Skip to content
Snippets Groups Projects
Commit 17783854 authored by Michiel van Galen's avatar Michiel van Galen
Browse files

Final additions

parent adfa52e4
No related branches found
No related tags found
No related merge requests found
...@@ -221,6 +221,13 @@ ...@@ -221,6 +221,13 @@
"- Interactive shell with improved user friendliness" "- Interactive shell with improved user friendliness"
] ]
}, },
{
"cell_type": "markdown",
"metadata": {},
"source": [
"$ ipython"
]
},
{ {
"cell_type": "markdown", "cell_type": "markdown",
"metadata": {}, "metadata": {},
...@@ -256,6 +263,13 @@ ...@@ -256,6 +263,13 @@
"- New notebooks can be created in that same directory" "- New notebooks can be created in that same directory"
] ]
}, },
{
"cell_type": "markdown",
"metadata": {},
"source": [
"$ ipython notebook"
]
},
{ {
"cell_type": "markdown", "cell_type": "markdown",
"metadata": {}, "metadata": {},
...@@ -285,6 +299,13 @@ ...@@ -285,6 +299,13 @@
"- Share notebooks easily with nbviewer" "- Share notebooks easily with nbviewer"
] ]
}, },
{
"cell_type": "markdown",
"metadata": {},
"source": [
"http://nbviewer.ipython.org/"
]
},
{ {
"cell_type": "heading", "cell_type": "heading",
"level": 1, "level": 1,
...@@ -349,8 +370,9 @@ ...@@ -349,8 +370,9 @@
"source": [ "source": [
"- Install locally\n", "- Install locally\n",
" - See instructions in this course\n", " - See instructions in this course\n",
" - Linux, Windows\n", " - Linux, Windows\n",
" \n", " - Type 'ipython notebook'\n",
" \n",
" \n", " \n",
"- Remotely, Shark cluster LUMC\n", "- Remotely, Shark cluster LUMC\n",
" - Connect to shark\n", " - Connect to shark\n",
...@@ -625,7 +647,7 @@ ...@@ -625,7 +647,7 @@
"cell_type": "markdown", "cell_type": "markdown",
"metadata": {}, "metadata": {},
"source": [ "source": [
"- Cells run asynchronous\n", "- Cells can be run individually\n",
"- Results are persistent\n", "- Results are persistent\n",
"- Save time by running intensive code blocks only once" "- Save time by running intensive code blocks only once"
] ]
...@@ -807,13 +829,41 @@ ...@@ -807,13 +829,41 @@
{ {
"metadata": {}, "metadata": {},
"output_type": "pyout", "output_type": "pyout",
"prompt_number": 47, "prompt_number": 1,
"text": [ "text": [
"0.7211185564561403" "0.21020888481775812"
] ]
} }
], ],
"prompt_number": 47 "prompt_number": 1
},
{
"cell_type": "heading",
"level": 4,
"metadata": {},
"source": [
"SHIFT-TAB shows help functions"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"numpy.random.random()"
],
"language": "python",
"metadata": {},
"outputs": [
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 5,
"text": [
"0.006939705725762635"
]
}
],
"prompt_number": 5
}, },
{ {
"cell_type": "heading", "cell_type": "heading",
...@@ -1486,7 +1536,8 @@ ...@@ -1486,7 +1536,8 @@
"**Bonus: Write a function which can test if there are short palindromic sequences in a longer piece of DNA**\n", "**Bonus: Write a function which can test if there are short palindromic sequences in a longer piece of DNA**\n",
"\n", "\n",
"- Try to find the palindromic sequences of at least length 6 in the sequence :\n", "- Try to find the palindromic sequences of at least length 6 in the sequence :\n",
" -GGGAGACATGTCTAACCGTTGTAAAA\n", "\n",
"**GGGAGACATGTCTAACCGTTGTAAAA**\n",
" \n", " \n",
"Hints:\n", "Hints:\n",
"\n", "\n",
......
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment