Final additions

05 - IPython Notebook.ipynb

@@ -221,6 +221,13 @@
       "- Interactive shell with improved user friendliness"
      ]
     },
+    {
+     "cell_type": "markdown",
+     "metadata": {},
+     "source": [
+      "$ ipython"
+     ]
+    },
     {
      "cell_type": "markdown",
      "metadata": {},
@@ -256,6 +263,13 @@
       "- New notebooks can be created in that same directory"
      ]
     },
+    {
+     "cell_type": "markdown",
+     "metadata": {},
+     "source": [
+      "$ ipython notebook"
+     ]
+    },
     {
      "cell_type": "markdown",
      "metadata": {},
@@ -285,6 +299,13 @@
       "- Share notebooks easily with nbviewer"
      ]
     },
+    {
+     "cell_type": "markdown",
+     "metadata": {},
+     "source": [
+      "http://nbviewer.ipython.org/"
+     ]
+    },
     {
      "cell_type": "heading",
      "level": 1,
@@ -349,8 +370,9 @@
      "source": [
       "- Install locally\n",
       "  - See instructions in this course\n",
-      "  - Linux, Windows\n",
-      "    \n",
+      "    - Linux, Windows\n",
+      "  - Type 'ipython notebook'\n",
+      "  \n",
       "    \n",
       "- Remotely, Shark cluster LUMC\n",
       "  - Connect to shark\n",
@@ -625,7 +647,7 @@
      "cell_type": "markdown",
      "metadata": {},
      "source": [
-      "- Cells run asynchronous\n",
+      "- Cells can be run individually\n",
       "- Results are persistent\n",
       "- Save time by running intensive code blocks only once"
      ]
@@ -807,13 +829,41 @@
       {
        "metadata": {},
        "output_type": "pyout",
-       "prompt_number": 47,
+       "prompt_number": 1,
        "text": [
-        "0.7211185564561403"
+        "0.21020888481775812"
        ]
       }
      ],
-     "prompt_number": 47
+     "prompt_number": 1
+    },
+    {
+     "cell_type": "heading",
+     "level": 4,
+     "metadata": {},
+     "source": [
+      "SHIFT-TAB shows help functions"
+     ]
+    },
+    {
+     "cell_type": "code",
+     "collapsed": false,
+     "input": [
+      "numpy.random.random()"
+     ],
+     "language": "python",
+     "metadata": {},
+     "outputs": [
+      {
+       "metadata": {},
+       "output_type": "pyout",
+       "prompt_number": 5,
+       "text": [
+        "0.006939705725762635"
+       ]
+      }
+     ],
+     "prompt_number": 5
     },
     {
      "cell_type": "heading",
@@ -1486,7 +1536,8 @@
       "**Bonus: Write a function which can test if there are short palindromic sequences in a longer piece of DNA**\n",
       "\n",
       "- Try to find the palindromic sequences of at least length 6 in the sequence :\n",
-      "  -GGGAGACATGTCTAACCGTTGTAAAA\n",
+      "\n",
+      "**GGGAGACATGTCTAACCGTTGTAAAA**\n",
       "  \n",
       "Hints:\n",
       "\n",