From 17783854cdb479e4ddf4528efcbea9b3c6468398 Mon Sep 17 00:00:00 2001 From: Michiel van Galen <m.van_galen@lumc.nl> Date: Fri, 11 Jul 2014 17:24:59 +0200 Subject: [PATCH] Final additions --- 05 - IPython Notebook.ipynb | 65 +++++++++++++++++++++++++++++++++---- 1 file changed, 58 insertions(+), 7 deletions(-) diff --git a/05 - IPython Notebook.ipynb b/05 - IPython Notebook.ipynb index 6988ad7..9cf3a8b 100644 --- a/05 - IPython Notebook.ipynb +++ b/05 - IPython Notebook.ipynb @@ -221,6 +221,13 @@ "- Interactive shell with improved user friendliness" ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "$ ipython" + ] + }, { "cell_type": "markdown", "metadata": {}, @@ -256,6 +263,13 @@ "- New notebooks can be created in that same directory" ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "$ ipython notebook" + ] + }, { "cell_type": "markdown", "metadata": {}, @@ -285,6 +299,13 @@ "- Share notebooks easily with nbviewer" ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "http://nbviewer.ipython.org/" + ] + }, { "cell_type": "heading", "level": 1, @@ -349,8 +370,9 @@ "source": [ "- Install locally\n", " - See instructions in this course\n", - " - Linux, Windows\n", - " \n", + " - Linux, Windows\n", + " - Type 'ipython notebook'\n", + " \n", " \n", "- Remotely, Shark cluster LUMC\n", " - Connect to shark\n", @@ -625,7 +647,7 @@ "cell_type": "markdown", "metadata": {}, "source": [ - "- Cells run asynchronous\n", + "- Cells can be run individually\n", "- Results are persistent\n", "- Save time by running intensive code blocks only once" ] @@ -807,13 +829,41 @@ { "metadata": {}, "output_type": "pyout", - "prompt_number": 47, + "prompt_number": 1, "text": [ - "0.7211185564561403" + "0.21020888481775812" ] } ], - "prompt_number": 47 + "prompt_number": 1 + }, + { + "cell_type": "heading", + "level": 4, + "metadata": {}, + "source": [ + "SHIFT-TAB shows help functions" + ] + }, + { + "cell_type": "code", + "collapsed": false, + "input": [ + "numpy.random.random()" + ], + "language": "python", + "metadata": {}, + "outputs": [ + { + "metadata": {}, + "output_type": "pyout", + "prompt_number": 5, + "text": [ + "0.006939705725762635" + ] + } + ], + "prompt_number": 5 }, { "cell_type": "heading", @@ -1486,7 +1536,8 @@ "**Bonus: Write a function which can test if there are short palindromic sequences in a longer piece of DNA**\n", "\n", "- Try to find the palindromic sequences of at least length 6 in the sequence :\n", - " -GGGAGACATGTCTAACCGTTGTAAAA\n", + "\n", + "**GGGAGACATGTCTAACCGTTGTAAAA**\n", " \n", "Hints:\n", "\n", -- GitLab