Skip to content
Snippets Groups Projects
Commit ae1a8c60 authored by Vermaat's avatar Vermaat
Browse files

Merge pull request #37 from LUMC/service-tests 

Add some JSON and SOAP service tests
parents b00a07d8 100f53b2
No related branches found
No related tags found
No related merge requests found
Hide whitespace changes
Inline Side-by-side
tests/test_services_json.py
+ 98
− 1
View file @ ae1a8c60
......@@ -200,4 +200,101 @@ class TestServicesJson(MutalyzerTest):
Get outer coordinates for gene that does not exist.
"""
with pytest.raises(Fault):
r = self._call('getGeneLocation', 'THISISNOTAGENE', 'hg19')
self._call('getGeneLocation', 'THISISNOTAGENE', 'hg19')
@fix(database, hg19, hg19_transcript_mappings)
def test_get_transcripts_mapping(self):
"""
Test output of getTranscriptsMapping.
"""
r = self._call('getTranscriptsMapping', 'hg19', 'chr11',
111955524, 111966518)
assert r == [{'cds_start': 111957632,
'cds_stop': 111965694,
'name': 'NM_003002',
'stop': 111966518,
'start': 111957571,
'version': 2,
'gene': 'SDHD',
'orientation': '+'},
{'cds_start': 111957492,
'cds_stop': 111956019,
'name': 'NM_012459',
'stop': 111955524,
'start': 111957522,
'version': 2,
'gene': 'TIMM8B',
'orientation': '-'},
{'cds_start': None,
'cds_stop': None,
'name': 'NR_028383',
'stop': 111955524,
'start': 111957522,
'version': 1,
'gene': 'TIMM8B',
'orientation': '-'}]
def test_description_extract(self):
"""
Test output of descriptionExtract.
"""
r = self._call('descriptionExtract',
'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
assert r == {'allele': [{'term': 0,
'end': 6,
'startAA': '',
'deleted': '',
'hgvsLength': 8,
'inserted': 'TT',
'start_offset': 0,
'start': 5,
'hgvs': '5_6insTT',
'shift': 1,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'ins'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': '',
'hgvsLength': 4,
'inserted': '',
'start_offset': 0,
'start': 17,
'hgvs': '17del',
'shift': 0,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'del'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': 'A',
'hgvsLength': 4,
'inserted': 'C',
'start_offset': 0,
'start': 26,
'hgvs': '26A>C',
'shift': 0,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'subst'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': '',
'hgvsLength': 4,
'inserted': '',
'start_offset': 0,
'start': 35,
'hgvs': '35dup',
'shift': 1,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'dup'}],
'description': '[5_6insTT;17del;26A>C;35dup]'}
tests/test_services_soap.py
+ 105
− 0
View file @ ae1a8c60
......@@ -711,3 +711,108 @@ facilisi."""
result = self._call('getBatchJob', job_id)
result = result.decode('base64').decode('utf-8').strip().split('\n')[1:]
assert expected == [line.split('\t') for line in result]
@fix(database, hg19, hg19_transcript_mappings)
def test_get_transcripts_mapping(self):
"""
Test output of getTranscriptsMapping.
"""
r = self._call('getTranscriptsMapping', 'hg19', 'chr11',
111955524, 111966518)
assert len(r.TranscriptMappingInfo) == 3
assert all(all(t_real[k] == t_expected[k] for k in t_expected)
for t_real, t_expected in
zip(r.TranscriptMappingInfo, [{'cds_start': 111957632,
'cds_stop': 111965694,
'name': 'NM_003002',
'stop': 111966518,
'start': 111957571,
'version': 2,
'gene': 'SDHD',
'orientation': '+'},
{'cds_start': 111957492,
'cds_stop': 111956019,
'name': 'NM_012459',
'stop': 111955524,
'start': 111957522,
'version': 2,
'gene': 'TIMM8B',
'orientation': '-'},
{'cds_start': None,
'cds_stop': None,
'name': 'NR_028383',
'stop': 111955524,
'start': 111957522,
'version': 1,
'gene': 'TIMM8B',
'orientation': '-'}]))
def test_description_extract(self):
"""
Test output of descriptionExtract.
"""
r = self._call('descriptionExtract',
'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
assert r['description'] == '[5_6insTT;17del;26A>C;35dup]'
assert len(r['allele'].RawVar) == 4
# For some reason, we get the empty string as `None` in SOAP.
assert all(all((v_real[k] == v_expected[k]) or not(v_real[k] or v_expected[k])
for k in v_expected)
for v_real, v_expected in
zip(r['allele'].RawVar, [{'term': 0,
'end': 6,
'startAA': '',
'deleted': '',
'hgvsLength': 8,
'inserted': 'TT',
'start_offset': 0,
'start': 5,
'hgvs': '5_6insTT',
'shift': 1,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'ins'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': '',
'hgvsLength': 4,
'inserted': '',
'start_offset': 0,
'start': 17,
'hgvs': '17del',
'shift': 0,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'del'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': 'A',
'hgvsLength': 4,
'inserted': 'C',
'start_offset': 0,
'start': 26,
'hgvs': '26A>C',
'shift': 0,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'subst'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': '',
'hgvsLength': 4,
'inserted': '',
'start_offset': 0,
'start': 35,
'hgvs': '35dup',
'shift': 1,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'dup'}]))
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment