diff --git a/tests/test_services_json.py b/tests/test_services_json.py
index 5ca81daef7b476993167fec26e1e7d47da2dbb81..c405422b8beafb70f5ffefc7c21a2a4380267bf8 100644
--- a/tests/test_services_json.py
+++ b/tests/test_services_json.py
@@ -200,4 +200,101 @@ class TestServicesJson(MutalyzerTest):
Get outer coordinates for gene that does not exist.
"""
with pytest.raises(Fault):
- r = self._call('getGeneLocation', 'THISISNOTAGENE', 'hg19')
+ self._call('getGeneLocation', 'THISISNOTAGENE', 'hg19')
+
+ @fix(database, hg19, hg19_transcript_mappings)
+ def test_get_transcripts_mapping(self):
+ """
+ Test output of getTranscriptsMapping.
+ """
+ r = self._call('getTranscriptsMapping', 'hg19', 'chr11',
+ 111955524, 111966518)
+ assert r == [{'cds_start': 111957632,
+ 'cds_stop': 111965694,
+ 'name': 'NM_003002',
+ 'stop': 111966518,
+ 'start': 111957571,
+ 'version': 2,
+ 'gene': 'SDHD',
+ 'orientation': '+'},
+ {'cds_start': 111957492,
+ 'cds_stop': 111956019,
+ 'name': 'NM_012459',
+ 'stop': 111955524,
+ 'start': 111957522,
+ 'version': 2,
+ 'gene': 'TIMM8B',
+ 'orientation': '-'},
+ {'cds_start': None,
+ 'cds_stop': None,
+ 'name': 'NR_028383',
+ 'stop': 111955524,
+ 'start': 111957522,
+ 'version': 1,
+ 'gene': 'TIMM8B',
+ 'orientation': '-'}]
+
+ def test_description_extract(self):
+ """
+ Test output of descriptionExtract.
+ """
+ r = self._call('descriptionExtract',
+ 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
+ 'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
+ assert r == {'allele': [{'term': 0,
+ 'end': 6,
+ 'startAA': '',
+ 'deleted': '',
+ 'hgvsLength': 8,
+ 'inserted': 'TT',
+ 'start_offset': 0,
+ 'start': 5,
+ 'hgvs': '5_6insTT',
+ 'shift': 1,
+ 'endAA': '',
+ 'DNA': True,
+ 'end_offset': 0,
+ 'type': 'ins'},
+ {'term': 0,
+ 'end': 0,
+ 'startAA': '',
+ 'deleted': '',
+ 'hgvsLength': 4,
+ 'inserted': '',
+ 'start_offset': 0,
+ 'start': 17,
+ 'hgvs': '17del',
+ 'shift': 0,
+ 'endAA': '',
+ 'DNA': True,
+ 'end_offset': 0,
+ 'type': 'del'},
+ {'term': 0,
+ 'end': 0,
+ 'startAA': '',
+ 'deleted': 'A',
+ 'hgvsLength': 4,
+ 'inserted': 'C',
+ 'start_offset': 0,
+ 'start': 26,
+ 'hgvs': '26A>C',
+ 'shift': 0,
+ 'endAA': '',
+ 'DNA': True,
+ 'end_offset': 0,
+ 'type': 'subst'},
+ {'term': 0,
+ 'end': 0,
+ 'startAA': '',
+ 'deleted': '',
+ 'hgvsLength': 4,
+ 'inserted': '',
+ 'start_offset': 0,
+ 'start': 35,
+ 'hgvs': '35dup',
+ 'shift': 1,
+ 'endAA': '',
+ 'DNA': True,
+ 'end_offset': 0,
+ 'type': 'dup'}],
+ 'description': '[5_6insTT;17del;26A>C;35dup]'}
diff --git a/tests/test_services_soap.py b/tests/test_services_soap.py
index 0a85844d07c0f5a95bcf9e00b1dbc183a591f6bf..df21a98fcfc0743524d17327f7e43c89942f8b15 100644
--- a/tests/test_services_soap.py
+++ b/tests/test_services_soap.py
@@ -711,3 +711,108 @@ facilisi."""
result = self._call('getBatchJob', job_id)
result = result.decode('base64').decode('utf-8').strip().split('\n')[1:]
assert expected == [line.split('\t') for line in result]
+
+ @fix(database, hg19, hg19_transcript_mappings)
+ def test_get_transcripts_mapping(self):
+ """
+ Test output of getTranscriptsMapping.
+ """
+ r = self._call('getTranscriptsMapping', 'hg19', 'chr11',
+ 111955524, 111966518)
+ assert len(r.TranscriptMappingInfo) == 3
+ assert all(all(t_real[k] == t_expected[k] for k in t_expected)
+ for t_real, t_expected in
+ zip(r.TranscriptMappingInfo, [{'cds_start': 111957632,
+ 'cds_stop': 111965694,
+ 'name': 'NM_003002',
+ 'stop': 111966518,
+ 'start': 111957571,
+ 'version': 2,
+ 'gene': 'SDHD',
+ 'orientation': '+'},
+ {'cds_start': 111957492,
+ 'cds_stop': 111956019,
+ 'name': 'NM_012459',
+ 'stop': 111955524,
+ 'start': 111957522,
+ 'version': 2,
+ 'gene': 'TIMM8B',
+ 'orientation': '-'},
+ {'cds_start': None,
+ 'cds_stop': None,
+ 'name': 'NR_028383',
+ 'stop': 111955524,
+ 'start': 111957522,
+ 'version': 1,
+ 'gene': 'TIMM8B',
+ 'orientation': '-'}]))
+
+ def test_description_extract(self):
+ """
+ Test output of descriptionExtract.
+ """
+ r = self._call('descriptionExtract',
+ 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
+ 'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
+ assert r['description'] == '[5_6insTT;17del;26A>C;35dup]'
+ assert len(r['allele'].RawVar) == 4
+ # For some reason, we get the empty string as `None` in SOAP.
+ assert all(all((v_real[k] == v_expected[k]) or not(v_real[k] or v_expected[k])
+ for k in v_expected)
+ for v_real, v_expected in
+ zip(r['allele'].RawVar, [{'term': 0,
+ 'end': 6,
+ 'startAA': '',
+ 'deleted': '',
+ 'hgvsLength': 8,
+ 'inserted': 'TT',
+ 'start_offset': 0,
+ 'start': 5,
+ 'hgvs': '5_6insTT',
+ 'shift': 1,
+ 'endAA': '',
+ 'DNA': True,
+ 'end_offset': 0,
+ 'type': 'ins'},
+ {'term': 0,
+ 'end': 0,
+ 'startAA': '',
+ 'deleted': '',
+ 'hgvsLength': 4,
+ 'inserted': '',
+ 'start_offset': 0,
+ 'start': 17,
+ 'hgvs': '17del',
+ 'shift': 0,
+ 'endAA': '',
+ 'DNA': True,
+ 'end_offset': 0,
+ 'type': 'del'},
+ {'term': 0,
+ 'end': 0,
+ 'startAA': '',
+ 'deleted': 'A',
+ 'hgvsLength': 4,
+ 'inserted': 'C',
+ 'start_offset': 0,
+ 'start': 26,
+ 'hgvs': '26A>C',
+ 'shift': 0,
+ 'endAA': '',
+ 'DNA': True,
+ 'end_offset': 0,
+ 'type': 'subst'},
+ {'term': 0,
+ 'end': 0,
+ 'startAA': '',
+ 'deleted': '',
+ 'hgvsLength': 4,
+ 'inserted': '',
+ 'start_offset': 0,
+ 'start': 35,
+ 'hgvs': '35dup',
+ 'shift': 1,
+ 'endAA': '',
+ 'DNA': True,
+ 'end_offset': 0,
+ 'type': 'dup'}]))