Skip to content
Snippets Groups Projects
Commit 101bcd0c authored by Vermaat's avatar Vermaat
Browse files

New version of NBIC poster based on comments by Peter 

git-svn-id: https://humgenprojects.lumc.nl/svn/mutalyzer/trunk@514 eb6bd6ab-9ccd-42b9-aceb-e2899b4a52f1
parent 2a564233
No related branches found
No related tags found
No related merge requests found
Hide whitespace changes
Inline Side-by-side
doc/Poster_24_25-04-12_NBIC_Mutalyzer2/poster.bbl
+ 0
− 6
View file @ 101bcd0c
......@@ -11,10 +11,4 @@ R.~Dalgleish and et~al.
\newblock {\em Genome Med}, 2:24, 2010.
\newblock See also {\small\texttt{http://www.lrg-sequence.org/}}.
\bibitem{LOVD}
I.F.A.C Fokkema, J.T. {den}~Dunnen, and P.E.M. Taschner.
\newblock {LOVD}: easy creation of a locus-specific sequence variation database
using an ``{LSDB-in-a-Box}'' approach.
\newblock {\em Human Mutation}, 26(2):63--68, 2005.
\end{thebibliography}
doc/Poster_24_25-04-12_NBIC_Mutalyzer2/poster.tex
+ 67
− 39
View file @ 101bcd0c
......@@ -36,16 +36,36 @@
PacBio) and the rise of sophisticated variant callers, the chance of
finding a complex variant increases and so does the need to describe these
variants.
\vspace{1cm}
\begin{figure}
{
\includegraphics[width = 0.8\textwidth, height = 19cm]{mutalyzerNameGenerator}
}
\caption{Name Generator describing an insertion on a genomic reference
sequence}
\label{figure:namegenerator}
\end{figure}
\vspace{1cm}
To aid in the construction of a variant description, Mutalyzer includes
the Name Generator (Fig.~\ref{figure:namegenerator}), alleviating the
need for knowledge of the HGVS recommendations. However, comparison of
reference and variant sequences still has to be done by the user and can
be a complex task.
}
\colorBlock{SalmonBg}{Description Extraction}{1}{
The description extractor can be used to construct variant descriptions
according to the HGVS recommendations. The algorithm closely follows the
human approach to describe a variant. It will first find the ``area of
change'' and then finds the largest overlap between the original area
and the area in the observed sequence. This process is repeated until
the smallest description is found. This not only helps clinicians to
generate the correct description, but its implementation also allows
automation of the description process.
The new Description Extractor can be used to automatically construct
variant descriptions according to the HGVS recommendations by sequence
comparison. The algorithm closely follows the human approach to
describe a variant. It will first find the ``area of change'' and then
finds the largest overlap between the original area and the area in the
variant sequence. This process is repeated until the smallest
description is found. This not only helps clinicians to generate the
correct description, but its implementation also allows automation of
the description process.
\vspace{1cm}
......@@ -53,8 +73,9 @@
\vspace{1cm}
\centerline{\texttt{ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA}}
\centerline{\texttt{ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA}}
\centerline{\texttt{\textcolor{blue}{A}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}~~\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{orange}{G}~\textcolor{blue}{A}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{blue}{A}}}
\centerline{\texttt{|||||~~|||||||||||~||||||||~|||||||||~||||}}
\centerline{\texttt{\textcolor{blue}{A}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{red}{T}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{green}{C}\textcolor{blue}{A}~\textcolor{red}{T}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{green}{C}\textcolor{green}{C}\textcolor{orange}{G}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{blue}{A}}}
\vspace{1cm}
......@@ -64,8 +85,8 @@
\vspace{1cm}
\begin{table}
\caption{Overview of the raw variants as provided by the description
extractor.}
\caption{Overview of the raw variants as provided by the Description
Extractor}
\colorbox{white}{
{\small
\begin{tabular}{l|l|l|l|l|l|l}
......@@ -80,23 +101,6 @@
}
\end{table}
}
\colorBlock{GreenBg}{Mutalyzer Interfaces}{1}{
\begin{tabular}{l@{\ \ --\ \ }p{25cm}}
Name Checker & Syntactic and semantic checks.$^*$
(Fig.~\ref{figure:namecheck}) \\
Syntax Checker & Syntactic checks only.$^*$ \\
Position Converter & Convert chromosomal positions to gene-centered
notation (no semantic check).$^*$ \\
SNP Converter & Convert a dbSNP rsId to HGVS notation.$^*$ \\
Name Generator & Contruct a HGVS notation. \\
Description Extractor & Extract HGVS notation from sequences. \\
GenBank Uploader & Upload custom GenBank files. \\
Webservices & Programmatic (SOAP) interface. \\
\end{tabular}
\bigskip
$^*$ {\small Also available as a batch interface.}
}
\colorBlock{YellowBg}{Acknowledgements}{1}{
{\small
Funded by the European Community's Seventh Framework Programme
......@@ -105,24 +109,48 @@
}
\nextColumn
\colorBlock{WhiteBg}{Conclusions}{1}{
With this proof-of-concept we have shown that it is feasible to
automatically generate correct variant descriptions following the HGVS
recommendations based on a comparison of the original sequence and the
observed sequence. The implementation relieves the user from the often
complex task of manually creating a description and guarantees
conformity to HGVS.
\vspace{1cm}
As future work we plan to implement description extraction from reference
sequences either identified by accession number or manually uploaded.
This will enable, for example, easy construction of descriptions for the
difference between two transcript reference sequences.
}
\colorBlock{BlueBg}{Name Checking}{1}{
\begin{figure}
{
\includegraphics[width = 0.95\textwidth, height = 57cm]{mutalyzerNameCheck}
}
\caption{Mutalyzer 2.0 Name Checker results using the CDKN2A LRG
reference sequence~\cite{LRG}}
\caption{Name Checker results using the CDKN2A LRG reference
sequence~\cite{LRG}}
\label{figure:namecheck}
\end{figure}
}
\colorBlock{WhiteBg}{Conclusions}{1}{
Variants at intergenic, exonic, intronic, CDS and UTR positions can be
easily distinguished based on their gene-centered HGVS descriptions.
Mutalyzer facilitates batch-wise conversion from dbSNP rsIDs or
chromosomal position numbering of next generation sequencing data to
transcript position numbering, as well as sequence variant checking of
locus-specific sequence variant databases (LSDBs)~\cite{LOVD}.
}
%\colorBlock{GreenBg}{Mutalyzer Interfaces (a Selection)}{1}{
% \begin{tabular}{l@{\ \ --\ \ }p{25cm}}
% Name Checker & Syntactic and semantic checks.$^*$
% (Fig.~\ref{figure:namecheck}) \\
% %Syntax Checker & Syntactic checks only.$^*$ \\
% Position Converter & Convert chromosomal positions to gene-centered
% notation (no semantic check).$^*$ \\
% %SNP Converter & Convert a dbSNP rsId to HGVS notation.$^*$ \\
% Name Generator & Contruct a HGVS notation. \\
% Description Extractor & Extract HGVS notation from sequences. \\
% %GenBank Uploader & Upload custom GenBank files. \\
% Webservices & Programmatic (SOAP) interface. \\
% \end{tabular}
% \bigskip
%
% $^*$ {\small Also available as a batch interface.}
%}
\colorBlock{Background}{References}{1}{
{\small
\bibliography{$HOME/projects/bibliography}{}
......
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment