From 101bcd0c928f43f483107ee99a0de8919f96671d Mon Sep 17 00:00:00 2001
From: Martijn Vermaat <martijn@vermaat.name>
Date: Thu, 19 Apr 2012 09:22:50 +0000
Subject: [PATCH] New version of NBIC poster based on comments by Peter
git-svn-id: https://humgenprojects.lumc.nl/svn/mutalyzer/trunk@514 eb6bd6ab-9ccd-42b9-aceb-e2899b4a52f1
---
.../poster.bbl | 6 -
.../poster.tex | 106 +++++++++++-------
2 files changed, 67 insertions(+), 45 deletions(-)
diff --git a/doc/Poster_24_25-04-12_NBIC_Mutalyzer2/poster.bbl b/doc/Poster_24_25-04-12_NBIC_Mutalyzer2/poster.bbl
index 56ee1b89..e84d0d83 100644
--- a/doc/Poster_24_25-04-12_NBIC_Mutalyzer2/poster.bbl
+++ b/doc/Poster_24_25-04-12_NBIC_Mutalyzer2/poster.bbl
@@ -11,10 +11,4 @@ R.~Dalgleish and et~al.
\newblock {\em Genome Med}, 2:24, 2010.
\newblock See also {\small\texttt{http://www.lrg-sequence.org/}}.
-\bibitem{LOVD}
-I.F.A.C Fokkema, J.T. {den}~Dunnen, and P.E.M. Taschner.
-\newblock {LOVD}: easy creation of a locus-specific sequence variation database
- using an ``{LSDB-in-a-Box}'' approach.
-\newblock {\em Human Mutation}, 26(2):63--68, 2005.
-
\end{thebibliography}
diff --git a/doc/Poster_24_25-04-12_NBIC_Mutalyzer2/poster.tex b/doc/Poster_24_25-04-12_NBIC_Mutalyzer2/poster.tex
index 879ca376..ef753fdf 100644
--- a/doc/Poster_24_25-04-12_NBIC_Mutalyzer2/poster.tex
+++ b/doc/Poster_24_25-04-12_NBIC_Mutalyzer2/poster.tex
@@ -36,16 +36,36 @@
PacBio) and the rise of sophisticated variant callers, the chance of
finding a complex variant increases and so does the need to describe these
variants.
+
+ \vspace{1cm}
+
+ \begin{figure}
+ {
+ \includegraphics[width = 0.8\textwidth, height = 19cm]{mutalyzerNameGenerator}
+ }
+ \caption{Name Generator describing an insertion on a genomic reference
+ sequence}
+ \label{figure:namegenerator}
+ \end{figure}
+
+ \vspace{1cm}
+
+ To aid in the construction of a variant description, Mutalyzer includes
+ the Name Generator (Fig.~\ref{figure:namegenerator}), alleviating the
+ need for knowledge of the HGVS recommendations. However, comparison of
+ reference and variant sequences still has to be done by the user and can
+ be a complex task.
}
\colorBlock{SalmonBg}{Description Extraction}{1}{
- The description extractor can be used to construct variant descriptions
- according to the HGVS recommendations. The algorithm closely follows the
- human approach to describe a variant. It will first find the ``area of
- change'' and then finds the largest overlap between the original area
- and the area in the observed sequence. This process is repeated until
- the smallest description is found. This not only helps clinicians to
- generate the correct description, but its implementation also allows
- automation of the description process.
+ The new Description Extractor can be used to automatically construct
+ variant descriptions according to the HGVS recommendations by sequence
+ comparison. The algorithm closely follows the human approach to
+ describe a variant. It will first find the ``area of change'' and then
+ finds the largest overlap between the original area and the area in the
+ variant sequence. This process is repeated until the smallest
+ description is found. This not only helps clinicians to generate the
+ correct description, but its implementation also allows automation of
+ the description process.
\vspace{1cm}
@@ -53,8 +73,9 @@
\vspace{1cm}
- \centerline{\texttt{ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA}}
- \centerline{\texttt{ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA}}
+ \centerline{\texttt{\textcolor{blue}{A}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}~~\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{orange}{G}~\textcolor{blue}{A}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{blue}{A}}}
+ \centerline{\texttt{|||||~~|||||||||||~||||||||~|||||||||~||||}}
+ \centerline{\texttt{\textcolor{blue}{A}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{red}{T}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{green}{C}\textcolor{blue}{A}~\textcolor{red}{T}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{green}{C}\textcolor{green}{C}\textcolor{orange}{G}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{red}{T}\textcolor{red}{T}\textcolor{blue}{A}\textcolor{orange}{G}\textcolor{orange}{G}\textcolor{blue}{A}\textcolor{green}{C}\textcolor{blue}{A}\textcolor{blue}{A}}}
\vspace{1cm}
@@ -64,8 +85,8 @@
\vspace{1cm}
\begin{table}
- \caption{Overview of the raw variants as provided by the description
- extractor.}
+ \caption{Overview of the raw variants as provided by the Description
+ Extractor}
\colorbox{white}{
{\small
\begin{tabular}{l|l|l|l|l|l|l}
@@ -80,23 +101,6 @@
}
\end{table}
}
- \colorBlock{GreenBg}{Mutalyzer Interfaces}{1}{
- \begin{tabular}{l@{\ \ --\ \ }p{25cm}}
- Name Checker & Syntactic and semantic checks.$^*$
- (Fig.~\ref{figure:namecheck}) \\
- Syntax Checker & Syntactic checks only.$^*$ \\
- Position Converter & Convert chromosomal positions to gene-centered
- notation (no semantic check).$^*$ \\
- SNP Converter & Convert a dbSNP rsId to HGVS notation.$^*$ \\
- Name Generator & Contruct a HGVS notation. \\
- Description Extractor & Extract HGVS notation from sequences. \\
- GenBank Uploader & Upload custom GenBank files. \\
- Webservices & Programmatic (SOAP) interface. \\
- \end{tabular}
- \bigskip
-
- $^*$ {\small Also available as a batch interface.}
- }
\colorBlock{YellowBg}{Acknowledgements}{1}{
{\small
Funded by the European Community's Seventh Framework Programme
@@ -105,24 +109,48 @@
}
\nextColumn
+ \colorBlock{WhiteBg}{Conclusions}{1}{
+ With this proof-of-concept we have shown that it is feasible to
+ automatically generate correct variant descriptions following the HGVS
+ recommendations based on a comparison of the original sequence and the
+ observed sequence. The implementation relieves the user from the often
+ complex task of manually creating a description and guarantees
+ conformity to HGVS.
+
+ \vspace{1cm}
+
+ As future work we plan to implement description extraction from reference
+ sequences either identified by accession number or manually uploaded.
+ This will enable, for example, easy construction of descriptions for the
+ difference between two transcript reference sequences.
+ }
\colorBlock{BlueBg}{Name Checking}{1}{
\begin{figure}
{
\includegraphics[width = 0.95\textwidth, height = 57cm]{mutalyzerNameCheck}
}
- \caption{Mutalyzer 2.0 Name Checker results using the CDKN2A LRG
- reference sequence~\cite{LRG}}
+ \caption{Name Checker results using the CDKN2A LRG reference
+ sequence~\cite{LRG}}
\label{figure:namecheck}
\end{figure}
}
- \colorBlock{WhiteBg}{Conclusions}{1}{
- Variants at intergenic, exonic, intronic, CDS and UTR positions can be
- easily distinguished based on their gene-centered HGVS descriptions.
- Mutalyzer facilitates batch-wise conversion from dbSNP rsIDs or
- chromosomal position numbering of next generation sequencing data to
- transcript position numbering, as well as sequence variant checking of
- locus-specific sequence variant databases (LSDBs)~\cite{LOVD}.
- }
+ %\colorBlock{GreenBg}{Mutalyzer Interfaces (a Selection)}{1}{
+ % \begin{tabular}{l@{\ \ --\ \ }p{25cm}}
+ % Name Checker & Syntactic and semantic checks.$^*$
+ % (Fig.~\ref{figure:namecheck}) \\
+ % %Syntax Checker & Syntactic checks only.$^*$ \\
+ % Position Converter & Convert chromosomal positions to gene-centered
+ % notation (no semantic check).$^*$ \\
+ % %SNP Converter & Convert a dbSNP rsId to HGVS notation.$^*$ \\
+ % Name Generator & Contruct a HGVS notation. \\
+ % Description Extractor & Extract HGVS notation from sequences. \\
+ % %GenBank Uploader & Upload custom GenBank files. \\
+ % Webservices & Programmatic (SOAP) interface. \\
+ % \end{tabular}
+ % \bigskip
+ %
+ % $^*$ {\small Also available as a batch interface.}
+ %}
\colorBlock{Background}{References}{1}{
{\small
\bibliography{$HOME/projects/bibliography}{}
--
GitLab