Commit daf0a0ba authored by bow's avatar bow
Browse files

Add tests for FastQC functionalities in Flexiprep

parent 1f0dda52
......@@ -39,5 +39,17 @@
# This file contains a list of potential contaminants which are
# frequently found in high throughput sequencing reactions. These
# are mostly sequences of adapters / primers used in the various
# sequencing chemistries.
# Please DO NOT rely on these sequences to design your own oligos, some
# of them are truncated at ambiguous positions, and none of them are
# definitive sequences from the manufacturers so don't blame us if you
# try to use them and they don't work.
# You can add more sequences to the file by putting one line per entry
# and specifying a name[tab]sequence. If the contaminant you add is
# likely to be of use to others please consider sending it to the FastQ
# authors, either via a bug report at
# or by directly emailing so other users of
# the program can benefit.
Illumina DpnII expression Adapter 1 ACAGGTTCAGAGTTCTACAGTCCGAC
Illumina DpnII expression Adapter 2 CAAGCAGAAGACGGCATACGA
Illumina DpnII expression PCR Primer 1 CAAGCAGAAGACGGCATACGA
Illumina DpnII expression Sequencing Primer CGACAGGTTCAGAGTTCTACAGTCCGACGATC
Illumina NlaIII expression Adapter 2 CAAGCAGAAGACGGCATACGA
Illumina NlaIII expression PCR Primer 1 CAAGCAGAAGACGGCATACGA
Illumina Multiplexing Adapter 1 GATCGGAAGAGCACACGTCT
Illumina Multiplexing Read1 Sequencing Primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Multiplexing Index Sequencing Primer GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Illumina Multiplexing Read2 Sequencing Primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
ABI Solid3 EF1 alpha Antisense Primer GAAAACCAAAGTGGTCCAC
* Biopet is built on top of GATK Queue for building bioinformatic
* pipelines. It is mainly intended to support LUMC SHARK cluster which is running
* SGE. But other types of HPC that are supported by GATK Queue (such as PBS)
* should also be able to execute Biopet tools and pipelines.
* Copyright 2014 Sequencing Analysis Support Core - Leiden University Medical Center
* Contact us at:
* A dual licensing mode is applied. The source code within this project that are
* not part of GATK Queue is freely available for non-commercial use under an AGPL
* license; For commercial users or users who do not want to follow the AGPL
* license, please contact us to obtain a separate license.
package nl.lumc.sasc.biopet.pipelines.flexiprep
import java.nio.file.Paths
import org.scalatest.Matchers
import org.scalatest.testng.TestNGSuite
import org.testng.annotations.Test
class FastqcV0101Test extends TestNGSuite with Matchers {
/** Returns the absolute path to test resource directory as a File object */
private val resourceDir: File = new File(Paths.get(getClass.getResource("/").toURI).toString)
/** Given a resource file name, returns the the absolute path to it as a File object */
private def resourceFile(p: String): File = new File(resourceDir, p)
/** Mock output file of a FastQC v0.10.1 run */
// the file doesn't actually exist, we just need it so the outputDir value can be computed correctly
private val outputv0101: File = resourceFile("")
@Test def testOutputDir() = {
val fqc = new Fastqc(null)
fqc.output = outputv0101
fqc.outputDir shouldBe new File(resourceDir, "v0101.fq_fastqc")
@Test def testQcModules() = {
val fqc = new Fastqc(null)
fqc.output = outputv0101
// 11 QC modules
fqc.qcModules.size shouldBe 11
// first module
fqc.qcModules.keySet should contain("Basic Statistics")
// mid (6th module)
fqc.qcModules.keySet should contain("Per sequence GC content")
// last module
fqc.qcModules.keySet should contain("Kmer Content")
@Test def testEncoding() = {
val fqc = new Fastqc(null)
fqc.output = outputv0101
fqc.encoding shouldBe "Sanger / Illumina 1.9"
@Test def testFoundAdapter() = {
val fqc = new Fastqc(null)
fqc.output = outputv0101
fqc.contaminants = Option(resourceFile("fqc_contaminants_v0101.txt"))
val adapters = fqc.foundAdapters
adapters.size shouldBe 1 should ===("TruSeq Adapter, Index 1")
// from fqc_contaminants_v0101.txt
\ No newline at end of file
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment