Apply `clippy` suggestions

lightmotif/benches/ecoli.rs

@@ -14,10 +14,8 @@ use lightmotif::seq::EncodedSequence;
 use lightmotif::utils::StrictlyPositive;
 use typenum::consts::U16;
 use typenum::consts::U32;
-use typenum::marker_traits::NonZero;
-use typenum::marker_traits::Unsigned;
 
-const SEQUENCE: &'static str = include_str!("ecoli.txt");
+const SEQUENCE: &str = include_str!("ecoli.txt");
 
 fn bench<C: StrictlyPositive, P: Score<Dna, C>>(bencher: &mut test::Bencher, pli: &P) {
     let encoded = EncodedSequence::<Dna>::from_str(SEQUENCE).unwrap();
@@ -34,7 +32,10 @@ fn bench<C: StrictlyPositive, P: Score<Dna, C>>(bencher: &mut test::Bencher, pli
     striped.configure(&pssm);
     let mut scores = StripedScores::new_for(&striped, &pssm);
     bencher.bytes = SEQUENCE.len() as u64;
-    bencher.iter(|| test::black_box(pli.score_into(&striped, &pssm, &mut scores)));
+    bencher.iter(|| {
+        pli.score_into(&striped, &pssm, &mut scores);
+        test::black_box(())
+    });
 }
 
 #[bench]

lightmotif/src/abc.rs

@@ -85,7 +85,7 @@ impl Alphabet for Dna {
 }
 
 /// A deoxyribonucleotide.
-#[derive(Clone, Copy, PartialEq, Debug)]
+#[derive(Clone, Copy, Debug, Default, PartialEq)]
 #[repr(u8)]
 pub enum Nucleotide {
     /// Adenine.
@@ -105,15 +105,10 @@ pub enum Nucleotide {
     /// ![guanine.png](https://www.ebi.ac.uk/chebi/displayImage.do?defaultImage=true&imageIndex=0&chebiId=16235)
     G = 3,
     /// Unknown base.
+    #[default]
     N = 4,
 }
 
-impl Default for Nucleotide {
-    fn default() -> Nucleotide {
-        Nucleotide::N
-    }
-}
-
 impl From<Nucleotide> for char {
     fn from(n: Nucleotide) -> char {
         n.as_char()
@@ -197,7 +192,7 @@ impl Alphabet for Protein {
 }
 
 /// A proteinogenic amino acid.
-#[derive(Clone, Copy, PartialEq, Debug)]
+#[derive(Clone, Copy, Default, Debug, PartialEq)]
 #[repr(u8)]
 pub enum AminoAcid {
     A = 0,
@@ -220,15 +215,10 @@ pub enum AminoAcid {
     V = 17,
     W = 18,
     Y = 19,
+    #[default]
     X = 20,
 }
 
-impl Default for AminoAcid {
-    fn default() -> Self {
-        AminoAcid::X
-    }
-}
-
 impl From<AminoAcid> for char {
     fn from(aa: AminoAcid) -> char {
         aa.as_char()
@@ -315,7 +305,7 @@ impl<A: Alphabet> Background<A> {
         let frequencies = frequencies.into();
         let mut sum = 0.0;
         for &f in frequencies.iter() {
-            if f < 0.0 || f > 1.0 {
+            if !(0.0..=1.0).contains(&f) {
                 return Err(InvalidData);
             }
             sum += f;
@@ -324,7 +314,7 @@ impl<A: Alphabet> Background<A> {
             return Err(InvalidData);
         }
         Ok(Self {
-            frequencies: frequencies.into(),
+            frequencies,
             alphabet: std::marker::PhantomData,
         })
     }
@@ -346,7 +336,6 @@ impl<A: Alphabet> Background<A> {
     /// ```
     pub fn uniform() -> Self {
         let frequencies = (0..A::K::USIZE)
-            .into_iter()
             .map(|i| {
                 if i != A::default_symbol().as_index() {
                     1.0 / ((A::K::USIZE - 1) as f32)
@@ -410,7 +399,7 @@ impl<A: Alphabet> From<GenericArray<f32, A::K>> for Pseudocounts<A> {
     fn from(counts: GenericArray<f32, A::K>) -> Self {
         Self {
             alphabet: std::marker::PhantomData,
-            counts: counts.into(),
+            counts,
         }
     }
 }
@@ -418,7 +407,6 @@ impl<A: Alphabet> From<GenericArray<f32, A::K>> for Pseudocounts<A> {
 impl<A: Alphabet> From<f32> for Pseudocounts<A> {
     fn from(count: f32) -> Self {
         let counts = (0..A::K::USIZE)
-            .into_iter()
             .map(|i| {
                 if i != A::default_symbol().as_index() {
                     count

lightmotif/src/dense.rs

@@ -51,7 +51,7 @@ impl<T: Default + Copy, C: Unsigned> DenseMatrix<T, C> {
         }
 
         // record indices to each rows
-        let indices = (0..rows).into_iter().map(|i| offset + i * c).collect();
+        let indices = (0..rows).map(|i| offset + i * c).collect();
 
         Self {
             data,

lightmotif/src/pli/platform/sse2.rs

@@ -42,10 +42,7 @@ unsafe fn score_sse2<A, C>(
     let zero = _mm_setzero_si128();
     // process columns of the striped matrix, any multiple of 16 is supported
     let data = scores.matrix_mut();
-    for offset in (0..<C as Div<U16>>::Output::USIZE)
-        .into_iter()
-        .map(|i| i * <Sse2 as Backend>::LANES::USIZE)
-    {
+    for offset in (0..<C as Div<U16>>::Output::USIZE).map(|i| i * <Sse2 as Backend>::LANES::USIZE) {
         // process every position of the sequence data
         for i in 0..seq.data.rows() - seq.wrap {
             // reset sums for current position
@@ -81,7 +78,7 @@ unsafe fn score_sse2<A, C>(
             }
             // record the score for the current position
             let row = &mut data[i];
-            _mm_storeu_ps(row[offset + 0..].as_mut_ptr(), s1);
+            _mm_storeu_ps(row[offset..].as_mut_ptr(), s1);
             _mm_storeu_ps(row[offset + 4..].as_mut_ptr(), s2);
             _mm_storeu_ps(row[offset + 8..].as_mut_ptr(), s3);
             _mm_storeu_ps(row[offset + 12..].as_mut_ptr(), s4);

lightmotif/src/pli/scores.rs

@@ -77,7 +77,7 @@ impl<C: Unsigned + NonZero> StripedScores<C> {
 
     /// Iterate over scores of individual sequence positions.
     pub fn iter(&self) -> Iter<'_, C> {
-        Iter::new(&self)
+        Iter::new(self)
     }
 
     /// Convert the striped scores to a vector of scores.

lightmotif/src/pwm.rs

@@ -91,7 +91,7 @@ impl<A: Alphabet> CountMatrix<A> {
             let src = &self.data[i];
             let dst = &mut probas[i];
             for (j, &x) in src.iter().enumerate() {
-                dst[j] = x as f32 + p.counts()[j] as f32;
+                dst[j] = x as f32 + p.counts()[j];
             }
             let s: f32 = dst.iter().sum();
             for x in dst.iter_mut() {
@@ -289,7 +289,7 @@ impl<A: ComplementableAlphabet> WeightMatrix<A> {
 
 impl<A: Alphabet> AsRef<WeightMatrix<A>> for WeightMatrix<A> {
     fn as_ref(&self) -> &Self {
-        &self
+        self
     }
 }
 
@@ -361,7 +361,7 @@ impl<A: Alphabet> ScoringMatrix<A> {
 
 impl<A: Alphabet> AsRef<ScoringMatrix<A>> for ScoringMatrix<A> {
     fn as_ref(&self) -> &Self {
-        &self
+        self
     }
 }
 

lightmotif/src/seq.rs

@@ -80,7 +80,7 @@ impl<A: Alphabet> EncodedSequence<A> {
 
 impl<A: Alphabet> AsRef<EncodedSequence<A>> for EncodedSequence<A> {
     fn as_ref(&self) -> &Self {
-        &self
+        self
     }
 }
 
@@ -148,7 +148,7 @@ impl<A: Alphabet, C: StrictlyPositive> StripedSequence<A, C> {
 
 impl<A: Alphabet, C: StrictlyPositive> AsRef<StripedSequence<A, C>> for StripedSequence<A, C> {
     fn as_ref(&self) -> &Self {
-        &self
+        self
     }
 }
 

lightmotif/tests/dna.rs

@@ -13,8 +13,8 @@ use typenum::consts::U1;
 use typenum::consts::U16;
 use typenum::consts::U32;
 
-const SEQUENCE: &'static str = "ATGTCCCAACAACGATACCCCGAGCCCATCGCCGTCATCGGCTCGGCATGCAGATTCCCAGGCG";
-const PATTERNS: &[&'static str] = &["GTTGACCTTATCAAC", "GTTGATCCAGTCAAC"];
+const SEQUENCE: &str = "ATGTCCCAACAACGATACCCCGAGCCCATCGCCGTCATCGGCTCGGCATGCAGATTCCCAGGCG";
+const PATTERNS: &[&str] = &["GTTGACCTTATCAAC", "GTTGATCCAGTCAAC"];
 
 // scores computed with Bio.motifs
 #[rustfmt::skip]