Changed location of the figures

05 - IPython Notebook.ipynb

@@ -203,7 +203,7 @@
      "cell_type": "markdown",
      "metadata": {},
      "source": [
-      "![interpreter](https://raw.githubusercontent.com/jrjohansson/scientific-python-lectures/master/images/python-screenshot.jpg)"
+      "![Python interpreter](images/python-screenshot.jpg)"
      ]
     },
     {
@@ -225,7 +225,7 @@
      "cell_type": "markdown",
      "metadata": {},
      "source": [
-      "![ipython](https://raw.githubusercontent.com/jrjohansson/scientific-python-lectures/master/images/ipython-screenshot.jpg)"
+      "![Ipython](images/ipython-screenshot.jpg)"
      ]
     },
     {
@@ -260,7 +260,7 @@
      "cell_type": "markdown",
      "metadata": {},
      "source": [
-      "![notebook](https://raw.githubusercontent.com/jrjohansson/scientific-python-lectures/master/images/ipython-notebook-screenshot.jpg)"
+      "![Ipython notebook](images/ipython-notebook-screenshot.jpg)"
      ]
     },
     {
@@ -437,7 +437,7 @@
      "cell_type": "markdown",
      "metadata": {},
      "source": [
-      "![Toolbar](http://nbviewer.ipython.org/github/ipython/ipython/blob/2.x/examples/Notebook/images/menubar_toolbar.png)"
+      "![Toolbar](images/menubar_toolbar.png)"
      ]
     },
     {
@@ -829,10 +829,13 @@
      "source": [
       "Start a Notebook session.\n",
       "  - $ ipython notebook\n",
+      "\n",
       "This opens a webbrowser and shows existing notebooks.\n",
       "  - Create a new notebook by clicking the 'New notebook' button.\n",
+      "\n",
       "A new tab will open with a fresh notebook. Rename your notebook to something useful\n",
       "  - Click on the current name (Untitled1) and edit this\n",
+      "\n",
       "Add the code shown below to some **_code_** cells\n",
       "  - Add cells by pressen the '+' button or ALT+ENTER\n",
       "  - Remember the keyboard shortcuts or the help function ('h')\n",
@@ -845,7 +848,7 @@
      "cell_type": "code",
      "collapsed": false,
      "input": [
-      "def translate(seq):\n",
+      "def complement(seq):\n",
       "    complements = {'A': 'T', 'C': 'G', 'T': 'A', 'G': 'C'}\n",
       "    c_seq  = ''\n",
       "    for n in seq:\n",
@@ -1134,9 +1137,9 @@
      ]
     },
     {
-     "cell_type": "raw",
-     "metadata": {},
-     "source": [
+     "cell_type": "code",
+     "collapsed": false,
+     "input": [
       "<table border=\"1\" style=\"width:200px\">\n",
       "<tr>\n",
       "  <td>Jill</td>\n",
@@ -1149,7 +1152,10 @@
       "  <td>94</td>\n",
       "</tr>\n",
       "</table>"
-     ]
+     ],
+     "language": "python",
+     "metadata": {},
+     "outputs": []
     },
     {
      "cell_type": "markdown",
@@ -1185,11 +1191,14 @@
      ]
     },
     {
-     "cell_type": "raw",
-     "metadata": {},
-     "source": [
+     "cell_type": "code",
+     "collapsed": false,
+     "input": [
       "\\begin{equation*} \\left( \\sum_{k=1}^n a_k b_k \\right)^2 \\leq \\left( \\sum_{k=1}^n a_k^2 \\right) \\left( \\sum_{k=1}^n b_k^2 \\right) \\end{equation*}\n"
-     ]
+     ],
+     "language": "python",
+     "metadata": {},
+     "outputs": []
     },
     {
      "cell_type": "markdown",
@@ -1214,11 +1223,14 @@
      ]
     },
     {
-     "cell_type": "markdown",
-     "metadata": {},
-     "source": [
+     "cell_type": "code",
+     "collapsed": false,
+     "input": [
       "![LUMC](https://www.lumc.nl/images/html5/logo-lumc.png)"
-     ]
+     ],
+     "language": "python",
+     "metadata": {},
+     "outputs": []
     },
     {
      "cell_type": "markdown",
@@ -1270,13 +1282,13 @@
        ],
        "metadata": {},
        "output_type": "pyout",
-       "prompt_number": 34,
+       "prompt_number": 1,
        "text": [
-        "<IPython.lib.display.YouTubeVideo at 0x331c850>"
+        "<IPython.lib.display.YouTubeVideo at 0x3224890>"
        ]
       }
      ],
-     "prompt_number": 34
+     "prompt_number": 1
     },
     {
      "cell_type": "heading",
@@ -1448,7 +1460,7 @@
      "metadata": {},
      "source": [
       "\n",
-      "<a href=\"url\"><img src=\"http://upload.wikimedia.org/wikipedia/commons/thumb/7/75/DNA_palindrome.svg/1590px-DNA_palindrome.svg.png\" align=\"center\" width=\"500\" ></a>\n"
+      "<img src=\"https://git.lumc.nl/humgen/programming-course/raw/master/images/1590px-DNA_palindrome.svg.png\" align=\"center\" width=\"400\" >\n"
      ]
     },
     {
@@ -1464,9 +1476,17 @@
      "metadata": {},
      "source": [
       " - Think of function which can test if a sequence is palindromic\n",
-      "   - Use the functions 'translate' and 'reverse'\n",
+      "   - Use the functions 'complement' and 'reverse'\n",
       " - Nicely formatted mardown cell(s) explaining the notebook\n",
-      "   - Add links as references like the one above\n"
+      "   - Add links as references like the one above\n",
+      "\n",
+      "**Bonus: Write a function which can test if there are short palindromic sequences in a longer piece of DNA**\n",
+      "\n",
+      "- Try to find the palindromic seqeuences of at least length 6 in the sequence : GGGAGACATGTCTAACCGTTGTAAAA\n",
+      "- Implement your current functions in a new function\n",
+      "- Begin to iterate over a sequence and find a palindrome of size 2\n",
+      "- Continue to work from there and expand your test\n",
+      "- Can a palindromic sequence have an odd length?\n"
      ]
     },
     {