Skip to content
Snippets Groups Projects
Commit 7c1c41be authored by Michiel van Galen's avatar Michiel van Galen
Browse files

Changed location of the figures

parent 68649d37
No related branches found
No related tags found
No related merge requests found
......@@ -203,7 +203,7 @@
"cell_type": "markdown",
"metadata": {},
"source": [
"![interpreter](https://raw.githubusercontent.com/jrjohansson/scientific-python-lectures/master/images/python-screenshot.jpg)"
"![Python interpreter](images/python-screenshot.jpg)"
]
},
{
......@@ -225,7 +225,7 @@
"cell_type": "markdown",
"metadata": {},
"source": [
"![ipython](https://raw.githubusercontent.com/jrjohansson/scientific-python-lectures/master/images/ipython-screenshot.jpg)"
"![Ipython](images/ipython-screenshot.jpg)"
]
},
{
......@@ -260,7 +260,7 @@
"cell_type": "markdown",
"metadata": {},
"source": [
"![notebook](https://raw.githubusercontent.com/jrjohansson/scientific-python-lectures/master/images/ipython-notebook-screenshot.jpg)"
"![Ipython notebook](images/ipython-notebook-screenshot.jpg)"
]
},
{
......@@ -437,7 +437,7 @@
"cell_type": "markdown",
"metadata": {},
"source": [
"![Toolbar](http://nbviewer.ipython.org/github/ipython/ipython/blob/2.x/examples/Notebook/images/menubar_toolbar.png)"
"![Toolbar](images/menubar_toolbar.png)"
]
},
{
......@@ -829,10 +829,13 @@
"source": [
"Start a Notebook session.\n",
" - $ ipython notebook\n",
"\n",
"This opens a webbrowser and shows existing notebooks.\n",
" - Create a new notebook by clicking the 'New notebook' button.\n",
"\n",
"A new tab will open with a fresh notebook. Rename your notebook to something useful\n",
" - Click on the current name (Untitled1) and edit this\n",
"\n",
"Add the code shown below to some **_code_** cells\n",
" - Add cells by pressen the '+' button or ALT+ENTER\n",
" - Remember the keyboard shortcuts or the help function ('h')\n",
......@@ -845,7 +848,7 @@
"cell_type": "code",
"collapsed": false,
"input": [
"def translate(seq):\n",
"def complement(seq):\n",
" complements = {'A': 'T', 'C': 'G', 'T': 'A', 'G': 'C'}\n",
" c_seq = ''\n",
" for n in seq:\n",
......@@ -1134,9 +1137,9 @@
]
},
{
"cell_type": "raw",
"metadata": {},
"source": [
"cell_type": "code",
"collapsed": false,
"input": [
"<table border=\"1\" style=\"width:200px\">\n",
"<tr>\n",
" <td>Jill</td>\n",
......@@ -1149,7 +1152,10 @@
" <td>94</td>\n",
"</tr>\n",
"</table>"
]
],
"language": "python",
"metadata": {},
"outputs": []
},
{
"cell_type": "markdown",
......@@ -1185,11 +1191,14 @@
]
},
{
"cell_type": "raw",
"metadata": {},
"source": [
"cell_type": "code",
"collapsed": false,
"input": [
"\\begin{equation*} \\left( \\sum_{k=1}^n a_k b_k \\right)^2 \\leq \\left( \\sum_{k=1}^n a_k^2 \\right) \\left( \\sum_{k=1}^n b_k^2 \\right) \\end{equation*}\n"
]
],
"language": "python",
"metadata": {},
"outputs": []
},
{
"cell_type": "markdown",
......@@ -1214,11 +1223,14 @@
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"cell_type": "code",
"collapsed": false,
"input": [
"![LUMC](https://www.lumc.nl/images/html5/logo-lumc.png)"
]
],
"language": "python",
"metadata": {},
"outputs": []
},
{
"cell_type": "markdown",
......@@ -1270,13 +1282,13 @@
],
"metadata": {},
"output_type": "pyout",
"prompt_number": 34,
"prompt_number": 1,
"text": [
"<IPython.lib.display.YouTubeVideo at 0x331c850>"
"<IPython.lib.display.YouTubeVideo at 0x3224890>"
]
}
],
"prompt_number": 34
"prompt_number": 1
},
{
"cell_type": "heading",
......@@ -1448,7 +1460,7 @@
"metadata": {},
"source": [
"\n",
"<a href=\"url\"><img src=\"http://upload.wikimedia.org/wikipedia/commons/thumb/7/75/DNA_palindrome.svg/1590px-DNA_palindrome.svg.png\" align=\"center\" width=\"500\" ></a>\n"
"<img src=\"https://git.lumc.nl/humgen/programming-course/raw/master/images/1590px-DNA_palindrome.svg.png\" align=\"center\" width=\"400\" >\n"
]
},
{
......@@ -1464,9 +1476,17 @@
"metadata": {},
"source": [
" - Think of function which can test if a sequence is palindromic\n",
" - Use the functions 'translate' and 'reverse'\n",
" - Use the functions 'complement' and 'reverse'\n",
" - Nicely formatted mardown cell(s) explaining the notebook\n",
" - Add links as references like the one above\n"
" - Add links as references like the one above\n",
"\n",
"**Bonus: Write a function which can test if there are short palindromic sequences in a longer piece of DNA**\n",
"\n",
"- Try to find the palindromic seqeuences of at least length 6 in the sequence : GGGAGACATGTCTAACCGTTGTAAAA\n",
"- Implement your current functions in a new function\n",
"- Begin to iterate over a sequence and find a palindrome of size 2\n",
"- Continue to work from there and expand your test\n",
"- Can a palindromic sequence have an odd length?\n"
]
},
{
......
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment