Skip to content
Snippets Groups Projects
Commit 55d10b82 authored by Jeroen F.J. Laros's avatar Jeroen F.J. Laros Committed by Vermaat
Browse files

New description extractor web interface 

We can now compare two sequences by supplying their sequence strings,
accession numbers, or uploaded file.
parent 8d1e898a
No related branches found
No related tags found
No related merge requests found
Hide whitespace changes
Inline Side-by-side
Showing
with 546 additions and 217 deletions
mutalyzer/util.py
+ 41
− 0
View file @ 55d10b82
......@@ -29,6 +29,7 @@ import operator
import sys
import time
from Bio import SeqIO
from Bio.SeqUtils import seq3
# NOTE: This is a temporary fix.
......@@ -352,6 +353,46 @@ def is_dna(s):
#is_dna
def guess_file_type(handle):
"""
Guess the file type of an NGS data file.
We assume that the stream is rewinded before use, after use, the input
stream will be rewinded.
:arg stream handle: Open readable handle to an NGS data file.
:returns unicode: Either 'fasta', 'fastq' or 'text'.
"""
token = handle.read(1)
handle.seek(0)
if token == '>':
return 'fasta'
elif token == '@':
return 'fastq'
return 'text'
def read_dna(handle):
"""
Read the first record in an NGS data file.
If the format is not recognised as FASTA or FASTQ, we assume that the input
is in plain text. In this case, all non-DNA characters are removed.
:arg stream handle: Open readable handle to an NGS data file.
:returns unicode: Content of the first record in the file.
"""
file_format = guess_file_type(handle)
if file_format != 'text':
return unicode(SeqIO.parse(handle, file_format).next().seq)
return ''.join(x for x in unicode(handle.read()) if x in 'ATCG')
def in_frame_description(s1, s2) :
"""
Give a description of an inframe difference of two proteins. Also give
......
mutalyzer/website/templates/description-extractor.html
+ 159
− 24
View file @ 55d10b82
......@@ -5,7 +5,7 @@
{% block content %}
<p class="alert alert-warning">Note that this is an experimental service.</p
<p class="alert alert-warning">Note that this is an experimental service.</p>
<p>
Extract the HGVS variant description from a reference sequence and an observed
......@@ -29,16 +29,115 @@ testing phase, we plan to use the underlying algorithm for:
Please supply a reference sequence and an observed sequence.
</p>
<form action="{{ url_for('.description_extractor') }}" method="get" class="form">
<div class="form-group">
<label for="reference_sequence">Reference sequence</label>
<input type="text" name="reference_sequence" id="reference_sequence" value="{{ reference_sequence }}" class="form-control form-pre example-target" placeholder="Reference sequence">
<p>Example: <code class="example-input">ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA</code></p>
<form enctype="multipart/form-data" action="{{ url_for('.description_extractor') }}" method="post" class="form" id="invoer">
<div class="row">
<h4>Reference input</h4>
<div class="col-md-6">
<div class="form-group" id="input-methods">
<div class="radio">
<label>
<input type="radio" name="reference_method" value="raw_method" class="input-select" data-context="select-form1" data-for="reference_raw_method" {{ 'checked' if reference_method == 'raw_method' or not reference_method }}>
Raw sequence.
</label>
</div>
<div class="radio">
<label>
<input type="radio" name="reference_method" value="file_method" class="input-select" data-context="select-form1" data-for="reference_file_method" {{ 'checked' if reference_method == 'file_method' }}>
FASTA/FASTQ/text file.
</label>
</div>
<div class="radio">
<label>
<input type="radio" name="reference_method" value="refseq_method" class="input-select" data-context="select-form1" data-for="reference_refseq_method" {{ 'checked' if reference_method == 'refseq_method' }}>
RefSeq accession number.
</label>
</div>
</div>
</div>
<div id="select-form1">
<div class="col-md-6">
<div class="subform" id="reference_raw_method" style="display: {{ '' if reference_method == 'raw_method' or not reference_method else 'none' }}">
<div class="form-group">
<label for="reference_sequence">Reference sequence</label>
<textarea name="reference_sequence" id="reference_sequence" class="form-control form-pre example-target" placeholder="Reference sequence">{{ reference_sequence }}</textarea>
<p>Example: <code class="example-input" data-for="reference_sequence">ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA</code></p>
</div>
</div>
</div>
<div class="col-md-6">
<div class="subform" id="reference_file_method" style="display: {{ 'none' if reference_method != 'file_method' }}">
<div class="form-group">
<label for="reference_file">Reference file</label>
<input type="file" name="reference_file" id="reference_file">
</div>
</div>
</div>
<div class="col-md-6">
<div class="subform" id="reference_refseq_method" style="display: {{ 'none' if reference_method != 'refseq_method' }}">
<div class="form-group">
<label for="reference_accession_number">Reference accession number</label>
<input type="text" name="reference_accession_number" id="reference_accession_number" value="{{ reference_accession_number }}" class="form-control form-pre example-target" placeholder="Reference accession number">
<p>Example: <code class="example-input" data-for="reference_accession_number">NM_004006.1</code></p>
</div>
</div>
</div>
</div>
</div>
<div class="form-group">
<label for="variant_sequence">Observed sequence</label>
<input type="text" name="variant_sequence" id="variant_sequence" value="{{ variant_sequence }}" class="form-control form-pre example-target-2" placeholder="Observed sequence">
<p>Example: <code class="example-input-2">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
<div class="row">
<h4>Sample input</h4>
<div class="col-md-6">
<div class="form-group" id="input-methods">
<div class="radio">
<label>
<input type="radio" name="sample_method" value="raw_method" class="input-select" data-context="select-form2" data-for="sample_raw_method" {{ 'checked' if sample_method == 'raw_method' or not sample_method }}>
Raw sequence.
</label>
</div>
<div class="radio">
<label>
<input type="radio" name="sample_method" value="file_method" class="input-select" data-context="select-form2" data-for="sample_file_method" {{ 'checked' if sample_method == 'file_method' }}>
FASTA/FASTQ/text file.
</label>
</div>
<div class="radio">
<label>
<input type="radio" name="sample_method" value="refseq_method" class="input-select" data-context="select-form2" data-for="sample_refseq_method" {{ 'checked' if sample_method == 'refseq_method' }}>
RefSeq accession number.
</label>
</div>
</div>
</div>
<div id="select-form2">
<div class="col-md-6">
<div class="subform" id="sample_raw_method" style="display: {{ '' if sample_method == 'raw_method' or not sample_method else 'none' }}">
<div class="form-group">
<label for="sample_sequence">Sample sequence</label>
<textarea name="sample_sequence" id="sample_sequence" class="form-control form-pre example-target-2" placeholder="Sample sequence">{{ sample_sequence }}</textarea>
<p>Example: <code class="example-input" data-for="sample_sequence">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
</div>
</div>
</div>
<div class="col-md-6">
<div class="subform" id="sample_file_method" style="display: {{ 'none' if sample_method != 'file_method' }}">
<div class="form-group">
<label for="sample_file">Reference file</label>
<input type="file" name="sample_file" id="sample_file">
</div>
</div>
</div>
<div class="col-md-6">
<div class="subform" id="sample_refseq_method" style="display: {{ 'none' if sample_method != 'refseq_method' }}">
<div class="form-group">
<label for="sample_accession_number">Sample accession number</label>
<input type="text" name="sample_accession_number" id="sample_accession_number" value="{{ sample_accession_number }}" class="form-control form-pre example-target-2" placeholder="Sample accession number">
<p>Example: <code class="example-input" data-for="sample_accession_number">NM_004006.2</code></p>
</div>
</div>
</div>
</div>
</div>
<div class="form-group">
<input type="submit" class="btn btn-primary" value="Extract variant description">
......@@ -46,7 +145,7 @@ Please supply a reference sequence and an observed sequence.
</div>
</form>
{% if description %}
{% if reference_method and sample_method %}
<hr>
{% for m in messages %}
{% if m.class == "error" %}
......@@ -69,8 +168,44 @@ Please supply a reference sequence and an observed sequence.
{% if not errors %}
<hr>
<h4>Genomic description</h4>
<p><code>g.{{ description }}</code></p>
<h4>Input</h4>
<table class="table">
<thead>
<tr>
<th>Field</th>
<th>Value</th>
</tr>
</thead>
<tbody>
<tr>
<td>Reference input</td>
<td>
{% if reference_method == 'raw_method' %}
<code>{{ reference_sequence|short(40) }}</code>
{% elif reference_method == 'file_method' %}
File upload
{% elif reference_method == 'refseq_method' %}
{{ reference_accession_number }}
{% endif %}
</td>
</tr>
<tr>
<td>Sample input</td>
<td>
{% if sample_method == 'raw_method' %}
<code>{{ sample_sequence|short(40) }}</code>
{% elif sample_method == 'file_method' %}
File upload
{% elif sample_method == 'refseq_method' %}
{{ sample_accession_number }}
{% endif %}
</td>
</tr>
</tbody>
</table>
<h4>Description</h4>
<p><pre class="description">{{ raw_vars|string }}</pre></p>
<h4>Overview of the raw variants</h4>
<table class="table">
......@@ -86,17 +221,17 @@ Please supply a reference sequence and an observed sequence.
</tr>
</thead>
<tbody>
{% for raw_var in raw_vars %}
<tr>
<td>{{ raw_var.start }}</td>
<td>{{ raw_var.end }}</td>
<td>{{ raw_var.type }}</td>
<td>{{ raw_var.deleted }}</td>
<td>{{ raw_var.inserted }}</td>
<td>{{ raw_var.shift }}</td>
<td>{{ raw_var }}</td>
</tr>
{% endfor %}
{% for raw_var in raw_vars %}
<tr>
<td>{{ raw_var.start }}</td>
<td>{{ raw_var.end }}</td>
<td>{{ raw_var.type }}</td>
<td><code>{{ raw_var.deleted|string|short }}</code></td>
<td><code>{{ raw_var.inserted|string|short }}</code></td>
<td>{{ raw_var.shift }}</td>
<td>{% if raw_var|string|length > 20 %}Too long to show{% else %}<code>{{ raw_var|string }}</code>{% endif %}</td>
</tr>
{% endfor %}
</tbody>
</table>
{% endif %}{# not errors #}
......
mutalyzer/website/templates/reference-loader.html
+ 92
− 98
View file @ 55d10b82
......@@ -5,14 +5,6 @@
{% block content %}
<script>
var oldLoad = window.onload;
window.onload=function(){
if (oldLoad) oldLoad();
updateVisibility();
}
</script>
<p>
The Reference File Loader allows you to use your own reference
sequence when no appropriate RefSeq, GenBank or LRG file is available.
......@@ -22,138 +14,140 @@ Please select one of the options below to upload or retrieve your reference
sequence (maximum size is {{ max_file_size }} megabytes).
</p>
<form name="invoer" enctype="multipart/form-data" action="{{ url_for('.reference_loader') }}" method="post">
<form name="invoer" enctype="multipart/form-data" action="{{ url_for('.reference_loader') }}" method="post" id="invoer">
<div class="row">
<div class="col-md-6">
<div class="form-group" id="input-methods">
<div class="radio">
<label>
<input type="radio" name="method" value="upload" checked >
<input class="input-select" type="radio" name="method" value="upload_method" data-context="select-form" data-for="upload_method" checked >
The reference sequence file is a local file.
</label>
</div>
<div class="radio">
<label>
<input type="radio" name="method" value="url" >
<input class="input-select" type="radio" name="method" value="url_method" data-context="select-form" data-for="url_method" >
The reference sequence file can be found at the following URL.
</label>
</div>
<div class="radio">
<label>
<input type="radio" name="method" value="slice_gene" >
<input class="input-select" type="radio" name="method" value="slice_gene_method" data-context="select-form" data-for="slice_gene_method" >
Retrieve part of the reference genome for a (HGNC) gene symbol.
</label>
</div>
<div class="radio">
<label>
<input type="radio" name="method" value="slice_accession" >
<input class="input-select" type="radio" name="method" value="slice_accession_method" data-context="select-form" data-for="slice_accession_method" >
Retrieve a range of a chromosome by accession number.
</label>
</div>
<div class="radio">
<label>
<input type="radio" name="method" value="slice_chromosome" >
<input class="input-select" type="radio" name="method" value="slice_chromosome_method" data-context="select-form" data-for="slice_chromosome_method" >
Retrieve a range of a chromosome by name.
</label>
</div>
</div>
</div>
<script type="text/javascript">
$('#input-methods input').on('change', updateVisibility);
</script>
<div class="col-md-6">
<div class="form-group" id="upload_label">
<label for="file">GenBank file</label>
<input type="file" name="file" id="file">
<p class="help-block">Please select the GenBank file in plain text format.</p>
</div>
<div class="form-group" id="url_label">
<label for="url">GenBank file URL</label>
<input type="text" name="url" id="url" class="form-control">
<p class="help-block">Please enter the URL of the GenBank file in plain text (including http://).</p>
</div>
<div id="slice_gene_label">
<div class="form-group">
<p class="help-block">Please enter the Gene symbol and organism name without spaces
and specify the length of the flanking sequences.</p>
<p class="help-block"><b>Note:</b> This uses
the <a href="http://www.ncbi.nlm.nih.gov/sites/gquery">NCBI
Entrez</a> search engine and is therefore based on the current
Entrez assembly for the given organism (GRCh38/hg38 for human).</p>
<label for="genesymbol">Gene symbol</label>
<input type="text" name="genesymbol" id="genesymbol" class="form-control">
</div>
<div class="form-group">
<label for="organism">Organism name</label>
<input type="text" name="organism" id="organism" class="form-control">
</div>
<div class="form-group">
<label for="upstream">Number of 5' flanking nucleotides</label>
<input type="text" name="upstream" id="upstream" value="5000" class="form-control">
</div>
<div class="form-group">
<label for="downstream"><td>Number of 3' flanking nucleotides</label>
<input type="text" name="downstream" id="downstream" value="2000" class="form-control">
<div id="select-form">
<div class="col-md-6">
<div class="subform" id="upload_method">
<div class="form-group">
<label for="file">GenBank file</label>
<input type="file" name="file" id="file">
<p class="help-block">Please select the GenBank file in plain text format.</p>
</div>
</div>
</div>
<div id="slice_accession_label">
<div class="form-group">
<p class="help-block">Please enter the accession number of the chromosome or contig and specify the range.</p>
<label for="accession">Chromosome accession number</label>
<input type="text" name="accession" id="accession" class="form-control">
</div>
<div class="form-group">
<label for="accession_start">Start position</label>
<input type="text" name="accession_start" id="accession_start" class="form-control">
</div>
<div class="form-group">
<label for="accession_stop">Stop position</label>
<input type="text" name="accession_stop" id="accession_stop" class="form-control">
<div class="subform" id="url_method" style="display: none">
<div class="form-group">
<label for="url">GenBank file URL</label>
<input type="text" name="url" id="url" class="form-control">
<p class="help-block">Please enter the URL of the GenBank file in plain text (including http://).</p>
</div>
</div>
<div class="form-group">
<label>Orientation</label>
<div class="radio"><label><input type="radio" name="accession_orientation" value="1" checked> Forward</label></div>
<div class="radio"><label><input type="radio" name="accession_orientation" value="2"> Reverse</label></div>
</div>
</div>
<div id="slice_chromosome_label">
<div class="form-group">
<p class="help-block">Please enter the name of the chromosome and specify the range.</p>
<label for="assembly_name_or_alias">Assembly</label>
<select name="assembly_name_or_alias" id="assembly_name_or_alias" class="form-control">
{% for assembly in assemblies %}
<option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} &mdash; {{ assembly.name }}{% if assembly.alias %} ({{assembly.alias }}){% endif %}</option>
{% endfor %}
</select>
<div class="subform" id="slice_gene_method" style="display: none">
<div class="form-group">
<p class="help-block">Please enter the Gene symbol and organism name without spaces
and specify the length of the flanking sequences.</p>
<p class="help-block"><b>Note:</b> This uses
the <a href="http://www.ncbi.nlm.nih.gov/sites/gquery">NCBI
Entrez</a> search engine and is therefore based on the current
Entrez assembly for the given organism (GRCh38/hg38 for human).</p>
<label for="genesymbol">Gene symbol</label>
<input type="text" name="genesymbol" id="genesymbol" class="form-control">
</div>
<div class="form-group">
<label for="organism">Organism name</label>
<input type="text" name="organism" id="organism" class="form-control">
</div>
<div class="form-group">
<label for="upstream">Number of 5' flanking nucleotides</label>
<input type="text" name="upstream" id="upstream" value="5000" class="form-control">
</div>
<div class="form-group">
<label for="downstream"><td>Number of 3' flanking nucleotides</label>
<input type="text" name="downstream" id="downstream" value="2000" class="form-control">
</div>
</div>
<div class="form-group">
<label for="chromosome">Chromosome name</label>
<input type="text" name="chromosome" id="chromosome" class="form-control">
</div>
<div class="form-group">
<label for="chromosome_start">Start position</label>
<input type="text" name="chromosome_start" id="chromosome_start" class="form-control">
</div>
<div class="form-group">
<label for="chromosome_stop">Stop position</label>
<input type="text" name="chromosome_stop" id="chromosome_stop" class="form-control">
<div class="subform" id="slice_accession_method" style="display: none">
<div class="form-group">
<p class="help-block">Please enter the accession number of the chromosome or contig and specify the range.</p>
<label for="accession">Chromosome accession number</label>
<input type="text" name="accession" id="accession" class="form-control">
</div>
<div class="form-group">
<label for="accession_start">Start position</label>
<input type="text" name="accession_start" id="accession_start" class="form-control">
</div>
<div class="form-group">
<label for="accession_stop">Stop position</label>
<input type="text" name="accession_stop" id="accession_stop" class="form-control">
</div>
<div class="form-group">
<label>Orientation</label>
<div class="radio"><label><input type="radio" name="accession_orientation" value="1" checked> Forward</label></div>
<div class="radio"><label><input type="radio" name="accession_orientation" value="2"> Reverse</label></div>
</div>
</div>
<div class="form-group">
<label for="chromosome_orientation">Orientation</label>
<div class="radio"><label><input type="radio" name="chromosome_orientation" value="1" checked> Forward</label></div>
<div class="radio"><label><input type="radio" name="chromosome_orientation" value="2"> Reverse</label></div>
<div class="subform" id="slice_chromosome_method" style="display: none">
<div class="form-group">
<p class="help-block">Please enter the name of the chromosome and specify the range.</p>
<label for="assembly_name_or_alias">Assembly</label>
<select name="assembly_name_or_alias" id="assembly_name_or_alias" class="form-control">
{% for assembly in assemblies %}
<option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} &mdash; {{ assembly.name }}{% if assembly.alias %} ({{assembly.alias }}){% endif %}</option>
{% endfor %}
</select>
</div>
<div class="form-group">
<label for="chromosome">Chromosome name</label>
<input type="text" name="chromosome" id="chromosome" class="form-control">
</div>
<div class="form-group">
<label for="chromosome_start">Start position</label>
<input type="text" name="chromosome_start" id="chromosome_start" class="form-control">
</div>
<div class="form-group">
<label for="chromosome_stop">Stop position</label>
<input type="text" name="chromosome_stop" id="chromosome_stop" class="form-control">
</div>
<div class="form-group">
<label for="chromosome_orientation">Orientation</label>
<div class="radio"><label><input type="radio" name="chromosome_orientation" value="1" checked> Forward</label></div>
<div class="radio"><label><input type="radio" name="chromosome_orientation" value="2"> Reverse</label></div>
</div>
</div>
</div>
</div>
</div>
<div class="form-group">
<input type="submit" value="Load reference file"class="btn btn-primary">
<input type="submit" value="Load reference file" class="btn btn-primary">
<a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/ReferenceLoader" target="_blank" class="btn btn-default pull-right">Help</a>
</div>
</form>
......
mutalyzer/website/templates/static/css/style.css
+ 10
− 4
View file @ 55d10b82
......@@ -136,6 +136,10 @@ input[type="text"].form-pre{
font-family: Menlo, Monaco, Consolas, "Courier New", monospace;
}
textarea.form-pre{
font-family: Menlo, Monaco, Consolas, "Courier New", monospace;
}
code {
/* color: #0B9B33;
background-color: #F2F9F3;*/
......@@ -144,9 +148,11 @@ code {
white-space: normal;
}
pre{
/* margin: 15px 30px;*/
pre.description {
white-space: pre-wrap;
max-height: 300px;
}
header.main-header {
height: 80px;
/* width: 649px;*/
......@@ -372,12 +378,12 @@ header.main-header {
float: right;
}
.example-input, .example-input-2 {
.example-input {
cursor: pointer;
color: #0B9B33;
}
.example-input:hover, .example-input-2:hover {
.example-input:hover {
color: #F2F9F3;
background-color: #5BC779;
}
......
mutalyzer/website/templates/static/js/interface.js
+ 38
− 56
View file @ 55d10b82
function updateVisibility() {
document.getElementById('upload_label').style.display = "none";
document.getElementById('url_label').style.display = "none";
document.getElementById('slice_gene_label').style.display = "none";
document.getElementById('slice_accession_label').style.display = "none";
document.getElementById('slice_chromosome_label').style.display = "none";
for (i = 0; i < document.invoer.method.length; i++) {
if (document.invoer.method[i].checked) {
if (document.invoer.method[i].value == 'upload') {
document.getElementById('upload_label').style.display = "";
}
else if (document.invoer.method[i].value == 'url') {
document.getElementById('url_label').style.display = "";
}
else if (document.invoer.method[i].value == 'slice_gene') {
document.getElementById('slice_gene_label').style.display = "";
}
else if (document.invoer.method[i].value == 'slice_accession') {
document.getElementById('slice_accession_label').style.display = "";
}
else if (document.invoer.method[i].value == 'slice_chromosome') {
document.getElementById('slice_chromosome_label').style.display = "";
}
}//if
}//for
}//updateVisibility
//Toggle the build option in the batch.html page
// Toggle the build option in the batch.html page.
function changeBatch(sel) {
var opt = $(sel).val();
// var opt = sel.options[sel.selectedIndex].value;
if(opt=='position-converter') {
document.getElementById('assembly_name_or_alias').style.display = "";
} else {
document.getElementById('assembly_name_or_alias').style.display = "none";
}
var opt = $(sel).val();
if(opt == 'position-converter') {
$('#assembly_name_or_alias').show();
}
else {
$('#assembly_name_or_alias').hide();
}
}
function toggle_visibility(id) {
var e = document.getElementById(id);
if (e.style.display == 'block') {
e.style.display = 'none';
} else {
e.style.display = 'block';
}
$(document.getElementById(id)).toggle();
}
function onloadBatch() {
changeBatch($('input[name="job_type"]:checked'));
changeBatch($('input[name="job_type"]:checked'));
}
function clearField(form, fieldName) {
for (var i = 0; i < form.elements.length; i++) {
if (form.elements[i].name == fieldName) {
form.elements[i].value = '';
}
var i;
for (i = 0; i < form.elements.length; i++) {
if (form.elements[i].name == fieldName) {
form.elements[i].value = '';
}
}
}
$(document).ready(function() {
$('.example-input').on('click', function() {
$('.example-target').val($(this).text());
return false;
});
$('.example-input-2').on('click', function() {
$('.example-target-2').val($(this).text());
return false;
});
})
$('.example-input').on('click', function() {
var target = document.getElementById($(this).data('for'));
$(target).val($(this).text());
return false;
});
$('.input-select').on('change', function() {
var context = document.getElementById(
$(this).data('context')).getElementsByClassName('subform'),
target = document.getElementById($(this).data('for')),
i;
for (i = 0; i < context.length; i++) {
context[i].style.display = 'none';
}
target.style.display = '';
return false;
});
});
mutalyzer/website/views.py
+ 115
− 27
View file @ 55d10b82
......@@ -9,6 +9,7 @@ import bz2
import os
import pkg_resources
import re
import StringIO
import urllib
from flask import Blueprint
......@@ -68,6 +69,13 @@ def request_terms():
return terms
@website.app_template_filter('short')
def short_seq_filter(s, max_len=21):
if len(s) > max_len:
return s[:max_len / 2 - 1] + '...' + s[-max_len / 2 + 2:]
return s
@website.context_processor
def add_globals():
return global_context()
......@@ -527,17 +535,17 @@ def reference_loader_submit():
corresponding to values for the `method` field, each requiring some
additional fields to be defined.:
`method=upload`
`method=upload_method`
The reference sequence file is uploaded from a local file.
- `file`: Reference sequence file to upload.
`method=url`
`method=url_method`
The reference sequence file can be found at the specified URL.
- `url`: URL of reference sequence file to load.
`method=slice_gene`
`method=slice_gene_method`
Retrieve part of the reference genome for an HGNC gene symbol.
- `genesymbol`: Gene symbol.
......@@ -545,7 +553,7 @@ def reference_loader_submit():
- `upstream`: Number of 5' flanking nucleotides.
- `downstream`: Number of 3' flanking nucleotides.
`method=slice_accession`
`method=slice_accession_method`
Retrieve a range of a chromosome by accession number.
- `accession`: Chromosome Accession Number.
......@@ -553,7 +561,7 @@ def reference_loader_submit():
- `accession_stop`: Stop position.
- `accession_orientation`: Orientation.
`method=slice_chromosome`
`method=slice_chromosome_method`
Retrieve a range of a chromosome by name.
- `assembly_name_or_alias`: Genome assembly by name or by alias.
......@@ -587,7 +595,7 @@ def reference_loader_submit():
raise InputException('Expected an integer in field: %s' % field)
try:
if method == 'upload':
if method == 'upload_method':
# Todo: Non-conforming clients (read: LOVD) might send the form
# request urlencoded (and not as the requested multipart/
# form-data).
......@@ -597,10 +605,10 @@ def reference_loader_submit():
ud = retriever.uploadrecord(file.read())
elif method == 'url':
elif method == 'url_method':
ud = retriever.downloadrecord(request.form.get('url'))
elif method == 'slice_gene':
elif method == 'slice_gene_method':
genesymbol = request.form.get('genesymbol')
organism = request.form.get('organism')
upstream = check_position(request.form.get('upstream', ''),
......@@ -610,7 +618,7 @@ def reference_loader_submit():
ud = retriever.retrievegene(genesymbol, organism, upstream,
downstream)
elif method == 'slice_accession':
elif method == 'slice_accession_method':
accession = request.form.get('accession')
start = check_position(request.form.get('accession_start', ''),
'Start position')
......@@ -619,7 +627,7 @@ def reference_loader_submit():
orientation = int(request.form.get('accession_orientation'))
ud = retriever.retrieveslice(accession, start, stop, orientation)
elif method == 'slice_chromosome':
elif method == 'slice_chromosome_method':
chromosome_name = request.form.get('chromosome')
start = check_position(request.form.get('chromosome_start', ''),
'Start position')
......@@ -672,29 +680,110 @@ def reference_loader_submit():
@website.route('/description-extractor')
def description_extractor():
"""
The Variant Description Extractor (experimental service).
Description extractor loader form.
"""
return render_template('description-extractor.html')
@website.route('/description-extractor', methods=['POST'])
def description_extractor_submit():
"""
reference_sequence = request.args.get('reference_sequence')
variant_sequence = request.args.get('variant_sequence')
The Variant Description Extractor (experimental service).
There multiple ways for the user to provide two sequences, corresponding to
the values for the `reference_method` and `sample_method` fields, each
requiring some additional fields to be defined:
`raw_method`
The reference and sample sequences are pasted into the form fields.
- `reference_sequence`: The reference sequence.
- `sample_sequence`: The sample sequence.
`file_method`
The reference and sample sequences are uploaded.
if not (reference_sequence and variant_sequence):
return render_template('description-extractor.html')
- `reference_file`: The reference file.
- `sample_file`: The sample file.
`refseq_method`
The reference and sample sequences are given by RefSeq accession numbers.
- `reference_accession_number`: RefSeq accession number for the reference
sequence.
- `sample_accession_number`: RefSeq accession number for the sample
sequence.
"""
output = Output(__file__)
output.addMessage(__file__, -1, 'INFO',
'Received Description Extract request from %s'
% request.remote_addr)
r = s = ''
reference_method = request.form.get('reference_method')
sample_method = request.form.get('sample_method')
reference_sequence = request.form.get('reference_sequence')
sample_sequence = request.form.get('sample_sequence')
reference_file = request.files.get('reference_file')
sample_file = request.files.get('sample_file')
reference_accession_number = request.form.get('reference_accession_number')
sample_accession_number = request.form.get('sample_accession_number')
if reference_method == 'refseq_method':
if reference_accession_number:
retriever = Retriever.GenBankRetriever(output)
genbank_record = retriever.loadrecord(reference_accession_number)
if genbank_record:
r = unicode(genbank_record.seq)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Reference accession number input fields is empty.')
elif reference_method == 'file_method':
if reference_file:
r = util.read_dna(reference_file)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'No reference file provided.')
else: # raw_method
if reference_sequence:
r = util.read_dna(StringIO.StringIO(reference_sequence))
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Reference sequence number input fields is empty.')
if sample_method == 'refseq_method':
if sample_accession_number:
retriever = Retriever.GenBankRetriever(output)
genbank_record = retriever.loadrecord(sample_accession_number)
if genbank_record:
s = unicode(genbank_record.seq)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Sample accession number input fields is empty.')
elif sample_method == 'file_method':
if sample_file:
s = util.read_dna(sample_file)
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'No sample file provided.')
else: # raw_method
if sample_sequence:
s = util.read_dna(StringIO.StringIO(sample_sequence))
else:
output.addMessage(__file__, 3, 'EEMPTYFIELD',
'Sample sequence number input fields is empty.')
# Todo: Move this to the describe module.
if not util.is_dna(reference_sequence):
if not util.is_dna(r):
output.addMessage(__file__, 3, 'ENODNA',
'Reference sequence is not DNA.')
if not util.is_dna(variant_sequence):
if not util.is_dna(s):
output.addMessage(__file__, 3, 'ENODNA',
'Variant sequence is not DNA.')
'Sample sequence is not DNA.')
raw_vars = extractor.describe_dna(reference_sequence, variant_sequence)
description = unicode(raw_vars) #describe.allele_description(raw_vars)
raw_vars = None
if r and s:
raw_vars = extractor.describe_dna(r, s)
errors, warnings, summary = output.Summary()
messages = map(util.message_info, output.getMessages())
......@@ -703,13 +792,12 @@ def description_extractor():
'Finished Description Extract request')
return render_template('description-extractor.html',
reference_sequence=reference_sequence,
variant_sequence=variant_sequence,
raw_vars=raw_vars,
description=description,
errors=errors,
summary=summary,
messages=messages)
reference_sequence=reference_sequence or '',
sample_sequence=sample_sequence or '',
reference_accession_number=reference_accession_number or '',
sample_accession_number=sample_accession_number or '',
raw_vars=raw_vars, errors=errors, summary=summary, messages=messages,
reference_method=reference_method, sample_method=sample_method)
@website.route('/reference/<string:filename>')
......
tests/data/NM_004006.1.gb.bz2 0 → 100644
+ 0
− 0
View file @ 55d10b82
File added
tests/data/NM_004006.2.gb.bz2 0 → 100644
+ 0
− 0
View file @ 55d10b82
File added
tests/data/extractor_input.fa 0 → 100644
+ 2
− 0
View file @ 55d10b82
>example_input
ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA
tests/data/extractor_input.fq 0 → 100644
+ 4
− 0
View file @ 55d10b82
@example_input
ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA
+
bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb
tests/data/extractor_input.txt 0 → 100644
+ 2
− 0
View file @ 55d10b82
ATGATTTGATCAGATACATGTGATACCGGT
AGTTAGGACAA
tests/fixtures.py
+ 6
− 0
View file @ 55d10b82
......@@ -85,6 +85,12 @@ REFERENCES = {
'NM_000132.3': {'filename': 'NM_000132.3.gb.bz2',
'checksum': '94569bee76d7c8b1168e17df4fe1dcb4',
'geninfo_id': '192448441'},
'NM_004006.1': {'filename': 'NM_004006.1.gb.bz2',
'checksum': 'be8fea2905e146bfe096e25fbfda2eef',
'geninfo_id': '5032282'},
'NM_004006.2': {'filename': 'NM_004006.2.gb.bz2',
'checksum': 'ee2090536af19a13ac1d6faa46d0b12e',
'geninfo_id': '238018044'},
'LRG_1': {'filename': 'LRG_1.xml.bz2',
'checksum': '5b8f5a39fcd9e3005688eddffd482746'},
'DMD': {'accession': 'UD_139262478721',
......
tests/test_website.py
+ 77
− 8
View file @ 55d10b82
......@@ -100,14 +100,83 @@ class TestWebsite(MutalyzerTest):
assert r.status == '200 OK'
assert 'nnouncement' not in r.data
def test_description_extractor(self):
def test_description_extractor_raw(self):
"""
Submit the variant description extractor.
Submit two sequences to the variant description extractor.
"""
r = self.app.get('/description-extractor', query_string={
'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'variant_sequence': 'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA'})
assert 'g.[5_6insTT;17del;26A&gt;C;35dup]' in r.data
r = self.app.post('/description-extractor', data={
'reference_method': 'raw_method',
'sample_method': 'raw_method',
'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'sample_sequence': 'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA'})
assert '[5_6insTT;17del;26A&gt;C;35dup]' in r.data
def test_description_extractor_raw_fastq(self):
"""
Submit two sequences to the variant description extractor.
"""
path = os.path.join(os.path.dirname(os.path.realpath(__file__)),
'data', 'extractor_input.fq')
r = self.app.post('/description-extractor', data={
'reference_method': 'raw_method',
'sample_method': 'raw_method',
'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'sample_sequence': open(path).read()})
assert '[5_6insTT;17del;26A&gt;C;35dup]' in r.data
@fix(database, cache('NM_004006.1', 'NM_004006.2'))
def test_description_extractor_refseq(self):
"""
Submit two accession numbers to the variant description extractor.
"""
r = self.app.post('/description-extractor', data={
'reference_method': 'refseq_method',
'sample_method': 'refseq_method',
'reference_accession_number': 'NM_004006.1',
'sample_accession_number': 'NM_004006.2'})
assert '[12749G&gt;A;13729G&gt;A]' in r.data
def test_description_extractor_file_fasta(self):
"""
Submit a sequence and a FASTA file to the variant description
extractor.
"""
path = os.path.join(os.path.dirname(os.path.realpath(__file__)),
'data', 'extractor_input.fa')
r = self.app.post('/description-extractor', data={
'reference_method': 'raw_method',
'sample_method': 'file_method',
'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'sample_file': (open(path), 'extractor_input.fa')})
assert '[5_6insTT;17del;26A&gt;C;35dup]' in r.data
def test_description_extractor_file_fastq(self):
"""
Submit a sequence and a FASTQ file to the variant description
extractor.
"""
path = os.path.join(os.path.dirname(os.path.realpath(__file__)),
'data', 'extractor_input.fq')
r = self.app.post('/description-extractor', data={
'reference_method': 'raw_method',
'sample_method': 'file_method',
'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'sample_file': (open(path), 'extractor_input.fq')})
assert '[5_6insTT;17del;26A&gt;C;35dup]' in r.data
def test_description_extractor_file_text(self):
"""
Submit a sequence and a text file to the variant description
extractor.
"""
path = os.path.join(os.path.dirname(os.path.realpath(__file__)),
'data', 'extractor_input.txt')
r = self.app.post('/description-extractor', data={
'reference_method': 'raw_method',
'sample_method': 'file_method',
'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'sample_file': (open(path), 'extractor_input.txt')})
assert '[5_6insTT;17del;26A&gt;C;35dup]' in r.data
def test_checksyntax_valid(self):
"""
......@@ -656,7 +725,7 @@ class TestWebsite(MutalyzerTest):
'data',
'AB026906.1.gb.bz2')
r = self.app.post('/reference-loader',
data={'method': 'upload',
data={'method': 'upload_method',
'file': (bz2.BZ2File(path), 'AB026906.1.gb')})
assert 'Your reference sequence was loaded successfully.' in r.data
......@@ -672,7 +741,7 @@ class TestWebsite(MutalyzerTest):
Test the genbank uploader with a non-genbank file.
"""
r = self.app.post('/reference-loader',
data={'method': 'upload',
data={'method': 'upload_method',
'file': (BytesIO('this is not a genbank file'.encode('utf-8')), 'AB026906.1.gb')})
assert 'Your reference sequence was loaded successfully.' not in r.data
assert 'The file could not be parsed.' in r.data
......
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment