Skip to content
Snippets Groups Projects
Commit 100f53b2 authored by Vermaat's avatar Vermaat
Browse files

Add some JSON and SOAP service tests

parent b00a07d8
No related branches found
No related tags found
No related merge requests found
...@@ -200,4 +200,101 @@ class TestServicesJson(MutalyzerTest): ...@@ -200,4 +200,101 @@ class TestServicesJson(MutalyzerTest):
Get outer coordinates for gene that does not exist. Get outer coordinates for gene that does not exist.
""" """
with pytest.raises(Fault): with pytest.raises(Fault):
r = self._call('getGeneLocation', 'THISISNOTAGENE', 'hg19') self._call('getGeneLocation', 'THISISNOTAGENE', 'hg19')
@fix(database, hg19, hg19_transcript_mappings)
def test_get_transcripts_mapping(self):
"""
Test output of getTranscriptsMapping.
"""
r = self._call('getTranscriptsMapping', 'hg19', 'chr11',
111955524, 111966518)
assert r == [{'cds_start': 111957632,
'cds_stop': 111965694,
'name': 'NM_003002',
'stop': 111966518,
'start': 111957571,
'version': 2,
'gene': 'SDHD',
'orientation': '+'},
{'cds_start': 111957492,
'cds_stop': 111956019,
'name': 'NM_012459',
'stop': 111955524,
'start': 111957522,
'version': 2,
'gene': 'TIMM8B',
'orientation': '-'},
{'cds_start': None,
'cds_stop': None,
'name': 'NR_028383',
'stop': 111955524,
'start': 111957522,
'version': 1,
'gene': 'TIMM8B',
'orientation': '-'}]
def test_description_extract(self):
"""
Test output of descriptionExtract.
"""
r = self._call('descriptionExtract',
'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
assert r == {'allele': [{'term': 0,
'end': 6,
'startAA': '',
'deleted': '',
'hgvsLength': 8,
'inserted': 'TT',
'start_offset': 0,
'start': 5,
'hgvs': '5_6insTT',
'shift': 1,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'ins'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': '',
'hgvsLength': 4,
'inserted': '',
'start_offset': 0,
'start': 17,
'hgvs': '17del',
'shift': 0,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'del'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': 'A',
'hgvsLength': 4,
'inserted': 'C',
'start_offset': 0,
'start': 26,
'hgvs': '26A>C',
'shift': 0,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'subst'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': '',
'hgvsLength': 4,
'inserted': '',
'start_offset': 0,
'start': 35,
'hgvs': '35dup',
'shift': 1,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'dup'}],
'description': '[5_6insTT;17del;26A>C;35dup]'}
...@@ -711,3 +711,108 @@ facilisi.""" ...@@ -711,3 +711,108 @@ facilisi."""
result = self._call('getBatchJob', job_id) result = self._call('getBatchJob', job_id)
result = result.decode('base64').decode('utf-8').strip().split('\n')[1:] result = result.decode('base64').decode('utf-8').strip().split('\n')[1:]
assert expected == [line.split('\t') for line in result] assert expected == [line.split('\t') for line in result]
@fix(database, hg19, hg19_transcript_mappings)
def test_get_transcripts_mapping(self):
"""
Test output of getTranscriptsMapping.
"""
r = self._call('getTranscriptsMapping', 'hg19', 'chr11',
111955524, 111966518)
assert len(r.TranscriptMappingInfo) == 3
assert all(all(t_real[k] == t_expected[k] for k in t_expected)
for t_real, t_expected in
zip(r.TranscriptMappingInfo, [{'cds_start': 111957632,
'cds_stop': 111965694,
'name': 'NM_003002',
'stop': 111966518,
'start': 111957571,
'version': 2,
'gene': 'SDHD',
'orientation': '+'},
{'cds_start': 111957492,
'cds_stop': 111956019,
'name': 'NM_012459',
'stop': 111955524,
'start': 111957522,
'version': 2,
'gene': 'TIMM8B',
'orientation': '-'},
{'cds_start': None,
'cds_stop': None,
'name': 'NR_028383',
'stop': 111955524,
'start': 111957522,
'version': 1,
'gene': 'TIMM8B',
'orientation': '-'}]))
def test_description_extract(self):
"""
Test output of descriptionExtract.
"""
r = self._call('descriptionExtract',
'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
assert r['description'] == '[5_6insTT;17del;26A>C;35dup]'
assert len(r['allele'].RawVar) == 4
# For some reason, we get the empty string as `None` in SOAP.
assert all(all((v_real[k] == v_expected[k]) or not(v_real[k] or v_expected[k])
for k in v_expected)
for v_real, v_expected in
zip(r['allele'].RawVar, [{'term': 0,
'end': 6,
'startAA': '',
'deleted': '',
'hgvsLength': 8,
'inserted': 'TT',
'start_offset': 0,
'start': 5,
'hgvs': '5_6insTT',
'shift': 1,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'ins'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': '',
'hgvsLength': 4,
'inserted': '',
'start_offset': 0,
'start': 17,
'hgvs': '17del',
'shift': 0,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'del'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': 'A',
'hgvsLength': 4,
'inserted': 'C',
'start_offset': 0,
'start': 26,
'hgvs': '26A>C',
'shift': 0,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'subst'},
{'term': 0,
'end': 0,
'startAA': '',
'deleted': '',
'hgvsLength': 4,
'inserted': '',
'start_offset': 0,
'start': 35,
'hgvs': '35dup',
'shift': 1,
'endAA': '',
'DNA': True,
'end_offset': 0,
'type': 'dup'}]))
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment