Commit bdadf513 authored by Peter van 't Hof's avatar Peter van 't Hof
Browse files

Added unit tests to reference trait

parent 9705d77d
......@@ -18,6 +18,7 @@ package nl.lumc.sasc.biopet.core
import java.io.File
import htsjdk.samtools.reference.IndexedFastaSequenceFile
import nl.lumc.sasc.biopet.core.summary.{SummaryQScript, Summarizable}
import nl.lumc.sasc.biopet.utils.Logging
import nl.lumc.sasc.biopet.utils.config.Configurable
......@@ -63,7 +64,7 @@ trait Reference extends Configurable {
protected def faiRequired = false
/** When set override this on true the pipeline with raise an exception when dict index is not found */
protected def dictRequired = false
protected def dictRequired = this.isInstanceOf[Summarizable] || this.isInstanceOf[SummaryQScript]
/** Returns the fasta file */
def referenceFasta(): File = {
......@@ -101,12 +102,11 @@ trait Reference extends Configurable {
def checkFasta(file: File): Unit = {
if (!Reference.checked.contains(file)) {
if (!file.exists()) Logging.addError(s"Reference not found: $file, species: $referenceSpecies, name: $referenceName, configValue: " + config("reference_fasta"))
if (dictRequired) Reference.requireDict(file)
if (faiRequired) Reference.requireFai(file)
Reference.checked += file
}
if (dictRequired) Reference.requireDict(file)
if (faiRequired) Reference.requireFai(file)
}
}
......@@ -121,10 +121,13 @@ object Reference {
*/
def requireFai(fastaFile: File): Unit = {
val fai = new File(fastaFile.getAbsolutePath + ".fai")
if (fai.exists()) {
if (!IndexedFastaSequenceFile.canCreateIndexedFastaReader(fastaFile))
Logging.addError(s"Index of reference cannot be loaded, reference: $fastaFile")
} else Logging.addError("Reference is missing a fai file")
if (!checked.contains(fai)) {
checked += fai
if (fai.exists()) {
if (!IndexedFastaSequenceFile.canCreateIndexedFastaReader(fastaFile))
Logging.addError(s"Index of reference cannot be loaded, reference: $fastaFile")
} else Logging.addError("Reference is missing a fai file")
}
}
/**
......@@ -132,10 +135,13 @@ object Reference {
* @param fastaFile Fasta file
*/
def requireDict(fastaFile: File): Unit = {
val dict = new File(fastaFile.getAbsolutePath
.stripSuffix(".fna")
.stripSuffix(".fa")
.stripSuffix(".fasta") + ".dict")
if (!dict.exists()) Logging.addError("Reference is missing a dict file")
val dict = new File(fastaFile.getAbsolutePath
.stripSuffix(".fna")
.stripSuffix(".fa")
.stripSuffix(".fasta") + ".dict")
if (!checked.contains(dict)) {
checked += dict
if (!dict.exists()) Logging.addError("Reference is missing a dict file")
}
}
}
@HD VN:1.4 SO:unsorted
@SQ SN:chrQ LN:16571 M5:94445ec460a68206ae9781f71697d3db UR:file:/home/ahbbollen/fake_chrQ.fa
>chrQ
TCGGCATCTAGAAACTCCAAGTCTGCAGATCTATAACACACGAGGGTATTCAGCCCTAAAGCATTGCGTCTAGGCATGGGTCTTTAATCTCGCCCCGGCAACCTCTACGCGAGCTCCTACCAGTCAACGTGATTGATCCCTCGTACCTAGCATATTCCACGGCGTTTCATAGCCTTGACGGGCACCTTATCCATTTTTACCTAGTTTGACATTAATTGCTTCAAGACTACTGCGGTACGGGTCCCTGCATCCAGAAAGGATGACAAAAAGTGTGACAGTGCGTTCAATCCATAGATTCCCGTCGGTGCGAGGGCTGAAGTTGAGCCCTACAACCCGGCGATAAAAATTGTAACCCTATGCATTGCGTCAAGTTAAGACCCTCCATCTTCGCCACGCGATAGGAATTTGAAACATCGGCGTGCTTAGAAAGGCTATTAGCGCGGGTGGCCTGATCGGTATCCGATAAAGGCGTTGCCACAAATTTTGCCGATTGACCTGCAATTACATCGGGTAAGTGCATTTCCGCCGTTAGAGTATTAAGTCATGACGTTTTCGACATGGGCATTTAATTGGCCCAAGGTGGAATATTCCTGATGTGCCTAAGTATGAGCTCCCCATGAGAATTTGAAGATCATGAAGACTTGAGTCAATTCTAAATGTAGTTACCATCACTTAAGTTCGTTCGCCTTCTGGGCAGGCTATGTCTAACGAGCGACGTCCGCAGTGTGACAATCTAGATATTGGTTGAGCAGGAATACCAAGGAGGTGCTTGAAGTTTCTCTTATGGAACCAACTTCAATCAATAGGTAGTCTCCGTTTCGTTTCCACTGAGACATTTGTGCAGTGGCACAGTATGTGGTCGTAAGCGCATGGTGTTGTTGGAACGAAGACTCTCACTTTTGTTTCCTTTGGTAGTTTAATTTAGCAGTATCCTGGTCGTTGACCAATTTGTGAATCTCCACGGTCTCTCTTTATCAGTCATACCTCTTAAACCGGCTTCCGCTCCTGCGCACATTTATATCCTACTTTCCGTCAATGTGAAAGAGAGATCAACATAATTTCGCGCACGATCTGTCCCATTTCAGACGCCATCGACGGGTCCCGCCTTCACAAAAAACCTGCCACCATGCAGTAGGTACCTCCATATGCTGAGCGTCCGTTACCGGAAGGGTTAAGTCACTGTTTAAAGGATAAGGCGAGGTTTCCCTTGGTGGTGTACTACTGCTCACGTTCCTGCTTTACTCTCCGAGTATTGTTTTAAAAGTGGGCACGCTGGAACGCAGCACCCTATAAGAAGACTCAGTTAGGTCCCCTTCACGAGCATGTTTGAGCTCTCGGACCTAAGACGTCCGAACTCGGTTACGACGGTTAAAGACAAAGCTCCCAGCATGGTATCAGAAGCCACCACGCGTGAGGATGGCGGGGCCCTGGGCACATTGGCCCCGAATTCTTCGCCCACTTAAGTCGGACTCACCACGGGAGACTACGCCCTAACCGGATAATATCTTTTAGATACCATACAGGGTGCAACCATCGCGGCGTCAGCTGAATGTGAGGACAGAGCCCCACACACAGCACTAACAGATCCATGATTTTACTTCGTTTGGGCGACGTGCGAGCCTATTCGGCCTGTCGGACTTTGTGTAGATTCGGGATTTGACCTAGCGTATAGGCCTTTGGTATACTCGAATTATCAGGGTCAAACTACCCTCAAGGAATCCTATTTCAGACGGACGTTTGCCACCCCGGAACGTTGTCGGATCGCTTCTTGCCGCAGGAGATTCATGGAGTGATAATCGCTGGACTCACAAGTGTCAGCGGACTTTCGGTGTCTTGTGGCCTACTTGCAGTGAACACCACCAAACGAGTAGTATTATGGATTGCCGGCGTGTGTTTGTGGCCATGATTGGTTGATGCGACGGCCTAGATTCTCCTACGGGAATCTACCAGGCCCAAAAGCGCTGACTTTTATGTATTTGAGGGGCCGAAATTACATAGTAACCCAGAACAAATACCCGTTAGTTATAAAGTGAGCGCATAAGTTTGGTCGATCCGGCAGTCGAACCATTGCGGTCGGACATATCCGCAGTAGTACACTAAGGCGGAATAGACTGCCGAGTCAACGCTCCCTCATTCTTGCTACCTTAGATCTCGCAGGTTCGACCATTGCTGAAGCCGCTGAATTACACGAGTTGTTTTGTTAACCCCCGGAATGTAGTTCGTACGCCTCAACTGATTCTTCAAAAGCTCACTGCACGTGACTTGTCATGTGTTCCTAAAACATACCTCATCTGTGGGTCTGGTCCCATAAGCATGGAATGTCCGTCGACGCAACATGGAAACCCACTCGCTCGCTATACGTTTATGGTGAGACAGAAACACACTGTATTAGACTGCCACTGATAGCCCCAGTAGCAAGGTGATGTGGCAGGCATGGTACCCAAACGTCTATCGTTTTGGGAACCAAGGGGAGTGCTAATAGGTCCGGCCACGTAGAATGACATAACCTCCAGAGGAGCGCAGGAGTTGATGCATTAAAAGATCCATACTAAACGTTAGCTTAATGCCTTCAAGGCACCAGCTACCTCCATGACAAGGAGATTTCGGAAGGGGTAAGATTTACTTCTGTCCCAAAAGGGTAATGACCCGTAGGGATGGAATCATTGATGAACTCTAAAGGGACTCAGCCGACTAGCCGAGAGGGCTGGACGATCATTTGATGGGAGAATACGCATACATCTAAGTGTCAAGTATTAAATCGGTAATCTCCGTAAAGGCGTGAAGTTCACAGGGCGCAGTTTCCAGTTACTCCAAGAAACTACCGGTTCAGTTATCGCTTCCGGTGCCTTCACAGCAAACATCATTCGCTCAAGAAAGTGCTGTCGCTGCGTGTGGATATTTCCCCCTCGTTCTGGAAAGTGCTCTCAGCGACGCACGTAAACATGCTGGCGACGAGAGAGGCGTCAACACGGTCCGTTACCAAACTGCGGCATTTACCACGAACCTGATTGCAAAGTGAGATTTCCGTAAGGAGGTTAGCCAAATATTACGTAGAGTGTTCCACACCAAATCCGTCGTCCACATTCGCGACGGCAGTCTAGACGTGTAATTCCCCGGATAATCCAGTTACTACATGCTGATGCAGTCATAGTGCACGCAAATGCGCAACTTAACAAGCACGACCTGAAACAGAGAACCCCTGTGTAGTCAATATAGGATGACGGACACACACACTTGCTGCTGCAATCTTACATTCTGCGAACGAGTGCAAAGTTGAAATCATGACGAACAGCCTTGCTTTTCAGAGTCTCTATCGAACTCCTTTACACCTCCATATCTACTTGCAAATCACACTAGAGGGGCGCAGCTTACTCACTGAGAGATGGTCTACCTAATCGATTTTCGGTGAACTTTGAGTACAGCATTGAGTCTGGAGGGTTCCACTACTTTATCGTACCGGTCCGACATGATTTCTTATCGAATAGATGTTGAGATGGACATTAATAAGCATAGTACGTCTCGATCGATGGCTACCTTTACGTCTATGAGTGCTTACATAAGGTCTCTCGTAAGTCATGGTCCCGCGGGGCTCGCGCAACATTGTGGATTAATGACTCCAGTGACGCATGTTCGATTCGCATGAAGTAGGTGGCGCGTATTCATACATGAATAGTAGGCAGAACGAGCACATTGGACCGATCTTGGAGGTTGGGCTTGAGGTCCCGCACTGATAGTTTACGGCCATGAAGACGACAATTGTCAATACTTCTCTATCCTGAGCGAATGCTGACGGGGGCCAGGCGGAAAAGTGCGACACAGTCTACTGATTACGTGTAGTACGTGGCTAAGCATATTCCCGGGTTCGCAAACATAGGTCTCTGATGGGGTATGGGTAAGAAATCTGAAGGTTGCGTCTCTCACCACGGTCAGGATACCGAATCAGCTCATAAGAGTTACAAACGCGCAAATGAAGGCCTAGTCCACAGGGGTGTCATTCGCACGAGCTGGGCTTAGAATCACTGTTTTCGGTCGCACCTGTAGGGGGACATGGGACGGATTTCACAACAAAAAAGCATCTCTCATGATTCGATTCAGATAGAGGAGAGGAGGTAAATGCCAACAAATCTATTCTTTAGTACCGCCTGACGGAACGTATTTAATCCTCGCCTCAGATCGACACCGCAGGGTAGCTGAAGACGTCCGTTCTTAGACATTTAGTCGATCATTTGTTATGAAACAGAACTAGGAGTCCGTGCCCTTCAGGCCGGCTCAGGGGCACCTACCTCCAGATCGCCCAGGTTGGGTTTATTAGGCGCCGAAAAGTTACTGCCCTATCAGCCCCTCCAATCCGACCTACGGACATCATCCCACTGGCTCGCAAAATATAAATTGCGGATGGGAAAGGATAAGGAAAATCATTACCTACACAGAAGGACAATGTCAGTTCCAAATAACACTGATACTTTCGGAGCAACTTGGTCCGGAAATGTAAGTACGACTATAGCCCTTTCGACCAACGCCGACAGTCCTATTTGGACGCCGAGAGAGGCGACGGGTAGCCGAATGTAAAGCTCTCGGGTCGCTCTTGGCGGAATGCGCTGCGGGTCCTACCCTAAACCCTTACCACCACCAACTTCGTTAGGAGCCGTATAGATTACAGCTCCCGCAAAATTAGAGAGGAATCTGAGTTATTAGCTGAGGACCCCGCATTTTCTGCGACGGCGTAGCTGCAGTGACGTACGATATGAGTTCCCGACTGTGAGGGAGTCCCAGTCGTGACTCCCTACAACGGCTCCAGATATTGTTACTTATGGTCAATATGCCCCGACCGCCCATTGTCTCGAGTACAGTCTTCCCCAAAGTTAAGCTGTGCATTACCTTACCGTTTTAGGTCCAGCTGGTAGCACCGAATGCTGCGCAATCCGAGCCCCCGAAATAGACTACGTGTCCACGGTCAATTGTCATGGGTAGCAGAGCTCAAAGAGGAGAAACGTGCCCCGTAAACCTATTAGATCTCGGTTGATAAATATCAGGCCACAGCAGGCTGCCCGATGCTTGTTTGAACAACAACTTCGGGAGCCGCGGTCCTTGGTTCTCCCGATATTCGGCCGCACCGAACGGTACGCGTCATCGCGAGGTGCGTTCTCGCAGCAAGAAATATTTGTTGTTGTTGTCTTCCTTCCGCATAGGAAACCTTAAGCGGTACCTTTCTACGAAGTTGAACCCTAGAAGCACGTGTAACAATTTTTTTTACGCTACACCCGGATCTGCTTCCATCTGTTGATCATATGAGCCTAATGTGACTAATCTGTGCCGTCGATTGAAAATTCGTTCTGAACCTAATCACATGAATTAAAATTAGGGCGAGAATTGGCTCCTTTTGGGCCGTAATCCTTCAAAGGGTTAACCGAATTTAGCCTCCACGGTGACACAAACTCCCATAGGTAAGGCAAACCCAATAACGAGGAAGCCTTGCCCACAGCATGTTTGATAAATACCCTTAGGGTAATATCGCGTGCAATACTGAAGCCGCTCTTCTAGCATCCGTGTTTGACATACTATGACCTTGAAGCCTGCCGCAGCTTCTAGGTCATCCAAGTAGATCAAAACGCCATGTTGTGGATCCATGCATCTTCCCAGTGAACATGGATCTTAGTGTGACAGGCGAGGAGCGGCGAACACTATCGGTGTGGCAAGCTCGGGCCTTCGTACGTTGTGGAAGTATGCGAATAAGGAGACCGTAATGTATCAAGTTCTTAAGAGCCTTGGTACCGTTGCAATTCGGCATGTTCCTACAGAGACACTCCGTGTTTGTCATCCGTCATAGATCTATGGCGTAGTTAGCGCCTCTGAAGTAGTTGTCCATTCAGCAGGCATTGCTTAGGGAGTTTCTGGCGCTTGCCGCTCAAGATGCTCACGGGCCTAAGTAGCACGGCAACCTTTTGACAAAGCATTTTATAAACTGAGCATATTGGCCCGAAACTAATCCAGCAAAGGGTGAAGACCTGTCAGCGGGCCCAGAGTGTGAACGGTCTACTGCGCGGTACATAAGTGGCGTAATCCATCAACAAGACCTACACGACCTGAATGATTTCCAACAACTTTATATGCTTTTCCGCATCTCGAGAGTACCGGAATCTATGCAATCTCCCAAGGATCCGTAGATTTGAAATTCAATCCGACGGGGTAAGGTTGCCGCGCCGGTTAGCTAATGTGCGGATTTATAGTCTTTTTCCCAGAAGGCGTAGTTAGTTTCGCACCTAACTACGACACATACTTGGGTCGACTGTTGAAGGTGGTAAGTTGCGAGCAGTCCGCCGCTCTCACGCGCCGAACCACGTTCATATCGGCAAAGTTGCGCGATGACCTATAGGTGTGCAAAGCTCGTCCGACATTGGGATTGGATTCACGTACATACGTTAGTATCATGGGTAAGCTTCCATGTCAGCCTCGTGTATAGCACCGGTGCGCCGCGCGTTAAGGATTCTATGCCCAGCAAATGTGCCAACGTTGTGGGGAGAAAAGTGTAGTTGGATGCGATCGTGACATCGGCACACCGAAACTCTGCAGCCAGTCCCGCTAATCTCATTGGCACCGGGTAAGAGATTACCTTTGGTTAGGAATCGCGTGCGACGTACTGCACGAAAACAGTGCCTGAACCGAGGTGTTTACTTAGATGGTTCTAGACCCAGCATGTTCCTCACTGGAACCTGACGTCGGTACGTGATCCTCTATACCTCCTTTTCGGTATTGGCCTGGCAGCTACTCTAACTGTTTGGGCCGCGCCGATTTCTCGAGTCCACACGGCGAGGTCAGCAAAATTGCCAGTTAGTGGATGTTGGGATCTCAACGCATTACCATGAGAGTTCTTGGTTTACCCGTTAACATCGCTGCGCACGGTGTGAAAAGCCTGTTTCTTTGGCCCCCATCATCTTCGGCCCGCAGATCTCAGATCAATGATGTAAGGTTGCGGCGGCAAAGACTAGACTTGAGTCGTGAGATGGTGCTTTGCTGAGGCCGTCTCCTATAGCTTATTCTAGGACTTTCCGCAAACCACCCGACGTGCGGCTGTCCACGATCGGATTCCATTCTGTCTCGGAGCATACAGCACTAGATTTGCCGCTTGAAAAATGTTCCATAACCATGATTTCAACCCCATCTAGTCGGCAGGCACAGCTGAGAACAGCGAAGGGCGTCGTGAAGGGCATTGCCCGTAGTGTTTCAGACGTGCTAGAGACTAAATCAACTATCTGCACTCGTAGCCTGGCGTGTGAGATGTCACCACGATGTGCCTAGAGGAGTGATTATGAACATGTATTACCACGTCCGGGTGTCGACGGCTATATGGCTAACATTTCTTATGGCTAGACGTGCTTGGAAAGGTTCCCCAGCCTTCTGTTTCCCGGTGCTTTCCACGAGTCTGGAGTTCTGGTAATTAACTACATGGCGTTAACGCGGAGGTAACCCCCAGTCATTGCATTGCAGGTAGGGCTTAGGTGCAATATAATTCACCAAGGCGCGGATTCCTCACGATTGTTACGAAGACACCCGGAGGGTTTCAGTATGGCTTGAGAAGTGTACGTTTTTCCGGCCAGGGTGTAACTATAACCAACACATGTTTGGCCACGGGCTAAGTCGGTCCGCACGACTGATTTCCCCCGCCCATGTGTTTGGGAGCAATAAACTGCGTCTGCCAAGAGTAACAACTCGAGTAGAGAAGGGAAGTCTCAGACTATTTTGCAAATCAGACTGTAAGGCTCAACAGCCATACAGCTTGCCCTACTACTGAATACTAGCGTAGCGTGGCCACATAGGAAAGACTTCATGTCTTCTAATAACCTTTTACCTCCAACGTCCCCGCCGTCTTCACGCGGTCCAACGATGAGGAAACAACCACCCCTATCTTCCGCGGAGTGGTTCACACGACCCCCGGCGTTAACGCGCACGTTGTTGTCTTTCGGGACGGCACTACCCCCAAATGCCCAGACCCAGTGCTAGCGATATTCAAACGCCGTCCGGTAAGTCCTGACGTTTTTCAACTGGATGCACTGGCGACACGTAGTTCGCAAGGCGTCCATGAGAGGTTTTAACCGTCATGTTTCCGTATCACGTCTTATGTCTGTCTCTATTCTCAGCGAAATTCTCATCATAGGGCGGAGACTATCTGAAGGCCAGCGAATACAAGATTTAATATCAAATATAGCATGGGGGCCAACAGAGGCCCCCCTGGTGCTGACGAATTATCGTGATATTAGTACAGCTGTCTGCAATGCCATTTCGAAGGCTTTTTGTTCGTATCACTGCTCTATGCATAGCGGTCACTATGACCTCTCAGCTTGACTCACCCGAATGACCAATTGTGGTCCAGCACTCCCTCATCTTCCCCCATTAACGATACGTTGGGCACCATCGGTGTGAGCTACCCGTTACAGTCATAGAATCGTTCTTTGCGTTGTACGCGGCACGGAGGTGACCGGGAAAAGCGCCGCGAAGGCCCCGCACTGAATAAAGCTAGTATTAGCGTCTGTCAAAGTGTTTTGACACCTAATTCGCTTCCAAGTCCCAATATCTAATCTAGCCTGCTTTGGGCCAACATCTCATTGCGTTATGCTAATGAAGAGGGTGCGGGATCACATCCGCTCTTCTCTTCCTATACACAGCGGACATTCGGGTTGGACGTTTGGAGTGATAATTTATCGTTAGGGATAAGTATGTCGGCGCTTAGTAGTATAGCCCGCTGACCAGCGTTCGATTTCGAACCTTACTGGACATTCTCAATAACTACTGATCATGACGTTTTCCTCAGTTCCTAGCCTTGACAACTAGCCACAGTCAGCATGGTAGAGAGCGTTGAGCCGGGGATAGCCAGGCTATTAAGACAAAGACCCTCGGGCCCCTTAATGCGCGTCAAGTCTGACGGTTTGAGTGCGGAGCAGTAAGCGCTTTGGTATAACCGTGACGTAGCAGATCCATGCTTCGCCCGCTTCCACCTGAGAGATACTAGCCTCTTTCGCACTTTGTAGGATTACGGGCAGCGAAATATTTATCCTGTGCGGCGAGCCCGCTTCGGTTTCGAGCTCTATCAGTGCGCGGTTGGCACTCCAACGCACGATAACATATACCCGCCCACAAGGCCATGCAGGTTTAACCTCCTATTCTGATTGTACCTGGCTGACTTTACGGTACCCACCAGCGCAGGATTAATAGCCTAATTATGCTAACCGGTGCTAGTCTAACTGCTGTTACTAGTCCGCCCCAGCTACCCCACGGGTCAGTAACTGCACCAGCAAGCATGGTTCTCCTCCTGAAGTTGTACGTTCGAGAACCCCGTATCGAGTTGGTATATAAATTAAGGGTTGTCTAAAACAGAAGCCTATTCCGCTATCATCGGTGTAATAACTGATCGCGCCGTGGTTAAATGGAGGAGCACCCGCATGGATACATCGCTAGCGTCTTGTAACTCTCTGGGGGCCTAGTATGGAACGGAACAATGACATCATTGCTTACGGGGCCCGCACTTAGCTGTCGCGTATCGCAAATCATATGGCATGTCAGTCCCGACATCACGAAAATGACCCCATCTGAGGTGGTCGGGAGGCGAACAGTCGAATATGATGTATGCACCCGCAACTTAATGTTCAAAGGCGGGCGAAATGCCTTCTCCCGTCCGGACTATCCTGAGTGCTAGCCGCGAGTCTGTAAAGGTTGACGCAACCATATAGCACGCAGAAAAATCACTCTCACACCATGAGAACCATGGCGGCACGCTGTCTACTTTGTCTGACAGGCTACGGAAGGAATGGTACATACGTACAAACGGATGATATGATATCGGTCATTGCCTATTGTGACGCTACCCTACTGCATCACCCCCTTAGAATGCGTTGGACGCTCTATAGCAGATCCTCCATCCAGTGGAAGTCTCGTCGCCGTGGTTTGCCTTAACGACCGTTGGAGAGAGCAGGACAGAAATATCGCCCTTTTGAGCGCATTATTTGGAATCGAGGTAAGTCAGTGCGGCATAATCGCGCCTCGTGAGCGGAACAGTTTTTGATCCCACCCGCTAAATGCCAAGGTGCTGTAACCTGGGCGCGACACCAAAAGACCACGTGCTGTATGAAGCATGTGTTCTAGCGCACTCTCAACCGTTACCCCGAGAGTAAAATGTTAGTTGTAGGCCGATTCTGCAATGGTAATTGGCGGAGTGTCTAGGGAAATGTTTCGGTCATACTTAACCGGCTACCTCTTCCTCCCTCAGATTCGGTCTGAGATGAGATATACTGGGTGAGTTGAGTCGCCCTGTATCGTTGCGGCGCTCGTGGACCAGACAGACAGTTCCCGTTTATCTCTGCTTCTAGATGGAGGGTCGCCTCCGTGTTAACGCCGGCGAAGGTAGTCGCAGCTGAAGTTGTGATGCACAATCAGGTGAGCCTTTTAAGTATGGTCCTACGGACGTGAACAGCTGGGCCCAGTCATTTAGTACGGGGGGTTTACCTATAAGGATACGGTAAGAACGTCATCTATCCGTCCCACTGGAGTCCGAGGGGTTCGTGTCTACACGGATTACTTATCATGCACACACGTCTACGGTCATGCATAAAGTTGTGCAGCGCAGCAATCGGAGCGGAGTTACACCATCTCCCTATTAACAAGGCACTTATTAGTACTTACCCCGTTATAGAGCTCTCATCTTATCGATAGAGCGCAGTCCTAAGTATTGGCTCGAGTGATTCGCTCCTCAGCCCTTGATTGTAACTCCCCCGATTGCAGGTTGTATGGTGAGTAAAATCTCTGCGCCCTTCTGTTCGGATAAAGAACCCCGACCACTAATGCCCGCCTGCTTGTTGGGCGGTAAATGGGTAACGGAACATGGACTATGAGTGCGATGATGGTCAATAGAATTACCTTATTACGCAGTAAAAGGAATGACGCAGACAGGTATTTGTCGACGATTGCTTCGAACCTGGCAAAATGGGGAGGTATCCTGTCATGTTCATCTGTAAAACAACTCCTGCCTCTTCGTAGAGGACACACACTGTGGGCCTTTAGCCTTTAGCAGCCCATTGGGGCTTACCAGCTGTCGTCATGGGGTATCATTAAGATCCATGCGCCCCCGAAACTTACTGCAAAACAATATGGCTTAAAGGTAAAGGGACCATCAGGAGAATGCTTAAGAGCGACATATAGATACGTATTTAATTAATTTATGTTAACGCAACCATCTCGCAGGAGTCGCATAGCATATTGCCGGGTGATAGTTAATGCACTGTGCTTCCGTGTTTATATAAAATAAGCAGTAACCTCTGACAGGTTGAGACTCCAACAAGTGCTCCGGGTATTTACCTTCTACCATGGCGTTCTAATATCACGAAAGAGAAATTGTGTGTACCGATGCCAGGTGACCGCCCGCGTGCGCCAACGACGCAATCTAGAGCATCCACGCTGAATTGGGGAACTCTTGCCGTTCGTCGCATGGTGTACTTGGTACCACTCGATATGCCTGATTAGGTTTGGCCGTAGCACGTAAGGTAGTGACTTTCCATTCAAGCTAGCGAAGCGACACCACCACAGTGCCCGGTCAAAATAACCCACACCTGGCCAGCATAGAGGCTAAAATAGCTACAGTGCGCTAATCGAGTGTTTTTGCATCGGCTCGTGGCTGGTGGACTCGGGACAGCTTAGAACTAACTCTGGTGTACAAACGCGATCGTAGCTCTCGCGACTTACTCACCGGAGTAGGTTAGATGGACAAGACCTAACCCGAAGCCTAAATCGCCCTGAGTGTTAGCCGCCATTCAATTCTATGGTTTATCGGGGGCGTCTATGGCTGCGACAGTATGGAGGCCCGTTATGGGCACCCGAGTATCGTACCATAGTAATCCCATATTCCTCTTCGAGCGACTATTGGATCAACATACCTACAGGGTAGTATGAATGTTCTTGATTACAGAAACCATGGAATCGGCGCATTCTATGTTTCACTTCCGAATAACAGTGAGCAAGGCATGCCCTTGACAAGGATCATCCCGACAGCAAGCCGATCGGGCCCTAGAGCCCGACCCCCAAACAGAACACCGGCCACGTAGTTGCTGGGACTAAACAAAGGTGTGTTTCCATAAAAGGAAATCTTCAAGTGTATTGTTGAGTCGTAACGCTTATATTTATGGCCCAATGGGCGTTGCGAGCACAGTAGCAGGCCTAGATGAATGCCTAGGCCACGATCGGGGGGAGGCTCATTGAACGTACTGCCATACCAAGCCCCCGTATGCTATGGCAGGAGGGGTTCTCTTCGTATAGAGCGAGGGTCTCTACGCCAAGCAGCATTCCCGTGTTGGGTGGCCAATGGGGCTCACTAGAAACTCGGTTTTTTTAGCGAAGGAATGAGCAAACTCGTGAAAGGTGGTACACACCAGTTGCGGCCGATTTGTTGTAGCAACAAGGTTTGAAGAATTGAGTAGATGGGCCAATTTACCTCCTATTTAGCGAGTGAGATGGCGCATGTTTATTCAGACTCCATGTGGGGTAGAGGCTAATCGTTTAGTAGCAATAACCCCGCGGGGCAAGAGACCGTAATAACTTGAATCTGTGGTAGCTATGAATATGTGCTTCGCCCTAAGTGTTATGTAACAAGAGTGATCCAGGGGCTCAGATCACACTTAGTACGATCCGCTACTGAAATGCGGCCGCGGGCTTGCACGCTGGACATAAGTCGGATAATCAATTGCCTACGACAGGTTCAGCCATAAGGCTTGGCTCCTAACACACTCATGATGTCTGGCTTTTACTCGTGCCCGGACATAAACGTATGCTCAAACGCGAGACAGGGGAGGGTCAGCACCGTTTAGATCTATAAGGCCTACCGGTAATATGGATCGACAACAAACAGATGCTATAGGGATACCTACTCCTTTGGACCCACATGTAGATGAAGGCAAACACGCAGAGCAAAGGAGAGTAGTCCACCCGGTATAAGTTTGTGCTTTGAATTCTGGCTACGCAGACTTGCACTCTGTCCCGGCATTCACTATACTTCTCCGGAAGTCCTTTAAGAAATGTCCGCGCTCATGTGGTTCCCGTTGCTCAGGGGCCAACTCAAGTAGATCTTTAAGGCGCAGTCGACCACAGGCTACTAGATACGAGTTATACTTATCCGGACATCTGGCTAAATACTTGGATACGATACTTCCCCAGTCGTGAGAACGAAGCTAATACAGATCGAATTTCGATGGTTCAGGCAGGCAGTTCTCAGGAGGCAAGGTGTTAAATAGTTTCGGAGGCTCTTTCGTACGATCAGGGTCTACTACCCTAGGGCATTTTGACTTTGGATTAAATATGCAAAATGCAAGGCCGATTGTGATCAGTACTGATACTCCAACTGGACCACCTTCAGACCCTTCGAGGGGACCTAGACGACGGGAACCCTTCCAGCGGGTGATACCAGTTAGAGCAAGTCACAAACACGATTCAGCCCCCGGGGTTTATGACGTACCATGCGAGTAATAATGCACGTATACGGAGCTCTTCCACCGAGCGATGGCATTTCGGGGCGAGGTAGTTGTCTTTCATTGGCATCGCACAACCCCCATCCTCTTAATTGGCATCGTCTCCAGCTGGAAAGAATTTGAGTGAGCATGTCGCCCCTATTATTCCGTTGCCAATAAAGTGTCTCAACTTTTGGCGAAGGTTTTAACGCATACAAGGAGAAGCCGCGAGACGTCTGTACCGCTGATCTGGACGCAAAGTGCTCGGACTGCCGCTGAGTTATCCTGGACGCCATGATTAGAGCCGTCGTCACTACCTGCATACATGGGCCGATAGAGTACTGCAACCAACAACTCACTTAAGCTCCACAACGGCTGGACACTTCCGAGAGCGGTCTTACACAAACGTTAGGTCCTGGGCCGCCGACCTTACCGCTAGTTAGTGAGAGCCAGTTAAAATTATGAACGCTCGGAACCTTCCCAACAGTGGCCGCAGCCTTCCTTGACGCCTAGCACATCTGGTTTATACTCGGGTATGCCGTAGATCGGTAACCTAGGGAACGACCCTGTGGGTTTAACACCCGAGTGCGTAATCAAGCCTAGAGGCCATCTCAACTCGAGAGGTCTCCTGACAAAGAGGCGCCCGATGAATCATCCAGAGGCGTCTGGCGGTCCTACGAGAGTGGCTTTGGATGCCTGCCCCTTGGATGGATCTGTCTTTAATCGGCGCCAATACCTAGCACTGCTAGGCTCCAGACTGTGTTTACATGCCGTAACCCTGATACTCGCAGAAACGTTGCTGGAAATTCCTAGCAGCTGAAACCATTCCCCGTAACGTACTAGTACGCTAAGAGAGAGTCTCTCCTGGCCCTGATGAGTGTGTTCTCATCTGGGGCACGATACAAGAATCGGAACGAACGCAATGCCGAAGTCCCTTGTACCTTAATTTGGGCGACGCAGATAGACCCAAAGATCGCGGACTACGGAAACTAGCATAGGACCTGTGTCGAGAAGGTTCGAGCAGGTAGTGACACGCAGCGCGGTGGCCGGCGGGGTGGCACATTGCGGGTCAATACTGGTAGTAGCCACTCTTTGGACATAGCGGCGGACCAGCGCCTAGAATGTCTCATTCTCATTTTGTTCCGTGGCACGTTACGTAATGACGGCCCGCCAGCACCTGTGTATGGACTTGTAGCTCGGGCCTCTGGTCCTGGCACGACAAGGCACCAGCCAGTAATCTCTCCTAAGGCGCTAGCGTGCATAGCGCGTCTGCCTACCGCCAGAGAACGCGTCATCTGCAAGACGTCCCAGCGTAGTGAATTGTAACTGCAAGCGTTCTCTTACGGTCATAGTGCCGATTTTGAGCAGTAATGGAAGCAGCAAAATGCCGCCCAAGCGATTCGCAAACTTCTAACAGAGCTACAGCCGGACACGACGCGGTGGTGCTCGCGGTTGGTGATCTTATGATATTAACGCCCATAGCGGCCATCTTAATCGACACCATGTTCGTTTTGGCAGGCCTTGTGGTAAACACGTGCTAGTGGCACCACCCATGCCCGTGCCCATACATCCAAACCGAGAGAAAGCCTATTTAAGCGAAAACCACAACTTCGAGGTTTCACCCCCTGCCATTGATAAAGCGAGGAGTACCCCCGATGCCGGGAAGCGTCCGCACCCATTTCTTTCGTTCTGGAATCCTCGGGCGACTTCTCGAAGATACTGTGCTCACGACCTGGAGTATCATGAACAATCGGAGGAAAATGAGTAATTGTCGAGTCGTTGTTAGACGGCACTTCCGTCCGGCCCAACTGTTCTCGGATACGTGTCCCGTGGTCAATGCTCTAAACCGGCTGCCGGCGACTCAGTTCACTGAGACAAATTCTGATGCTTTCGAAGCAAGGATGCGCCCAGAGCAGAGCTGCCCAGATGAGGTTAAGAACGTAACTATAATCGATCAGCCATTCGGCTTAAGGGGCCCCGGCGAAACGCGAAACACTTGGCACATGGACGCTTCACGCGCAACAGTAGTTGTCTCTTTCGTGAGCCACCGTAGCAGCTAGAAAGGCCTATCCAGTGATGCTTTATGACTGAGTGTCGAATCTAGGTATAGCATAGACTGGCTGATCGGGCGGGTCGGCCCACCCGTCTCGGTCGAGCGGTTCTGACTTTGGGTGGCTGTGTGAACCCAACTGCAGATGGAGTTGAATGGGTACACCCTATGCGAGGCCTCGTCTTTACACCAAATCGGGGCCCTGTGAAGTGCCACTCTTTTCCAGCCGGCAGCCGCTCAGTCTGATTTTGCTTGTACATGTCGTGTGCGAACGTTCCGGGAGGCTTCCGTGTTCCAAATACCGTGTTCTCATATTCGGTCCATCTACCGACGGAGAGTTGGGATGCCCGGGCCCGGAAATATAATTTAAACTCGTGGCCAAGAATTTAGCATGTTGTAAACATGAGAGACAGGGCCGGGCTAAAACATTACCCCTGAGTAATGTAGAGCCACAACTGAACATAACATTGGGATCTAACGCACGCAATCAGTGTAGCTTCAGCCCACCCTCTAAATTTCCCCCGGACAACTGGATTATCACCTGCGTCACGCGATAATTGCTCGCATCTCACCAACACACTTCGACAAATCTGGAGTCTCCCTGGTCCGTACGTCCAAAACCGTTTAAATGGGCGGGTGTGTCGTGAACCAATCTCCTCTTCCATTTGTCACATACTGGCGATGACATCCTTTTACTTGAATTATTCATCCGGGCACCAGCCGCTTTCCCTACGATCCCCGACACTCGGGGCTTCGGGAGTTGCCCGCCAAAAAACCGACAAACCAAACTATACAATCAATCCCATCTAGATGTAGGGGACTGAGGCTCTAAGCTATGCGCCTACTATACTTTGTAGGTATCAAACTACGCTTGAAGATAGTTGATAAGGAAGCGAATTGATCGAGTACCGTATCTTCAGTCCGACTCCCGTTCGAACGCAGCACGCTAACATGGTCCACTGGCATTCTTACTAAATACCTAGTTCACTTCTACATGAGGAGTGTCTGGGCCGGACTCACCTTTGATTAGATAACTGAAG
>chrQ
TCGGCATCTAGAAACTCCAAGTCTGCAGATCTATAACACACGAGGGTATTCAGCCCTAAAGCATTGCGTCTAGGCATGGGTCTTTAATCTCGCCCCGGCAACCTCTACGCGAGCTCCTACCAGTCAACGTGATTGATCCCTCGTACCTAGCATATTCCACGGCGTTTCATAGCCTTGACGGGCACCTTATCCATTTTTACCTAGTTTGACATTAATTGCTTCAAGACTACTGCGGTACGGGTCCCTGCATCCAGAAAGGATGACAAAAAGTGTGACAGTGCGTTCAATCCATAGATTCCCGTCGGTGCGAGGGCTGAAGTTGAGCCCTACAACCCGGCGATAAAAATTGTAACCCTATGCATTGCGTCAAGTTAAGACCCTCCATCTTCGCCACGCGATAGGAATTTGAAACATCGGCGTGCTTAGAAAGGCTATTAGCGCGGGTGGCCTGATCGGTATCCGATAAAGGCGTTGCCACAAATTTTGCCGATTGACCTGCAATTACATCGGGTAAGTGCATTTCCGCCGTTAGAGTATTAAGTCATGACGTTTTCGACATGGGCATTTAATTGGCCCAAGGTGGAATATTCCTGATGTGCCTAAGTATGAGCTCCCCATGAGAATTTGAAGATCATGAAGACTTGAGTCAATTCTAAATGTAGTTACCATCACTTAAGTTCGTTCGCCTTCTGGGCAGGCTATGTCTAACGAGCGACGTCCGCAGTGTGACAATCTAGATATTGGTTGAGCAGGAATACCAAGGAGGTGCTTGAAGTTTCTCTTATGGAACCAACTTCAATCAATAGGTAGTCTCCGTTTCGTTTCCACTGAGACATTTGTGCAGTGGCACAGTATGTGGTCGTAAGCGCATGGTGTTGTTGGAACGAAGACTCTCACTTTTGTTTCCTTTGGTAGTTTAATTTAGCAGTATCCTGGTCGTTGACCAATTTGTGAATCTCCACGGTCTCTCTTTATCAGTCATACCTCTTAAACCGGCTTCCGCTCCTGCGCACATTTATATCCTACTTTCCGTCAATGTGAAAGAGAGATCAACATAATTTCGCGCACGATCTGTCCCATTTCAGACGCCATCGACGGGTCCCGCCTTCACAAAAAACCTGCCACCATGCAGTAGGTACCTCCATATGCTGAGCGTCCGTTACCGGAAGGGTTAAGTCACTGTTTAAAGGATAAGGCGAGGTTTCCCTTGGTGGTGTACTACTGCTCACGTTCCTGCTTTACTCTCCGAGTATTGTTTTAAAAGTGGGCACGCTGGAACGCAGCACCCTATAAGAAGACTCAGTTAGGTCCCCTTCACGAGCATGTTTGAGCTCTCGGACCTAAGACGTCCGAACTCGGTTACGACGGTTAAAGACAAAGCTCCCAGCATGGTATCAGAAGCCACCACGCGTGAGGATGGCGGGGCCCTGGGCACATTGGCCCCGAATTCTTCGCCCACTTAAGTCGGACTCACCACGGGAGACTACGCCCTAACCGGATAATATCTTTTAGATACCATACAGGGTGCAACCATCGCGGCGTCAGCTGAATGTGAGGACAGAGCCCCACACACAGCACTAACAGATCCATGATTTTACTTCGTTTGGGCGACGTGCGAGCCTATTCGGCCTGTCGGACTTTGTGTAGATTCGGGATTTGACCTAGCGTATAGGCCTTTGGTATACTCGAATTATCAGGGTCAAACTACCCTCAAGGAATCCTATTTCAGACGGACGTTTGCCACCCCGGAACGTTGTCGGATCGCTTCTTGCCGCAGGAGATTCATGGAGTGATAATCGCTGGACTCACAAGTGTCAGCGGACTTTCGGTGTCTTGTGGCCTACTTGCAGTGAACACCACCAAACGAGTAGTATTATGGATTGCCGGCGTGTGTTTGTGGCCATGATTGGTTGATGCGACGGCCTAGATTCTCCTACGGGAATCTACCAGGCCCAAAAGCGCTGACTTTTATGTATTTGAGGGGCCGAAATTACATAGTAACCCAGAACAAATACCCGTTAGTTATAAAGTGAGCGCATAAGTTTGGTCGATCCGGCAGTCGAACCATTGCGGTCGGACATATCCGCAGTAGTACACTAAGGCGGAATAGACTGCCGAGTCAACGCTCCCTCATTCTTGCTACCTTAGATCTCGCAGGTTCGACCATTGCTGAAGCCGCTGAATTACACGAGTTGTTTTGTTAACCCCCGGAATGTAGTTCGTACGCCTCAACTGATTCTTCAAAAGCTCACTGCACGTGACTTGTCATGTGTTCCTAAAACATACCTCATCTGTGGGTCTGGTCCCATAAGCATGGAATGTCCGTCGACGCAACATGGAAACCCACTCGCTCGCTATACGTTTATGGTGAGACAGAAACACACTGTATTAGACTGCCACTGATAGCCCCAGTAGCAAGGTGATGTGGCAGGCATGGTACCCAAACGTCTATCGTTTTGGGAACCAAGGGGAGTGCTAATAGGTCCGGCCACGTAGAATGACATAACCTCCAGAGGAGCGCAGGAGTTGATGCATTAAAAGATCCATACTAAACGTTAGCTTAATGCCTTCAAGGCACCAGCTACCTCCATGACAAGGAGATTTCGGAAGGGGTAAGATTTACTTCTGTCCCAAAAGGGTAATGACCCGTAGGGATGGAATCATTGATGAACTCTAAAGGGACTCAGCCGACTAGCCGAGAGGGCTGGACGATCATTTGATGGGAGAATACGCATACATCTAAGTGTCAAGTATTAAATCGGTAATCTCCGTAAAGGCGTGAAGTTCACAGGGCGCAGTTTCCAGTTACTCCAAGAAACTACCGGTTCAGTTATCGCTTCCGGTGCCTTCACAGCAAACATCATTCGCTCAAGAAAGTGCTGTCGCTGCGTGTGGATATTTCCCCCTCGTTCTGGAAAGTGCTCTCAGCGACGCACGTAAACATGCTGGCGACGAGAGAGGCGTCAACACGGTCCGTTACCAAACTGCGGCATTTACCACGAACCTGATTGCAAAGTGAGATTTCCGTAAGGAGGTTAGCCAAATATTACGTAGAGTGTTCCACACCAAATCCGTCGTCCACATTCGCGACGGCAGTCTAGACGTGTAATTCCCCGGATAATCCAGTTACTACATGCTGATGCAGTCATAGTGCACGCAAATGCGCAACTTAACAAGCACGACCTGAAACAGAGAACCCCTGTGTAGTCAATATAGGATGACGGACACACACACTTGCTGCTGCAATCTTACATTCTGCGAACGAGTGCAAAGTTGAAATCATGACGAACAGCCTTGCTTTTCAGAGTCTCTATCGAACTCCTTTACACCTCCATATCTACTTGCAAATCACACTAGAGGGGCGCAGCTTACTCACTGAGAGATGGTCTACCTAATCGATTTTCGGTGAACTTTGAGTACAGCATTGAGTCTGGAGGGTTCCACTACTTTATCGTACCGGTCCGACATGATTTCTTATCGAATAGATGTTGAGATGGACATTAATAAGCATAGTACGTCTCGATCGATGGCTACCTTTACGTCTATGAGTGCTTACATAAGGTCTCTCGTAAGTCATGGTCCCGCGGGGCTCGCGCAACATTGTGGATTAATGACTCCAGTGACGCATGTTCGATTCGCATGAAGTAGGTGGCGCGTATTCATACATGAATAGTAGGCAGAACGAGCACATTGGACCGATCTTGGAGGTTGGGCTTGAGGTCCCGCACTGATAGTTTACGGCCATGAAGACGACAATTGTCAATACTTCTCTATCCTGAGCGAATGCTGACGGGGGCCAGGCGGAAAAGTGCGACACAGTCTACTGATTACGTGTAGTACGTGGCTAAGCATATTCCCGGGTTCGCAAACATAGGTCTCTGATGGGGTATGGGTAAGAAATCTGAAGGTTGCGTCTCTCACCACGGTCAGGATACCGAATCAGCTCATAAGAGTTACAAACGCGCAAATGAAGGCCTAGTCCACAGGGGTGTCATTCGCACGAGCTGGGCTTAGAATCACTGTTTTCGGTCGCACCTGTAGGGGGACATGGGACGGATTTCACAACAAAAAAGCATCTCTCATGATTCGATTCAGATAGAGGAGAGGAGGTAAATGCCAACAAATCTATTCTTTAGTACCGCCTGACGGAACGTATTTAATCCTCGCCTCAGATCGACACCGCAGGGTAGCTGAAGACGTCCGTTCTTAGACATTTAGTCGATCATTTGTTATGAAACAGAACTAGGAGTCCGTGCCCTTCAGGCCGGCTCAGGGGCACCTACCTCCAGATCGCCCAGGTTGGGTTTATTAGGCGCCGAAAAGTTACTGCCCTATCAGCCCCTCCAATCCGACCTACGGACATCATCCCACTGGCTCGCAAAATATAAATTGCGGATGGGAAAGGATAAGGAAAATCATTACCTACACAGAAGGACAATGTCAGTTCCAAATAACACTGATACTTTCGGAGCAACTTGGTCCGGAAATGTAAGTACGACTATAGCCCTTTCGACCAACGCCGACAGTCCTATTTGGACGCCGAGAGAGGCGACGGGTAGCCGAATGTAAAGCTCTCGGGTCGCTCTTGGCGGAATGCGCTGCGGGTCCTACCCTAAACCCTTACCACCACCAACTTCGTTAGGAGCCGTATAGATTACAGCTCCCGCAAAATTAGAGAGGAATCTGAGTTATTAGCTGAGGACCCCGCATTTTCTGCGACGGCGTAGCTGCAGTGACGTACGATATGAGTTCCCGACTGTGAGGGAGTCCCAGTCGTGACTCCCTACAACGGCTCCAGATATTGTTACTTATGGTCAATATGCCCCGACCGCCCATTGTCTCGAGTACAGTCTTCCCCAAAGTTAAGCTGTGCATTACCTTACCGTTTTAGGTCCAGCTGGTAGCACCGAATGCTGCGCAATCCGAGCCCCCGAAATAGACTACGTGTCCACGGTCAATTGTCATGGGTAGCAGAGCTCAAAGAGGAGAAACGTGCCCCGTAAACCTATTAGATCTCGGTTGATAAATATCAGGCCACAGCAGGCTGCCCGATGCTTGTTTGAACAACAACTTCGGGAGCCGCGGTCCTTGGTTCTCCCGATATTCGGCCGCACCGAACGGTACGCGTCATCGCGAGGTGCGTTCTCGCAGCAAGAAATATTTGTTGTTGTTGTCTTCCTTCCGCATAGGAAACCTTAAGCGGTACCTTTCTACGAAGTTGAACCCTAGAAGCACGTGTAACAATTTTTTTTACGCTACACCCGGATCTGCTTCCATCTGTTGATCATATGAGCCTAATGTGACTAATCTGTGCCGTCGATTGAAAATTCGTTCTGAACCTAATCACATGAATTAAAATTAGGGCGAGAATTGGCTCCTTTTGGGCCGTAATCCTTCAAAGGGTTAACCGAATTTAGCCTCCACGGTGACACAAACTCCCATAGGTAAGGCAAACCCAATAACGAGGAAGCCTTGCCCACAGCATGTTTGATAAATACCCTTAGGGTAATATCGCGTGCAATACTGAAGCCGCTCTTCTAGCATCCGTGTTTGACATACTATGACCTTGAAGCCTGCCGCAGCTTCTAGGTCATCCAAGTAGATCAAAACGCCATGTTGTGGATCCATGCATCTTCCCAGTGAACATGGATCTTAGTGTGACAGGCGAGGAGCGGCGAACACTATCGGTGTGGCAAGCTCGGGCCTTCGTACGTTGTGGAAGTATGCGAATAAGGAGACCGTAATGTATCAAGTTCTTAAGAGCCTTGGTACCGTTGCAATTCGGCATGTTCCTACAGAGACACTCCGTGTTTGTCATCCGTCATAGATCTATGGCGTAGTTAGCGCCTCTGAAGTAGTTGTCCATTCAGCAGGCATTGCTTAGGGAGTTTCTGGCGCTTGCCGCTCAAGATGCTCACGGGCCTAAGTAGCACGGCAACCTTTTGACAAAGCATTTTATAAACTGAGCATATTGGCCCGAAACTAATCCAGCAAAGGGTGAAGACCTGTCAGCGGGCCCAGAGTGTGAACGGTCTACTGCGCGGTACATAAGTGGCGTAATCCATCAACAAGACCTACACGACCTGAATGATTTCCAACAACTTTATATGCTTTTCCGCATCTCGAGAGTACCGGAATCTATGCAATCTCCCAAGGATCCGTAGATTTGAAATTCAATCCGACGGGGTAAGGTTGCCGCGCCGGTTAGCTAATGTGCGGATTTATAGTCTTTTTCCCAGAAGGCGTAGTTAGTTTCGCACCTAACTACGACACATACTTGGGTCGACTGTTGAAGGTGGTAAGTTGCGAGCAGTCCGCCGCTCTCACGCGCCGAACCACGTTCATATCGGCAAAGTTGCGCGATGACCTATAGGTGTGCAAAGCTCGTCCGACATTGGGATTGGATTCACGTACATACGTTAGTATCATGGGTAAGCTTCCATGTCAGCCTCGTGTATAGCACCGGTGCGCCGCGCGTTAAGGATTCTATGCCCAGCAAATGTGCCAACGTTGTGGGGAGAAAAGTGTAGTTGGATGCGATCGTGACATCGGCACACCGAAACTCTGCAGCCAGTCCCGCTAATCTCATTGGCACCGGGTAAGAGATTACCTTTGGTTAGGAATCGCGTGCGACGTACTGCACGAAAACAGTGCCTGAACCGAGGTGTTTACTTAGATGGTTCTAGACCCAGCATGTTCCTCACTGGAACCTGACGTCGGTACGTGATCCTCTATACCTCCTTTTCGGTATTGGCCTGGCAGCTACTCTAACTGTTTGGGCCGCGCCGATTTCTCGAGTCCACACGGCGAGGTCAGCAAAATTGCCAGTTAGTGGATGTTGGGATCTCAACGCATTACCATGAGAGTTCTTGGTTTACCCGTTAACATCGCTGCGCACGGTGTGAAAAGCCTGTTTCTTTGGCCCCCATCATCTTCGGCCCGCAGATCTCAGATCAATGATGTAAGGTTGCGGCGGCAAAGACTAGACTTGAGTCGTGAGATGGTGCTTTGCTGAGGCCGTCTCCTATAGCTTATTCTAGGACTTTCCGCAAACCACCCGACGTGCGGCTGTCCACGATCGGATTCCATTCTGTCTCGGAGCATACAGCACTAGATTTGCCGCTTGAAAAATGTTCCATAACCATGATTTCAACCCCATCTAGTCGGCAGGCACAGCTGAGAACAGCGAAGGGCGTCGTGAAGGGCATTGCCCGTAGTGTTTCAGACGTGCTAGAGACTAAATCAACTATCTGCACTCGTAGCCTGGCGTGTGAGATGTCACCACGATGTGCCTAGAGGAGTGATTATGAACATGTATTACCACGTCCGGGTGTCGACGGCTATATGGCTAACATTTCTTATGGCTAGACGTGCTTGGAAAGGTTCCCCAGCCTTCTGTTTCCCGGTGCTTTCCACGAGTCTGGAGTTCTGGTAATTAACTACATGGCGTTAACGCGGAGGTAACCCCCAGTCATTGCATTGCAGGTAGGGCTTAGGTGCAATATAATTCACCAAGGCGCGGATTCCTCACGATTGTTACGAAGACACCCGGAGGGTTTCAGTATGGCTTGAGAAGTGTACGTTTTTCCGGCCAGGGTGTAACTATAACCAACACATGTTTGGCCACGGGCTAAGTCGGTCCGCACGACTGATTTCCCCCGCCCATGTGTTTGGGAGCAATAAACTGCGTCTGCCAAGAGTAACAACTCGAGTAGAGAAGGGAAGTCTCAGACTATTTTGCAAATCAGACTGTAAGGCTCAACAGCCATACAGCTTGCCCTACTACTGAATACTAGCGTAGCGTGGCCACATAGGAAAGACTTCATGTCTTCTAATAACCTTTTACCTCCAACGTCCCCGCCGTCTTCACGCGGTCCAACGATGAGGAAACAACCACCCCTATCTTCCGCGGAGTGGTTCACACGACCCCCGGCGTTAACGCGCACGTTGTTGTCTTTCGGGACGGCACTACCCCCAAATGCCCAGACCCAGTGCTAGCGATATTCAAACGCCGTCCGGTAAGTCCTGACGTTTTTCAACTGGATGCACTGGCGACACGTAGTTCGCAAGGCGTCCATGAGAGGTTTTAACCGTCATGTTTCCGTATCACGTCTTATGTCTGTCTCTATTCTCAGCGAAATTCTCATCATAGGGCGGAGACTATCTGAAGGCCAGCGAATACAAGATTTAATATCAAATATAGCATGGGGGCCAACAGAGGCCCCCCTGGTGCTGACGAATTATCGTGATATTAGTACAGCTGTCTGCAATGCCATTTCGAAGGCTTTTTGTTCGTATCACTGCTCTATGCATAGCGGTCACTATGACCTCTCAGCTTGACTCACCCGAATGACCAATTGTGGTCCAGCACTCCCTCATCTTCCCCCATTAACGATACGTTGGGCACCATCGGTGTGAGCTACCCGTTACAGTCATAGAATCGTTCTTTGCGTTGTACGCGGCACGGAGGTGACCGGGAAAAGCGCCGCGAAGGCCCCGCACTGAATAAAGCTAGTATTAGCGTCTGTCAAAGTGTTTTGACACCTAATTCGCTTCCAAGTCCCAATATCTAATCTAGCCTGCTTTGGGCCAACATCTCATTGCGTTATGCTAATGAAGAGGGTGCGGGATCACATCCGCTCTTCTCTTCCTATACACAGCGGACATTCGGGTTGGACGTTTGGAGTGATAATTTATCGTTAGGGATAAGTATGTCGGCGCTTAGTAGTATAGCCCGCTGACCAGCGTTCGATTTCGAACCTTACTGGACATTCTCAATAACTACTGATCATGACGTTTTCCTCAGTTCCTAGCCTTGACAACTAGCCACAGTCAGCATGGTAGAGAGCGTTGAGCCGGGGATAGCCAGGCTATTAAGACAAAGACCCTCGGGCCCCTTAATGCGCGTCAAGTCTGACGGTTTGAGTGCGGAGCAGTAAGCGCTTTGGTATAACCGTGACGTAGCAGATCCATGCTTCGCCCGCTTCCACCTGAGAGATACTAGCCTCTTTCGCACTTTGTAGGATTACGGGCAGCGAAATATTTATCCTGTGCGGCGAGCCCGCTTCGGTTTCGAGCTCTATCAGTGCGCGGTTGGCACTCCAACGCACGATAACATATACCCGCCCACAAGGCCATGCAGGTTTAACCTCCTATTCTGATTGTACCTGGCTGACTTTACGGTACCCACCAGCGCAGGATTAATAGCCTAATTATGCTAACCGGTGCTAGTCTAACTGCTGTTACTAGTCCGCCCCAGCTACCCCACGGGTCAGTAACTGCACCAGCAAGCATGGTTCTCCTCCTGAAGTTGTACGTTCGAGAACCCCGTATCGAGTTGGTATATAAATTAAGGGTTGTCTAAAACAGAAGCCTATTCCGCTATCATCGGTGTAATAACTGATCGCGCCGTGGTTAAATGGAGGAGCACCCGCATGGATACATCGCTAGCGTCTTGTAACTCTCTGGGGGCCTAGTATGGAACGGAACAATGACATCATTGCTTACGGGGCCCGCACTTAGCTGTCGCGTATCGCAAATCATATGGCATGTCAGTCCCGACATCACGAAAATGACCCCATCTGAGGTGGTCGGGAGGCGAACAGTCGAATATGATGTATGCACCCGCAACTTAATGTTCAAAGGCGGGCGAAATGCCTTCTCCCGTCCGGACTATCCTGAGTGCTAGCCGCGAGTCTGTAAAGGTTGACGCAACCATATAGCACGCAGAAAAATCACTCTCACACCATGAGAACCATGGCGGCACGCTGTCTACTTTGTCTGACAGGCTACGGAAGGAATGGTACATACGTACAAACGGATGATATGATATCGGTCATTGCCTATTGTGACGCTACCCTACTGCATCACCCCCTTAGAATGCGTTGGACGCTCTATAGCAGATCCTCCATCCAGTGGAAGTCTCGTCGCCGTGGTTTGCCTTAACGACCGTTGGAGAGAGCAGGACAGAAATATCGCCCTTTTGAGCGCATTATTTGGAATCGAGGTAAGTCAGTGCGGCATAATCGCGCCTCGTGAGCGGAACAGTTTTTGATCCCACCCGCTAAATGCCAAGGTGCTGTAACCTGGGCGCGACACCAAAAGACCACGTGCTGTATGAAGCATGTGTTCTAGCGCACTCTCAACCGTTACCCCGAGAGTAAAATGTTAGTTGTAGGCCGATTCTGCAATGGTAATTGGCGGAGTGTCTAGGGAAATGTTTCGGTCATACTTAACCGGCTACCTCTTCCTCCCTCAGATTCGGTCTGAGATGAGATATACTGGGTGAGTTGAGTCGCCCTGTATCGTTGCGGCGCTCGTGGACCAGACAGACAGTTCCCGTTTATCTCTGCTTCTAGATGGAGGGTCGCCTCCGTGTTAACGCCGGCGAAGGTAGTCGCAGCTGAAGTTGTGATGCACAATCAGGTGAGCCTTTTAAGTATGGTCCTACGGACGTGAACAGCTGGGCCCAGTCATTTAGTACGGGGGGTTTACCTATAAGGATACGGTAAGAACGTCATCTATCCGTCCCACTGGAGTCCGAGGGGTTCGTGTCTACACGGATTACTTATCATGCACACACGTCTACGGTCATGCATAAAGTTGTGCAGCGCAGCAATCGGAGCGGAGTTACACCATCTCCCTATTAACAAGGCACTTATTAGTACTTACCCCGTTATAGAGCTCTCATCTTATCGATAGAGCGCAGTCCTAAGTATTGGCTCGAGTGATTCGCTCCTCAGCCCTTGATTGTAACTCCCCCGATTGCAGGTTGTATGGTGAGTAAAATCTCTGCGCCCTTCTGTTCGGATAAAGAACCCCGACCACTAATGCCCGCCTGCTTGTTGGGCGGTAAATGGGTAACGGAACATGGACTATGAGTGCGATGATGGTCAATAGAATTACCTTATTACGCAGTAAAAGGAATGACGCAGACAGGTATTTGTCGACGATTGCTTCGAACCTGGCAAAATGGGGAGGTATCCTGTCATGTTCATCTGTAAAACAACTCCTGCCTCTTCGTAGAGGACACACACTGTGGGCCTTTAGCCTTTAGCAGCCCATTGGGGCTTACCAGCTGTCGTCATGGGGTATCATTAAGATCCATGCGCCCCCGAAACTTACTGCAAAACAATATGGCTTAAAGGTAAAGGGACCATCAGGAGAATGCTTAAGAGCGACATATAGATACGTATTTAATTAATTTATGTTAACGCAACCATCTCGCAGGAGTCGCATAGCATATTGCCGGGTGATAGTTAATGCACTGTGCTTCCGTGTTTATATAAAATAAGCAGTAACCTCTGACAGGTTGAGACTCCAACAAGTGCTCCGGGTATTTACCTTCTACCATGGCGTTCTAATATCACGAAAGAGAAATTGTGTGTACCGATGCCAGGTGACCGCCCGCGTGCGCCAACGACGCAATCTAGAGCATCCACGCTGAATTGGGGAACTCTTGCCGTTCGTCGCATGGTGTACTTGGTACCACTCGATATGCCTGATTAGGTTTGGCCGTAGCACGTAAGGTAGTGACTTTCCATTCAAGCTAGCGAAGCGACACCACCACAGTGCCCGGTCAAAATAACCCACACCTGGCCAGCATAGAGGCTAAAATAGCTACAGTGCGCTAATCGAGTGTTTTTGCATCGGCTCGTGGCTGGTGGACTCGGGACAGCTTAGAACTAACTCTGGTGTACAAACGCGATCGTAGCTCTCGCGACTTACTCACCGGAGTAGGTTAGATGGACAAGACCTAACCCGAAGCCTAAATCGCCCTGAGTGTTAGCCGCCATTCAATTCTATGGTTTATCGGGGGCGTCTATGGCTGCGACAGTATGGAGGCCCGTTATGGGCACCCGAGTATCGTACCATAGTAATCCCATATTCCTCTTCGAGCGACTATTGGATCAACATACCTACAGGGTAGTATGAATGTTCTTGATTACAGAAACCATGGAATCGGCGCATTCTATGTTTCACTTCCGAATAACAGTGAGCAAGGCATGCCCTTGACAAGGATCATCCCGACAGCAAGCCGATCGGGCCCTAGAGCCCGACCCCCAAACAGAACACCGGCCACGTAGTTGCTGGGACTAAACAAAGGTGTGTTTCCATAAAAGGAAATCTTCAAGTGTATTGTTGAGTCGTAACGCTTATATTTATGGCCCAATGGGCGTTGCGAGCACAGTAGCAGGCCTAGATGAATGCCTAGGCCACGATCGGGGGGAGGCTCATTGAACGTACTGCCATACCAAGCCCCCGTATGCTATGGCAGGAGGGGTTCTCTTCGTATAGAGCGAGGGTCTCTACGCCAAGCAGCATTCCCGTGTTGGGTGGCCAATGGGGCTCACTAGAAACTCGGTTTTTTTAGCGAAGGAATGAGCAAACTCGTGAAAGGTGGTACACACCAGTTGCGGCCGATTTGTTGTAGCAACAAGGTTTGAAGAATTGAGTAGATGGGCCAATTTACCTCCTATTTAGCGAGTGAGATGGCGCATGTTTATTCAGACTCCATGTGGGGTAGAGGCTAATCGTTTAGTAGCAATAACCCCGCGGGGCAAGAGACCGTAATAACTTGAATCTGTGGTAGCTATGAATATGTGCTTCGCCCTAAGTGTTATGTAACAAGAGTGATCCAGGGGCTCAGATCACACTTAGTACGATCCGCTACTGAAATGCGGCCGCGGGCTTGCACGCTGGACATAAGTCGGATAATCAATTGCCTACGACAGGTTCAGCCATAAGGCTTGGCTCCTAACACACTCATGATGTCTGGCTTTTACTCGTGCCCGGACATAAACGTATGCTCAAACGCGAGACAGGGGAGGGTCAGCACCGTTTAGATCTATAAGGCCTACCGGTAATATGGATCGACAACAAACAGATGCTATAGGGATACCTACTCCTTTGGACCCACATGTAGATGAAGGCAAACACGCAGAGCAAAGGAGAGTAGTCCACCCGGTATAAGTTTGTGCTTTGAATTCTGGCTACGCAGACTTGCACTCTGTCCCGGCATTCACTATACTTCTCCGGAAGTCCTTTAAGAAATGTCCGCGCTCATGTGGTTCCCGTTGCTCAGGGGCCAACTCAAGTAGATCTTTAAGGCGCAGTCGACCACAGGCTACTAGATACGAGTTATACTTATCCGGACATCTGGCTAAATACTTGGATACGATACTTCCCCAGTCGTGAGAACGAAGCTAATACAGATCGAATTTCGATGGTTCAGGCAGGCAGTTCTCAGGAGGCAAGGTGTTAAATAGTTTCGGAGGCTCTTTCGTACGATCAGGGTCTACTACCCTAGGGCATTTTGACTTTGGATTAAATATGCAAAATGCAAGGCCGATTGTGATCAGTACTGATACTCCAACTGGACCACCTTCAGACCCTTCGAGGGGACCTAGACGACGGGAACCCTTCCAGCGGGTGATACCAGTTAGAGCAAGTCACAAACACGATTCAGCCCCCGGGGTTTATGACGTACCATGCGAGTAATAATGCACGTATACGGAGCTCTTCCACCGAGCGATGGCATTTCGGGGCGAGGTAGTTGTCTTTCATTGGCATCGCACAACCCCCATCCTCTTAATTGGCATCGTCTCCAGCTGGAAAGAATTTGAGTGAGCATGTCGCCCCTATTATTCCGTTGCCAATAAAGTGTCTCAACTTTTGGCGAAGGTTTTAACGCATACAAGGAGAAGCCGCGAGACGTCTGTACCGCTGATCTGGACGCAAAGTGCTCGGACTGCCGCTGAGTTATCCTGGACGCCATGATTAGAGCCGTCGTCACTACCTGCATACATGGGCCGATAGAGTACTGCAACCAACAACTCACTTAAGCTCCACAACGGCTGGACACTTCCGAGAGCGGTCTTACACAAACGTTAGGTCCTGGGCCGCCGACCTTACCGCTAGTTAGTGAGAGCCAGTTAAAATTATGAACGCTCGGAACCTTCCCAACAGTGGCCGCAGCCTTCCTTGACGCCTAGCACATCTGGTTTATACTCGGGTATGCCGTAGATCGGTAACCTAGGGAACGACCCTGTGGGTTTAACACCCGAGTGCGTAATCAAGCCTAGAGGCCATCTCAACTCGAGAGGTCTCCTGACAAAGAGGCGCCCGATGAATCATCCAGAGGCGTCTGGCGGTCCTACGAGAGTGGCTTTGGATGCCTGCCCCTTGGATGGATCTGTCTTTAATCGGCGCCAATACCTAGCACTGCTAGGCTCCAGACTGTGTTTACATGCCGTAACCCTGATACTCGCAGAAACGTTGCTGGAAATTCCTAGCAGCTGAAACCATTCCCCGTAACGTACTAGTACGCTAAGAGAGAGTCTCTCCTGGCCCTGATGAGTGTGTTCTCATCTGGGGCACGATACAAGAATCGGAACGAACGCAATGCCGAAGTCCCTTGTACCTTAATTTGGGCGACGCAGATAGACCCAAAGATCGCGGACTACGGAAACTAGCATAGGACCTGTGTCGAGAAGGTTCGAGCAGGTAGTGACACGCAGCGCGGTGGCCGGCGGGGTGGCACATTGCGGGTCAATACTGGTAGTAGCCACTCTTTGGACATAGCGGCGGACCAGCGCCTAGAATGTCTCATTCTCATTTTGTTCCGTGGCACGTTACGTAATGACGGCCCGCCAGCACCTGTGTATGGACTTGTAGCTCGGGCCTCTGGTCCTGGCACGACAAGGCACCAGCCAGTAATCTCTCCTAAGGCGCTAGCGTGCATAGCGCGTCTGCCTACCGCCAGAGAACGCGTCATCTGCAAGACGTCCCAGCGTAGTGAATTGTAACTGCAAGCGTTCTCTTACGGTCATAGTGCCGATTTTGAGCAGTAATGGAAGCAGCAAAATGCCGCCCAAGCGATTCGCAAACTTCTAACAGAGCTACAGCCGGACACGACGCGGTGGTGCTCGCGGTTGGTGATCTTATGATATTAACGCCCATAGCGGCCATCTTAATCGACACCATGTTCGTTTTGGCAGGCCTTGTGGTAAACACGTGCTAGTGGCACCACCCATGCCCGTGCCCATACATCCAAACCGAGAGAAAGCCTATTTAAGCGAAAACCACAACTTCGAGGTTTCACCCCCTGCCATTGATAAAGCGAGGAGTACCCCCGATGCCGGGAAGCGTCCGCACCCATTTCTTTCGTTCTGGAATCCTCGGGCGACTTCTCGAAGATACTGTGCTCACGACCTGGAGTATCATGAACAATCGGAGGAAAATGAGTAATTGTCGAGTCGTTGTTAGACGGCACTTCCGTCCGGCCCAACTGTTCTCGGATACGTGTCCCGTGGTCAATGCTCTAAACCGGCTGCCGGCGACTCAGTTCACTGAGACAAATTCTGATGCTTTCGAAGCAAGGATGCGCCCAGAGCAGAGCTGCCCAGATGAGGTTAAGAACGTAACTATAATCGATCAGCCATTCGGCTTAAGGGGCCCCGGCGAAACGCGAAACACTTGGCACATGGACGCTTCACGCGCAACAGTAGTTGTCTCTTTCGTGAGCCACCGTAGCAGCTAGAAAGGCCTATCCAGTGATGCTTTATGACTGAGTGTCGAATCTAGGTATAGCATAGACTGGCTGATCGGGCGGGTCGGCCCACCCGTCTCGGTCGAGCGGTTCTGACTTTGGGTGGCTGTGTGAACCCAACTGCAGATGGAGTTGAATGGGTACACCCTATGCGAGGCCTCGTCTTTACACCAAATCGGGGCCCTGTGAAGTGCCACTCTTTTCCAGCCGGCAGCCGCTCAGTCTGATTTTGCTTGTACATGTCGTGTGCGAACGTTCCGGGAGGCTTCCGTGTTCCAAATACCGTGTTCTCATATTCGGTCCATCTACCGACGGAGAGTTGGGATGCCCGGGCCCGGAAATATAATTTAAACTCGTGGCCAAGAATTTAGCATGTTGTAAACATGAGAGACAGGGCCGGGCTAAAACATTACCCCTGAGTAATGTAGAGCCACAACTGAACATAACATTGGGATCTAACGCACGCAATCAGTGTAGCTTCAGCCCACCCTCTAAATTTCCCCCGGACAACTGGATTATCACCTGCGTCACGCGATAATTGCTCGCATCTCACCAACACACTTCGACAAATCTGGAGTCTCCCTGGTCCGTACGTCCAAAACCGTTTAAATGGGCGGGTGTGTCGTGAACCAATCTCCTCTTCCATTTGTCACATACTGGCGATGACATCCTTTTACTTGAATTATTCATCCGGGCACCAGCCGCTTTCCCTACGATCCCCGACACTCGGGGCTTCGGGAGTTGCCCGCCAAAAAACCGACAAACCAAACTATACAATCAATCCCATCTAGATGTAGGGGACTGAGGCTCTAAGCTATGCGCCTACTATACTTTGTAGGTATCAAACTACGCTTGAAGATAGTTGATAAGGAAGCGAATTGATCGAGTACCGTATCTTCAGTCCGACTCCCGTTCGAACGCAGCACGCTAACATGGTCCACTGGCATTCTTACTAAATACCTAGTTCACTTCTACATGAGGAGTGTCTGGGCCGGACTCACCTTTGATTAGATAACTGAAG
......@@ -15,7 +15,7 @@
#
# Set root logger level to DEBUG and its only appender to A1.
log4j.rootLogger=ERROR, A1
log4j.rootLogger=FATAL, A1
# A1 is set to be a ConsoleAppender.
log4j.appender.A1=org.apache.log4j.ConsoleAppender
......
package nl.lumc.sasc.biopet.core
import java.nio.file.Paths
import nl.lumc.sasc.biopet.utils.{ConfigUtils, Logging}
import nl.lumc.sasc.biopet.utils.config.{Configurable, Config}
import org.scalatest.Matchers
import org.scalatest.mock.MockitoSugar
import org.scalatest.testng.TestNGSuite
import org.mockito.Mockito._
import org.testng.annotations.Test
/**
* Created by pjvan_thof on 12/30/15.
*/
class ReferenceTest extends TestNGSuite with Matchers with MockitoSugar {
import ReferenceTest._
@Test
def testDefault: Unit = {
make(config :: testReferenceNoIndex :: Nil).referenceFasta()
Logging.checkErrors(true)
make(config :: testReference :: Nil).referenceFasta()
Logging.checkErrors(true)
}
@Test
def testIndexes: Unit = {
make(config :: testReferenceNoIndex :: Nil, fai = true, dict = true).referenceFasta()
intercept[IllegalStateException] {
Logging.checkErrors(true)
}
val a = make(config :: testReference :: Nil, fai = true, dict = true)
a.referenceFasta()
a.referenceSummary shouldBe Map(
"contigs" -> Map("chrQ" -> Map("md5" -> Some("94445ec460a68206ae9781f71697d3db"), "length" -> 16571)),
"species" -> "test_species",
"name" -> "test_genome")
Logging.checkErrors(true)
}
}
object ReferenceTest {
private def resourcePath(p: String): String = {
Paths.get(getClass.getResource(p).toURI).toString
}
val config = Map("species" -> "test_species", "reference_name" -> "test_genome")
val testReferenceNoIndex = Map(
"references" -> Map(
"test_species" -> Map(
"test_genome" -> Map(
"reference_fasta" -> resourcePath("/fake_chrQ_no_index.fa")))))
val testReference = Map(
"references" -> Map(
"test_species" -> Map(
"test_genome" -> Map(
"reference_fasta" -> resourcePath("/fake_chrQ.fa")))))
def make(configs: List[Map[String, Any]],
r: Configurable = null,
fai: Boolean = false,
dict: Boolean = false) = new Reference {
val root = r
override def globalConfig = new Config(configs
.foldLeft(Map[String, Any]()) { case (a, b) => ConfigUtils.mergeMaps(a, b)} )
override def dictRequired = if (dict) true else super.dictRequired
override def faiRequired = if (fai) true else super.faiRequired
}
}
\ No newline at end of file
......@@ -43,18 +43,19 @@ object Logging {
errors.append(new Exception(msg))
}
def checkErrors(): Unit = {
def checkErrors(debug: Boolean = false): Unit = {
if (errors.nonEmpty) {
logger.error("*************************")
logger.error("Biopet found some errors:")
if (logger.isDebugEnabled) {
if (debug || logger.isDebugEnabled) {
for (e <- errors) {
logger.error(e.getMessage)
logger.debug(e.getStackTrace.mkString("Stack trace:\n", "\n", "\n"))
logger.error(e.getStackTrace.mkString("Stack trace:\n", "\n", "\n"))
}
} else {
errors.map(_.getMessage).sorted.distinct.foreach(logger.error(_))
}
errors.clear()
throw new IllegalStateException("Biopet found errors")
}
}
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment