Commit 901811a4 authored by Wai Yi Leung's avatar Wai Yi Leung
Browse files

Merge branch 'patch-flexiprep-parse-adapters' into 'develop'

Patch flexiprep parse adapters

This addresses the bug (not reported) where the adapters are incorrectly supplied to cutadapt. To protect against it, unit tests were added, and some refactoring was done.

See merge request !82
parents 4bf8722f b9e3a088
......@@ -25,10 +25,10 @@ import nl.lumc.sasc.biopet.core.config.Configurable
class Fastqc(val root: Configurable) extends BiopetCommandLineFunction {
@Input(doc = "Contaminants", required = false)
var contaminants: File = _
var contaminants: Option[File] = None
@Input(doc = "Adapters", required = false)
var adapters: File = _
var adapters: Option[File] = None
@Input(doc = "Fastq file", shortName = "FQ")
var fastqfile: File = _
......@@ -50,17 +50,19 @@ class Fastqc(val root: Configurable) extends BiopetCommandLineFunction {
override def afterGraph {
if (contaminants == null) {
val fastqcDir = executable.substring(0, executable.lastIndexOf("/"))
val defaultContams = getVersion match {
case "v0.11.2" => new File(fastqcDir + "/Configuration/contaminant_list.txt")
case _ => new File(fastqcDir + "/Contaminants/contaminant_list.txt")
val defaultAdapters = getVersion match {
case "v0.11.2" => new File(fastqcDir + "/Configuration/adapter_list.txt")
case _ => null
contaminants = config("contaminants", default = defaultContams)
contaminants = contaminants match {
case None =>
val fastqcDir = executable.substring(0, executable.lastIndexOf("/"))
val defaultContams = getVersion match {
case "v0.11.2" => Option(new File(fastqcDir + "/Configuration/contaminant_list.txt"))
case _ => Option(new File(fastqcDir + "/Contaminants/contaminant_list.txt"))
val defaultAdapters = getVersion match {
case "v0.11.2" => Option(new File(fastqcDir + "/Configuration/adapter_list.txt"))
case _ => None
config("contaminants", default = defaultContams)
case wrapped @ Some(_) => wrapped
......@@ -74,6 +76,6 @@ class Fastqc(val root: Configurable) extends BiopetCommandLineFunction {
conditional(noextract, "--noextract") +
conditional(extract, "--extract") +
conditional(quiet, "--quiet") +
required("-o", output.getParent()) +
required("-o", output.getParent) +
......@@ -39,5 +39,17 @@
......@@ -33,14 +33,14 @@ class Cutadapt(root: Configurable) extends nl.lumc.sasc.biopet.extensions.Cutada
override def beforeCmd() {
val foundAdapters =
val foundAdapters =
if (default_clip_mode == "3") opt_adapter ++= foundAdapters
else if (default_clip_mode == "5") opt_front ++= foundAdapters
else if (default_clip_mode == "both") opt_anywhere ++= foundAdapters
override def cmdLine = {
if (!opt_adapter.isEmpty || !opt_anywhere.isEmpty || !opt_front.isEmpty) {
if (opt_adapter.nonEmpty || opt_anywhere.nonEmpty || opt_front.nonEmpty) {
analysisName = getClass.getSimpleName
} else {
......@@ -16,82 +16,154 @@
package nl.lumc.sasc.biopet.pipelines.flexiprep
import nl.lumc.sasc.biopet.core.config.Configurable
import{ File, FileNotFoundException }
import argonaut._, Argonaut._
import scalaz._, Scalaz._
import nl.lumc.sasc.biopet.core.config.Configurable
import nl.lumc.sasc.biopet.utils.ConfigUtils
* FastQC wrapper with added functionality for the Flexiprep pipeline
* This wrapper implements additional methods for parsing FastQC output files and aggregating everything in a summary
* object. The current implementation is based on FastQC v0.10.1.
class Fastqc(root: Configurable) extends nl.lumc.sasc.biopet.extensions.Fastqc(root) {
def getDataBlock(name: String): Array[String] = { // Based on Fastqc v0.10.1
val outputDir = output.getAbsolutePath.stripSuffix(".zip")
val dataFile = new File(outputDir + "/fastqc_data.txt")
if (!dataFile.exists) return null
val data = Source.fromFile(dataFile).mkString
for (block <- data.split(">>END_MODULE\n")) {
val b = if (block.startsWith("##FastQC")) block.substring(block.indexOf("\n") + 1) else block
if (b.startsWith(">>" + name))
return for (line <- b.split("\n"))
yield line
return null
def getEncoding: String = {
val block = getDataBlock("Basic Statistics")
if (block == null) return null
for (
line <- block if (line.startsWith("Encoding"))
) return line.stripPrefix("Encoding\t")
return null // Could be default Sanger with a warning in the log
/** Class for storing a single FastQC module result */
protected case class FastQCModule(name: String, status: String, lines: Seq[String])
/** Default FastQC output directory containing actual results */
// this is a def instead of a val since the value depends on the variable `output`, which is null on class creation
def outputDir: File = new File(output.getAbsolutePath.stripSuffix(".zip"))
/** Default FastQC output data file */
// this is a def instead of a val since the value depends on the variable `output`, which is null on class creation
def dataFile: File = new File(outputDir, "fastqc_data.txt")
* FastQC QC modules.
* @return Mapping of FastQC module names and its contents as array of strings (one item per line)
* @throws FileNotFoundException if the FastQC data file can not be found.
* @throws IllegalStateException if the module lines have no content or mapping is empty.
def qcModules: Map[String, FastQCModule] = {
val fqModules = Source.fromFile(dataFile)
// drop all the characters before the first module delimiter (i.e. '>>')
.dropWhile(_ != '>')
// pull everything into a string
// split into modules
// make map of module name -> module lines
.map {
case (modString) =>
// module name is in the first line, without '>>' and before the tab character
val Array(firstLine, otherLines) = modString
// drop all '>>' character (start of module)
.dropWhile(_ == '>')
// split first line and others
.split("\n", 2)
// and slice them
.slice(0, 2)
// extract module name and module status
val Array(modName, modStatus) = firstLine
.split("\t", 2)
.slice(0, 2)
modName -> FastQCModule(modName, modStatus, otherLines.split("\n").toSeq)
if (fqModules.isEmpty) throw new IllegalStateException("Empty FastQC data file " + dataFile.toString)
else fqModules
protected case class Sequence(name: String, seq: String)
def getFoundAdapters: List[Sequence] = {
def getSeqs(file: File) = {
if (file != null) {
(for (
line <- Source.fromFile(file).getLines(); if line.startsWith("#");
values = line.split("\t*") if values.size >= 2
) yield Sequence(values(0), values(1))).toList
} else Nil
* Retrieves the FASTQ file encoding as computed by FastQC.
* @return encoding name
* @throws NoSuchElementException when the "Basic Statistics" key does not exist in the mapping or
* when a line starting with "Encoding" does not exist.
def encoding: String =
qcModules("Basic Statistics")
/** Case class representing a known adapter sequence */
protected case class AdapterSequence(name: String, seq: String)
val seqs = getSeqs(adapters) ::: getSeqs(contaminants)
* Retrieves overrepresented sequences found by FastQ.
* @return a [[Set]] of [[AdapterSequence]] objects.
def foundAdapters: Set[AdapterSequence] = {
val block = getDataBlock("Overrepresented sequences")
if (block == null) return Nil
/** Returns a list of adapter and/or contaminant sequences known to FastQC */
def getFastqcSeqs(file: Option[File]): Set[AdapterSequence] = file match {
case None => Set.empty[AdapterSequence]
case Some(f) =>
(for {
line <- Source.fromFile(f).getLines()
if !line.startsWith("#")
values = line.split("\t+")
if values.size >= 2
} yield AdapterSequence(values(0), values(1))).toSet
val found = for (
line <- block if !line.startsWith("#");
values = line.split("\t") if values.size >= 4
) yield values(3)
val found = qcModules.get("Overrepresented sequences") match {
case None => Seq.empty[String]
case Some(qcModule) =>
for (
line <- qcModule.lines if !(line.startsWith("#") || line.startsWith(">"));
values = line.split("\t") if values.size >= 4
) yield values(3)
seqs.filter(x => found.exists(_.startsWith(
// select full sequences from known adapters and contaminants
// based on overrepresented sequences results
(getFastqcSeqs(adapters) ++ getFastqcSeqs(contaminants))
.filter(x => found.exists(_.startsWith(
def getSummary: Json = {
val subfixs = Map("plot_duplication_levels" -> "Images/duplication_levels.png",
"plot_kmer_profiles" -> "Images/kmer_profiles.png",
"plot_per_base_gc_content" -> "Images/per_base_gc_content.png",
"plot_per_base_n_content" -> "Images/per_base_n_content.png",
"plot_per_base_quality" -> "Images/per_base_quality.png",
"plot_per_base_sequence_content" -> "Images/per_base_sequence_content.png",
"plot_per_sequence_gc_content" -> "Images/per_sequence_gc_content.png",
"plot_per_sequence_quality" -> "Images/per_sequence_quality.png",
"plot_sequence_length_distribution" -> "Images/sequence_length_distribution.png",
"fastqc_data" -> "fastqc_data.txt")
val dir = output.getAbsolutePath.stripSuffix(".zip") + "/"
var outputMap: Map[String, Map[String, String]] = Map()
for ((k, v) <- subfixs) outputMap += (k -> Map("path" -> (dir + v)))
val temp = ("" := outputMap) ->: jEmptyObject
return temp.fieldOrEmptyObject("")
/** Summary of the FastQC run, stored in a [[Json]] object */
def summary: Json = {
val outputMap =
Map("plot_duplication_levels" -> "Images/duplication_levels.png",
"plot_kmer_profiles" -> "Images/kmer_profiles.png",
"plot_per_base_gc_content" -> "Images/per_base_gc_content.png",
"plot_per_base_n_content" -> "Images/per_base_n_content.png",
"plot_per_base_quality" -> "Images/per_base_quality.png",
"plot_per_base_sequence_content" -> "Images/per_base_sequence_content.png",
"plot_per_sequence_gc_content" -> "Images/per_sequence_gc_content.png",
"plot_per_sequence_quality" -> "Images/per_sequence_quality.png",
"plot_sequence_length_distribution" -> "Images/sequence_length_distribution.png",
"fastqc_data" -> "fastqc_data.txt")
.map {
case (name, relPath) =>
name -> Map("path" -> (outputDir + relPath))
object Fastqc {
def apply(root: Configurable, fastqfile: File, outDir: String): Fastqc = {
val fastqcCommand = new Fastqc(root)
fastqcCommand.fastqfile = fastqfile
......@@ -102,6 +174,6 @@ object Fastqc {
//if (filename.endsWith(".fq")) filename = filename.substring(0,filename.size - 3)
fastqcCommand.output = new File(outDir + "/" + filename + "")
return fastqcCommand
......@@ -201,7 +201,7 @@ class FlexiprepSummary(val root: Configurable) extends InProcessFunction with Co
def fastqcSummary(fastqc: Fastqc): Option[Json] = {
if (fastqc == null) return None
else return Option(fastqc.getSummary)
else return Option(fastqc.summary)
def clipstatSummary(): Option[Json] = {
......@@ -25,7 +25,7 @@ class SeqtkSeq(root: Configurable) extends nl.lumc.sasc.biopet.extensions.seqtk.
override def beforeCmd {
if (fastqc != null && Q == None) {
val encoding = fastqc.getEncoding
val encoding = fastqc.encoding
Q = encoding match {
case null => None
case s if (s.contains("Sanger / Illumina 1.9")) => None
# This file contains a list of potential contaminants which are
# frequently found in high throughput sequencing reactions. These
# are mostly sequences of adapters / primers used in the various
# sequencing chemistries.
# Please DO NOT rely on these sequences to design your own oligos, some
# of them are truncated at ambiguous positions, and none of them are
# definitive sequences from the manufacturers so don't blame us if you
# try to use them and they don't work.
# You can add more sequences to the file by putting one line per entry
# and specifying a name[tab]sequence. If the contaminant you add is
# likely to be of use to others please consider sending it to the FastQ
# authors, either via a bug report at
# or by directly emailing so other users of
# the program can benefit.
Illumina DpnII expression Adapter 1 ACAGGTTCAGAGTTCTACAGTCCGAC
Illumina DpnII expression Adapter 2 CAAGCAGAAGACGGCATACGA
Illumina DpnII expression PCR Primer 1 CAAGCAGAAGACGGCATACGA
Illumina DpnII expression Sequencing Primer CGACAGGTTCAGAGTTCTACAGTCCGACGATC
Illumina NlaIII expression Adapter 2 CAAGCAGAAGACGGCATACGA
Illumina NlaIII expression PCR Primer 1 CAAGCAGAAGACGGCATACGA
Illumina Multiplexing Adapter 1 GATCGGAAGAGCACACGTCT
Illumina Multiplexing Read1 Sequencing Primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Multiplexing Index Sequencing Primer GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Illumina Multiplexing Read2 Sequencing Primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
ABI Solid3 EF1 alpha Antisense Primer GAAAACCAAAGTGGTCCAC
* Biopet is built on top of GATK Queue for building bioinformatic
* pipelines. It is mainly intended to support LUMC SHARK cluster which is running
* SGE. But other types of HPC that are supported by GATK Queue (such as PBS)
* should also be able to execute Biopet tools and pipelines.
* Copyright 2014 Sequencing Analysis Support Core - Leiden University Medical Center
* Contact us at:
* A dual licensing mode is applied. The source code within this project that are
* not part of GATK Queue is freely available for non-commercial use under an AGPL
* license; For commercial users or users who do not want to follow the AGPL
* license, please contact us to obtain a separate license.
package nl.lumc.sasc.biopet.pipelines.flexiprep
import java.nio.file.Paths
import org.scalatest.Matchers
import org.scalatest.testng.TestNGSuite
import org.testng.annotations.Test
class FastqcV0101Test extends TestNGSuite with Matchers {
/** Returns the absolute path to test resource directory as a File object */
private val resourceDir: File = new File(Paths.get(getClass.getResource("/").toURI).toString)
/** Given a resource file name, returns the the absolute path to it as a File object */
private def resourceFile(p: String): File = new File(resourceDir, p)
/** Mock output file of a FastQC v0.10.1 run */
// the file doesn't actually exist, we just need it so the outputDir value can be computed correctly
private val outputv0101: File = resourceFile("")
@Test def testOutputDir() = {
val fqc = new Fastqc(null)
fqc.output = outputv0101
fqc.outputDir shouldBe new File(resourceDir, "v0101.fq_fastqc")
@Test def testQcModules() = {
val fqc = new Fastqc(null)
fqc.output = outputv0101
// 11 QC modules
fqc.qcModules.size shouldBe 11
// first module
fqc.qcModules.keySet should contain("Basic Statistics")
// mid (6th module)
fqc.qcModules.keySet should contain("Per sequence GC content")
// last module
fqc.qcModules.keySet should contain("Kmer Content")
@Test def testSingleQcModule() = {
val fqc = new Fastqc(null)
fqc.output = outputv0101
fqc.qcModules("Basic Statistics").name should ===("Basic Statistics")
fqc.qcModules("Basic Statistics").status should ===("pass")
fqc.qcModules("Basic Statistics").lines.size shouldBe 8
@Test def testEncoding() = {
val fqc = new Fastqc(null)
fqc.output = outputv0101
fqc.encoding shouldBe "Sanger / Illumina 1.9"
@Test def testFoundAdapter() = {
val fqc = new Fastqc(null)
fqc.output = outputv0101
fqc.contaminants = Option(resourceFile("fqc_contaminants_v0101.txt"))
val adapters = fqc.foundAdapters
adapters.size shouldBe 1