Add `unittest` for Python bindings with a Rust harness loader

lightmotif-py/Cargo.toml

@@ -31,4 +31,9 @@ pyo3-built = "0.4.7"
 [features]
 default = []
 extension-module = ["pyo3/extension-module"]
-nightly = ["pyo3/nightly"]
\ No newline at end of file
+nightly = ["pyo3/nightly"]
+
+[[test]]
+name = "unittest"
+path = "lightmotif/tests/unittest.rs"
+harness = false

lightmotif-py/lightmotif/tests/__init__.py

+from . import (
+    test_dna
+)
+
+def load_tests(loader, suite, pattern):
+    suite.addTests(loader.loadTestsFromModule(test_dna))
+    return suite

lightmotif-py/lightmotif/tests/test_dna.py

+import gzip
+import os
+import tempfile
+import unittest
+
+import lightmotif
+
+SEQUENCE = "ATGTCCCAACAACGATACCCCGAGCCCATCGCCGTCATCGGCTCGGCATGCAGATTCCCAGGCG"
+EXPECTED = [
+    -23.07094  , -18.678621 , -15.219191 , -17.745737 , 
+    -18.678621 , -23.07094  , -17.745737 , -19.611507 , 
+    -27.463257 , -29.989803 , -14.286304 , -26.53037  , 
+    -15.219191 , -10.826873 , -10.826873 , -22.138054 , 
+    -38.774437 , -30.922688 ,  -5.50167  , -24.003826 ,
+    -18.678621 , -15.219191 , -35.315006 , -17.745737 , 
+    -10.826873 , -30.922688 , -23.07094  ,  -6.4345555, 
+    -31.855574 , -23.07094  , -15.219191 , -31.855574 ,  
+    -8.961102  , -26.53037  , -27.463257 , -14.286304 , 
+    -15.219191 , -26.53037  , -23.07094  , -18.678621 ,
+    -14.286304 , -18.678621 , -26.53037  , -16.152077 , 
+    -17.745737 , -18.678621 , -17.745737 , -14.286304 , 
+    -30.922688 , -18.678621 
+]
+
+class TestDNAMotif(unittest.TestCase):
+
+    def test_calculate(self):
+        counts = lightmotif.create(["GTTGACCTTATCAAC", "GTTGATCCAGTCAAC"])
+        frequencies = counts.normalize(0.1)
+        pssm = frequencies.log_odds()
+
+        seq = lightmotif.EncodedSequence(SEQUENCE)
+        striped = seq.stripe()
+
+        scores = pssm.calculate(striped)
+        self.assertEqual(len(scores), len(EXPECTED))
+        for x, y in zip(scores, EXPECTED):
+            self.assertAlmostEqual(x, y, places=5)
\ No newline at end of file

lightmotif-py/lightmotif/tests/unittest.rs

+extern crate lightmotif_py;
+extern crate pyo3;
+
+use std::path::Path;
+
+use pyo3::prelude::PyResult;
+use pyo3::types::PyDict;
+use pyo3::types::PyList;
+use pyo3::types::PyModule;
+use pyo3::Python;
+
+pub fn main() -> PyResult<()> {
+    // get the relative path to the project folder
+    let folder = Path::new(file!())
+        .parent()
+        .unwrap()
+        .parent()
+        .unwrap()
+        .parent()
+        .unwrap()
+        .parent()
+        .unwrap();
+
+    // spawn a Python interpreter
+    pyo3::prepare_freethreaded_python();
+    Python::with_gil(|py| {
+        // insert the project folder in `sys.modules` so that
+        // the main module can be imported by Python
+        let sys = py.import("sys")?;
+        sys.getattr("path")?
+            .downcast::<PyList>()?
+            .insert(0, folder)?;
+
+        // create a Python module from our rust code with debug symbols
+        let module = PyModule::new(py, "lightmotif.lib")?;
+        lightmotif_py::init(py, &module).unwrap();
+        sys.getattr("modules")?
+            .downcast::<PyDict>()?
+            .set_item("lightmotif.lib", module)?;
+
+        // run unittest on the tests
+        let kwargs = PyDict::new(py);
+        kwargs.set_item("exit", false).unwrap();
+        kwargs.set_item("verbosity", 2u8).unwrap();
+        py.import("unittest").unwrap().call_method(
+            "TestProgram",
+            ("lightmotif.tests",),
+            Some(kwargs),
+        )?;
+
+        Ok(())
+    })
+}