README.md

use lightmotif::*;

// Create a count matrix from an iterable of motif sequences
let counts = CountMatrix::<Dna, {Dna::K}>::from_sequences(&[
    EncodedSequence::encode("GTTGACCTTATCAAC").unwrap(),
    EncodedSequence::encode("GTTGATCCAGTCAAC").unwrap(),
]).unwrap();

// Create a PSSM with 0.1 pseudocounts and uniform background frequencies.
let pssm = counts.to_freq(0.1).to_scoring(None);

// Encode the target sequence into a striped matrix
let seq = "ATGTCCCAACAACGATACCCCGAGCCCATCGCCGTCATCGGCTCGGCATGCAGATTCCCAGGCG";
let encoded = EncodedSequence::<Dna>::encode(seq).unwrap();
let mut striped = encoded.to_striped::<32>();
striped.configure(&pssm);

// Use a pipeline to compute scores for every position of the matrix
let scores = Pipeline::<Dna, f32>::score(&striped, &pssm);

// Scores can be extracted into a Vec<f32>, or indexed directly.
let v = scores.to_vec();
assert_eq!(scores[0], -23.07094);
assert_eq!(v[0], -23.07094);
running 3 tests
test bench_avx2    ... bench:  13,053,752 ns/iter (+/- 45,411) = 355 MB/s
test bench_ssse3   ... bench:  37,203,277 ns/iter (+/- 2,416,572) = 124 MB/s
test bench_generic ... bench: 314,682,807 ns/iter (+/- 1,072,174) = 14 MB/s
test bench_avx2    ... bench:      46,390 ns/iter (+/- 115) = 215 MB/s
test bench_ssse3   ... bench:      97,691 ns/iter (+/- 2,720) = 102 MB/s
test bench_generic ... bench:     740,305 ns/iter (+/- 2,527) = 13 MB/s
test bench_bio     ... bench:   1,575,504 ns/iter (+/- 2,799) = 6 MB/s