Skip to content
Snippets Groups Projects
Commit c60c534c authored by wyleung's avatar wyleung
Browse files

Merge with master from upstream

parents b361ae47 9c489dc1
No related branches found
No related tags found
1 merge request!3Merge back lecture on painting pandas with master repo
Expand all Hide whitespace changes
Inline Side-by-side
01 - Welcome.ipynb
+ 6
− 4
View file @ c60c534c
......@@ -2,7 +2,7 @@
"metadata": {
"celltoolbar": "Slideshow",
"name": "",
"signature": "sha256:a016c0815699df8dae5155425df47f34e59e2aac64d4fa7f4edaa9c43a33ad3f"
"signature": "sha256:318ca794a2566193c1a821deac41537867c46decd770e1ce9a52eafcc6854bb5"
},
"nbformat": 3,
"nbformat_minor": 0,
......@@ -48,7 +48,7 @@
"* Programming as a tool to do your research.\n",
"* Slightly focussed on bioinformatics.\n",
"\n",
"**Note:** It <s>is</s> was a pilot."
"**Note:** This is its second year."
]
},
{
......@@ -140,7 +140,7 @@
"<td>Jeroen</td>\n",
"</tr>\n",
"<tr><td>11-12</td>\n",
"<td>Python for data analysis</td>\n",
"<td>Painting Pandas</td>\n",
"<td>Wai Yi</td>\n",
"</tr>\n",
"<tr><td rowspan=\"3\">Friday</td>\n",
......@@ -235,6 +235,8 @@
"* Use our etherpad:\n",
"\n",
"<br>\n",
"<br>\n",
"<br>\n",
"\n",
"<center style=\"font-size: 300%\">[tinyurl.com/leidencourse](http://tinyurl.com/leidencourse)</center>"
]
......@@ -287,7 +289,7 @@
"output_type": "pyout",
"prompt_number": 1,
"text": [
"<IPython.core.display.HTML at 0x1f71a50>"
"<IPython.core.display.HTML at 0x2099990>"
]
}
],
......
numpy.ipynb → 04 - Working with NumPy arrays.ipynb
+ 234
− 227
View file @ c60c534c
This diff is collapsed.
05 - IPython Notebook.ipynb
+ 79
− 21
View file @ c60c534c
......@@ -39,7 +39,7 @@
"level": 2,
"metadata": {},
"source": [
"Requirements on scientific computing"
"Requirements on scientific computing\n"
]
},
{
......@@ -221,6 +221,13 @@
"- Interactive shell with improved user friendliness"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"$ ipython"
]
},
{
"cell_type": "markdown",
"metadata": {},
......@@ -256,6 +263,13 @@
"- New notebooks can be created in that same directory"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"$ ipython notebook"
]
},
{
"cell_type": "markdown",
"metadata": {},
......@@ -285,6 +299,13 @@
"- Share notebooks easily with nbviewer"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"http://nbviewer.ipython.org/"
]
},
{
"cell_type": "heading",
"level": 1,
......@@ -349,8 +370,9 @@
"source": [
"- Install locally\n",
" - See instructions in this course\n",
" - Linux, Windows\n",
" \n",
" - Linux, Windows\n",
" - Type 'ipython notebook'\n",
" \n",
" \n",
"- Remotely, Shark cluster LUMC\n",
" - Connect to shark\n",
......@@ -625,7 +647,7 @@
"cell_type": "markdown",
"metadata": {},
"source": [
"- Cells run asynchronous\n",
"- Cells can be run individually\n",
"- Results are persistent\n",
"- Save time by running intensive code blocks only once"
]
......@@ -807,20 +829,48 @@
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 47,
"prompt_number": 1,
"text": [
"0.21020888481775812"
]
}
],
"prompt_number": 1
},
{
"cell_type": "heading",
"level": 4,
"metadata": {},
"source": [
"SHIFT-TAB shows help functions"
]
},
{
"cell_type": "code",
"collapsed": false,
"input": [
"numpy.random.random()"
],
"language": "python",
"metadata": {},
"outputs": [
{
"metadata": {},
"output_type": "pyout",
"prompt_number": 5,
"text": [
"0.7211185564561403"
"0.006939705725762635"
]
}
],
"prompt_number": 47
"prompt_number": 5
},
{
"cell_type": "heading",
"level": 1,
"metadata": {},
"source": [
"\u00a7 Excercise : My first Notebook (1)"
"\u00a7 Exercise : My first Notebook (1)"
]
},
{
......@@ -837,7 +887,7 @@
" - Click on the current name (Untitled1) and edit this\n",
"\n",
"Add the code shown below to some **_code_** cells\n",
" - Add cells by pressen the '+' button or ALT+ENTER\n",
" - Add cells by pressing the '+' button or ALT+ENTER\n",
" - Remember the keyboard shortcuts or the help function ('h')\n",
"\n",
"\n",
......@@ -1219,7 +1269,7 @@
"cell_type": "markdown",
"metadata": {},
"source": [
"- Notebook has acceess to all the files down in the directory"
"- Notebook has access to all the files down in the directory"
]
},
{
......@@ -1245,7 +1295,7 @@
"metadata": {},
"source": [
"<br></br><br></br>\n",
"Some other examples:"
"Embed videos using python code"
]
},
{
......@@ -1284,7 +1334,7 @@
"output_type": "pyout",
"prompt_number": 1,
"text": [
"<IPython.lib.display.YouTubeVideo at 0x3224890>"
"<IPython.lib.display.YouTubeVideo at 0x23c2890>"
]
}
],
......@@ -1295,7 +1345,7 @@
"level": 1,
"metadata": {},
"source": [
"Plotting with matplotlib"
"Output plots with matplotlib "
]
},
{
......@@ -1333,7 +1383,7 @@
"level": 1,
"metadata": {},
"source": [
"\u00a7 Excercise : My first Notebook (2)"
"\u00a7 Exercise : My first Notebook (2)"
]
},
{
......@@ -1358,15 +1408,18 @@
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"cell_type": "code",
"collapsed": false,
"input": [
"### My next notebook\n",
"\n",
"This notebook is my first notebook with some experimental code.\n",
"\n",
"Author: [Michiel van Galen](mailto:m.van_galen@lumc.nl)"
]
],
"language": "python",
"metadata": {},
"outputs": []
},
{
"cell_type": "markdown",
......@@ -1442,7 +1495,7 @@
"level": 1,
"metadata": {},
"source": [
"\u00a7 Excercise : My first Notebook (3)\n",
"\u00a7 Exercise : My first Notebook (3)\n",
" "
]
},
......@@ -1475,14 +1528,19 @@
"cell_type": "markdown",
"metadata": {},
"source": [
" - Think of function which can test if a sequence is palindromic\n",
" - Think of a function which can test if a sequence is palindromic\n",
" - Use the functions 'complement' and 'reverse'\n",
" - Nicely formatted mardown cell(s) explaining the notebook\n",
" - Add links as references like the one above\n",
"\n",
"**Bonus: Write a function which can test if there are short palindromic sequences in a longer piece of DNA**\n",
"\n",
"- Try to find the palindromic seqeuences of at least length 6 in the sequence : GGGAGACATGTCTAACCGTTGTAAAA\n",
"- Try to find the palindromic sequences of at least length 6 in the sequence :\n",
"\n",
"**GGGAGACATGTCTAACCGTTGTAAAA**\n",
" \n",
"Hints:\n",
"\n",
"- Implement your current functions in a new function\n",
"- Begin to iterate over a sequence and find a palindrome of size 2\n",
"- Continue to work from there and expand your test\n",
......
INSTALL.md
+ 1
− 1
View file @ c60c534c
......@@ -23,7 +23,7 @@ We need some system packages to be installed. For the following command, you
need sudo rights:
sudo apt-get install -y \
curl gfortran git libblas-dev libfreetype6-dev liblapack-dev
curl gfortran git libblas-dev libfreetype6-dev liblapack-dev \
libpng12-dev python-cairo python-gtk2 python-gtk2-dev python-qt4
From here on, everything is local for the current user.
......
README.md
+ 10
− 1
View file @ c60c534c
......@@ -32,7 +32,7 @@ The top-level directory contains materials for the following lessons:
2. Introduction to Python ([slides 1][lesson_02_01], [slides 2][lesson_02_02],
[slides 3][lesson_02_03])
3. More Python Goodness ([notebook 1][lesson_03_01], [notebook 2][lesson_03_02])
4. Working with NumPy arrays
4. Working with NumPy arrays ([slides][lesson_04])
5. IPython Notebook ([notebook][lesson_05])
6. Plotting with matplotlib
7. Painting Pandas ([slides][lesson_07])
......@@ -45,6 +45,7 @@ The top-level directory contains materials for the following lessons:
[lesson_02_03]: http://nbviewer.ipython.org/urls/git.lumc.nl/humgen/programming-course/raw/master/02%20-%20Introduction%20to%20Python%20(3).ipynb
[lesson_03_01]: http://nbviewer.ipython.org/urls/git.lumc.nl/humgen/programming-course/raw/master/03%20-%20More%20Python%20goodness%20(1).ipynb
[lesson_03_02]: http://nbviewer.ipython.org/urls/git.lumc.nl/humgen/programming-course/raw/master/03%20-%20More%20Python%20goodness%20(2).ipynb
[lesson_04]: http://nbviewer.ipython.org/urls/git.lumc.nl/humgen/programming-course/raw/master/04%20-%20Working%20with%20NumPy%20arrays.ipynb
[lesson_05]: http://nbviewer.ipython.org/urls/git.lumc.nl/humgen/programming-course/raw/master/05%20-%20IPython%20Notebook.ipynb
[lesson_07]: http://nbviewer.ipython.org/urls/git.lumc.nl/humgen/programming-course/raw/master/07%20-%20Painting%20Pandas.ipynb
[lesson_09_01]: http://nbviewer.ipython.org/urls/git.lumc.nl/humgen/programming-course/raw/master/09%20-%20A%20sip%20of%20Biopython%20(1).ipynb
......@@ -101,6 +102,14 @@ this argument:
--ServePostProcessor.open_in_browser=False
To serve on another IP address than the default 127.0.0.1, use the `ip`
configuration of the serve postprocessing. For example, to listen on all IP
addresses:
--ServePostProcessor.ip=0.0.0.0
Changing the port can be done similarly with `port`.
By default, the reveal.js library is loaded over the internet from a CDN. I
think it's usually not a good idea to rely on internet connectivity for your
slides, so you can also place a copy of reveal.js on your local computer and
......
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment