... | ... | @@ -226,6 +226,9 @@ The PCR for **Sanger** sequence validation was performed using the primers (list |
|
|
|LMNA|E|AGGCCAAGAAGCAACTTCAG|TACTGCTCCACCTGGTCCTC|
|
|
|
|LMNA|F|ACCAAGAAGGAGGGTGACCT|TACTGCTCCACCTGGTCCTC|
|
|
|
|
|
|
> **PCR Report** <br> [:arrow_down:]() PDF file, containing a report on fragment analysis of the PCR products. <br> <br>
|
|
|
> **Sanger Sequences** <br> [:arrow_down:]() FASTA file, containing Sanger sequences based on the PCR experiment.
|
|
|
|
|
|
<br>
|
|
|
|
|
|
**Single-molecule RNA FISH** relies on the combined fluorescence from 25-48 singly fluorophore labeled oligonucleotides bound to the same RNA. By using the fluorescence from a guide probe set in one dye, the fluorescence from one or more exon-specific probe sets with <25 oligonucleotides, and each labeled with a separate dye, can be accurately registered as belong to the same RNA. The optimal number of oligonucleotides per specific set must be experimentally determined. Here we could use probe sets with only 9 oligonucleotides. <br>
|
... | ... | |