... | ... | @@ -143,7 +143,7 @@ ORF prediction was done on the PacBio MCF-7 sequences using [ANGEL](http://www.g |
|
|
|
|
|
---
|
|
|
## **RNA-FISH and Sanger Validations** <br>
|
|
|
The PCR for Sanger sequence validation was performed using the primers (listed in the table below) using the 2x Phusion High-Fidelity PCR master mix with HF buffer (NEB). Briefly, the pcr ran for 30 cycles with 1 min elongation at 72C. The PCR products were purified using Ampure XP beads following the guidelines of the manufacturer. The sizing of the amplicons was checked using Agilent’s Labonachip system. The Sanger sequencing of the products was performed by the LGTC and the sequences were analyzed using Sequence Scanner Sofware 2 (Applied Biosystems, CA USA).<br>
|
|
|
The PCR for **Sanger** sequence validation was performed using the primers (listed in the table below) using the 2x Phusion High-Fidelity PCR master mix with HF buffer (NEB). Briefly, the pcr ran for 30 cycles with 1 min elongation at 72C. The PCR products were purified using Ampure XP beads following the guidelines of the manufacturer. The sizing of the amplicons was checked using Agilent’s Labonachip system. The Sanger sequencing of the products was performed by the LGTC and the sequences were analyzed using Sequence Scanner Sofware 2 (Applied Biosystems, CA USA).<br>
|
|
|
|
|
|
|Gene |Fragment |5' Primer |3' Primer |
|
|
|
|:---|:---|:---|:---|
|
... | ... | @@ -170,6 +170,23 @@ The PCR for Sanger sequence validation was performed using the primers (listed i |
|
|
|LMNA|E|AGGCCAAGAAGCAACTTCAG|TACTGCTCCACCTGGTCCTC|
|
|
|
|LMNA|F|ACCAAGAAGGAGGGTGACCT|TACTGCTCCACCTGGTCCTC|
|
|
|
|
|
|
<br>
|
|
|
|
|
|
**Single-molecule RNA FISH** relies on the combined fluorescence from 25-48 singly fluorophore labeled oligonucleotides bound to the same RNA. By using the fluorescence from a guide probe set in one dye, the fluorescence from one or more exon-specific probe sets with <25 oligonucleotides, and each labeled with a separate dye, can be accurately registered as belong to the same RNA. The optimal number of oligonucleotides per specific set must be experimentally determined. Here we could use probe sets with only 9 oligonucleotides. <br>
|
|
|
|
|
|
*Probe sets* <br>
|
|
|
Four probe sets were designed at www.biosearchtech.com/stellarisdesigner to detect: 1) The common exons of the human CALU (Calumenin; NCBI Gene ID: 813; 7q32.1) mRNAs (CALU_E), 2) the alternatively spliced exon 4 (CALU_E4), 3) the alternatively spliced exon 5 (CALU_E5), and the common first intron (CALU_I1). The probe set target sequences were as follows: CALU_E: NM_001199671.1 nts 1-141, 957-1188, 1383-1610, 1811-2875, CALU_E4: NM_001199671.1, nts 1177-1394, CALU_E5: NM_001199672.1, nts 1177-1394, and CALU_I1: NC_000007.14, nts 128739433-128747432. CALU_E is an inclusive probe set designed to detect the following variants: NM_001219.4, NM_001130674.2, NM_001199671.1, NM_001199672.1, NM_001199673.1, and NR_074086.1. Both CALU_E and CALU_I1 are full sets with >32 oligonucleotides, whereas the sets targeting the short exons 4 and 5 have 9 oligonucleotides each. The four sets were synthesized at LGC Biosearch Technologies as custom Stellaris® probe sets with unique fluorophores: CALU_E: Quasar® 670, CALU_E4: Quasar 570, CALU_E5: Cal Fluor ® Red 610, and CALU_I1: FAM. The CALU_E4 and CALU_E5 probes were further purified by reverse phase HPLC, to ensure full labeling. <br>
|
|
|
|
|
|
*Reagents* <br>
|
|
|
Human breast adenocarcinoma MCF-7 cells (ATCC-HTB-22) were obtained from ATCC (Manassas, VA) and cultured as recommended by the provider. The hypotriploid karyotype is available at the provider's web site, and shows three chromosomal loci for 7q32.1. 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride, 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI), molecular biology grade ethanol, acetic acid, and methanol were from Sigma Aldrich (St. Louis, MO). Vectashield was from Vector Laboratories (Burlingame, CA). Stellaris RNA FISH hybridization and wash buffers were from LGC Biosearch Technologies. <br>
|
|
|
|
|
|
*smRNA FISH* <br>
|
|
|
Stellaris RNA FISH was performed as previously described for methanol/acetic acid-fixed cultured cells65, 66. <br>
|
|
|
|
|
|
*Image acquisition and analysis* <br>
|
|
|
DAPI-stained nuclei, fluorescein (FAM), Quasar 570 (Q570), CalFluor 610 (CF610) and Quasar 670 (Q670) dyes were imaged through a 60X 1.4NA oil-immersion lens on a Nikon TI widefield microscope using the appropriate filters: 49000-ET-DAPI, 49011-ET-FITC, SP102v1, SP103v2, 49022-ET-Cy5.5 respectively. The exposure and sequence of channels to acquire were determined based on the brightness and photostability of the dye with which each probe set was labeled. The sequence of exposure was Q670, followed by FAM, and then either or both Q570, CF610. Each Z-slice was exposed for 1 s, except for Q670 which required 2 s exposures. For each field of view, a range spanning the vertical dimension of the cell (typically 10 um) is defined and for each channel, a series of images were acquired through this span at 0.3 µm increments by using Nikon Elements' Advanced Research software.
|
|
|
Each Z-series was collapsed and rendered as a single, max-intensity projected image. Translational registration to align images shifted relative to another was accomplished by ImageJ macros after identification of a region containing overlapping signals in each channel. Peak positions of these signals were determined relative to each other to inform the shift of each channel. Next, spots and their centroid positions were identified in each channel using the ImageJ Find Maxima utility. These positions were then compared against one another and co-localized spots were grouped if within 3 pixels (330 nm). Based on these groupings, spots were categorized into separate transcript variants and displayed on the image for review. Finally, cell borders were defined and spots associated with distinct cells for per-cell and per-transcript variant copy number determination. RNA FISH features were counted in at least ten cells. <br>
|
|
|
|
|
|
<p align="right"> [`TOP`](#full-length-mrna-sequencing-uncovers-a-widespread-coupling-between-transcription-and-mrna-processing)</p><br>
|
|
|
|
|
|
---
|
... | ... | |