Commit 06132fbe authored by Vermaat's avatar Vermaat
Browse files

Fix broken example input links

Fixes #43
parent 957483fa
......@@ -70,7 +70,7 @@ Please supply a reference sequence and an observed sequence.
<div class="subform" id="reference_raw_method" style="display: {{ '' if reference_method == 'raw_method' or not reference_method else 'none' }}">
<div class="form-group">
<label for="reference_sequence">Reference sequence</label>
<textarea name="reference_sequence" id="reference_sequence" class="form-control form-pre example-target" placeholder="Reference sequence">{{ reference_sequence }}</textarea>
<textarea name="reference_sequence" id="reference_sequence" class="form-control form-pre" placeholder="Reference sequence">{{ reference_sequence }}</textarea>
<p>Example: <code class="example-input" data-for="reference_sequence">ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA</code></p>
</div>
</div>
......@@ -87,7 +87,7 @@ Please supply a reference sequence and an observed sequence.
<div class="subform" id="reference_refseq_method" style="display: {{ 'none' if reference_method != 'refseq_method' }}">
<div class="form-group">
<label for="reference_accession_number">Reference accession number</label>
<input type="text" name="reference_accession_number" id="reference_accession_number" value="{{ reference_accession_number }}" class="form-control form-pre example-target" placeholder="Reference accession number">
<input type="text" name="reference_accession_number" id="reference_accession_number" value="{{ reference_accession_number }}" class="form-control form-pre" placeholder="Reference accession number">
<p>Example: <code class="example-input" data-for="reference_accession_number">NM_198697.1</code></p>
</div>
</div>
......@@ -125,7 +125,7 @@ Please supply a reference sequence and an observed sequence.
<div class="subform" id="sample_raw_method" style="display: {{ '' if sample_method == 'raw_method' or not sample_method else 'none' }}">
<div class="form-group">
<label for="sample_sequence">Sample sequence</label>
<textarea name="sample_sequence" id="sample_sequence" class="form-control form-pre example-target-2" placeholder="Sample sequence">{{ sample_sequence }}</textarea>
<textarea name="sample_sequence" id="sample_sequence" class="form-control form-pre" placeholder="Sample sequence">{{ sample_sequence }}</textarea>
<p>Example: <code class="example-input" data-for="sample_sequence">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
</div>
</div>
......@@ -142,7 +142,7 @@ Please supply a reference sequence and an observed sequence.
<div class="subform" id="sample_refseq_method" style="display: {{ 'none' if sample_method != 'refseq_method' }}">
<div class="form-group">
<label for="sample_accession_number">Sample accession number</label>
<input type="text" name="sample_accession_number" id="sample_accession_number" value="{{ sample_accession_number }}" class="form-control form-pre example-target-2" placeholder="Sample accession number">
<input type="text" name="sample_accession_number" id="sample_accession_number" value="{{ sample_accession_number }}" class="form-control form-pre" placeholder="Sample accession number">
<p>Example: <code class="example-input" data-for="sample_accession_number">NM_198697.2</code></p>
</div>
</div>
......
......@@ -18,14 +18,14 @@ nomenclature according to the
<div class="caption">
<h3><a href="{{ url_for('.name_checker') }}">Name Checker</a></h3>
<p>The Name Checker takes the complete sequence variant description as input and checks whether it is correct.</p>
<p>Example: <code class="example-input">AB026906.1:c.274G&gt;T</code></p>
<p>Example: <code class="example-input" data-for="description">AB026906.1:c.274G&gt;T</code></p>
<!-- <a href="{{ url_for('.name_checker') }}" class="btn btn-default btn-small btn-primary">Try
this</a> -->
<form class="form" action="{{ url_for('.name_checker') }}" method="get">
<div class="input-group">
<input class="form-control form-control-small form-pre example-target" type="text" name="description" value="{{ description }}" placeholder="Variant description using HGVS format">
<input class="form-control form-control-small form-pre" type="text" name="description" id="description" value="{{ description }}" placeholder="Variant description using HGVS format">
<span class="input-group-btn">
<input type="submit" class="btn btn-primary pull-right" value="Check variant description">
</span>
......
......@@ -51,10 +51,10 @@
<form class="form" action="{{ url_for('.name_checker') }}" method="get">
<div class="form-group">
<label for="description">Variant description</label>
<input class="form-control form-pre example-target" type="text"
<input class="form-control form-pre" type="text"
name="description" id="description" value="{{ description }}"
placeholder="Variant description using HGVS format">
<p>Example: <code class="example-input">AB026906.1:c.274G&gt;T</code></p>
<p>Example: <code class="example-input" data-for="description">AB026906.1:c.274G&gt;T</code></p>
</div>
<div class="form-group button-group">
......
......@@ -28,8 +28,9 @@ normalize it to HGVS. Use the <a href="{{ url_for('.name_checker') }}">Name Chec
<div class="form-group">
<label for="description">Variant description</label>
<input type="text" name="description" id="description" value="{{ description }}"
class="form-control form-pre example-target" placeholder="Variant description using HGVS format">
<p>Examples: <code class="example-input">NM_003002.3:c.274G&gt;T</code>, <code class="example-input">chr11:g.111959693G&gt;T</code> and <code class="example-input">NC_000011.9:g.111959693G&gt;T</code></p>
class="form-control form-pre" placeholder="Variant description using HGVS format">
<p>Examples: <code class="example-input"
data-for="description">NM_003002.3:c.274G&gt;T</code>, <code class="example-input" data-for="description">chr11:g.111959693G&gt;T</code> and <code class="example-input" data-for="description">NC_000011.9:g.111959693G&gt;T</code></p>
</div>
<div class="form-group button-group">
<input type="submit" class="btn btn-primary" value="Convert variant description">
......
......@@ -14,10 +14,10 @@ the reference sequence(s) used by dbSNP.
<form role="form" class="form" action="{{ url_for('.snp_converter') }}" method="get">
<div class="form-group">
<label for="description">SNP</label>
<input type="text" class="form-control form-pre example-target"
name="rs_id" id="description" placeholder="dbSNP rs number (including rs)" value="{{ rs_id }}" ></input>
<p>Example: <code class="example-input">rs9919552</code></p>
<label for="rsid">SNP</label>
<input type="text" class="form-control form-pre"
name="rs_id" id="rsid" placeholder="dbSNP rs number (including rs)" value="{{ rs_id }}" ></input>
<p>Example: <code class="example-input" data-for="rsid">rs9919552</code></p>
</div>
<div class="form-group">
......
......@@ -17,9 +17,9 @@ standard variant nomenclature">HGVS</a> format:
<form class="form" action="{{ url_for('.syntax_checker') }}" method="get">
<div class="form-group">
<label for="description">Variant description</label>
<input class="form-control form-pre example-target" type="text"
<input class="form-control form-pre" type="text"
name="description" id="description" value="{{ description }}" placeholder="Variant description using HGVS format">
<p>Example: <code class="example-input">AB026906.1:c.274G&gt;T</code></p>
<p>Example: <code class="example-input" data-for="description">AB026906.1:c.274G&gt;T</code></p>
</div>
<div class="form-group button-group">
<input type="submit" class="btn btn-primary" value="Check syntax">
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment