descriptionExtract.html 2.77 KB
Newer Older
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
<html>
  <head>
    <link rel="stylesheet"
      type="text/css"
      href="base/css/style.css">
    <title></title>
  </head>
  <body>
    <div metal:define-macro="content">
      <center>
        <h3>Variant Description Extractor</h3>
      </center>
      <div style="border: 1px solid grey; background-color: aliceblue; padding: 20px;">
        <form action = "" method = "post">
          Please supply a reference sequence and an observed sequence.<br>
          <br>
          <div style="border: 1px solid grey; padding: 20px">
            <b>Reference sequence:</b><br>
            <br>
            Example: <tt>ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA</tt><br>
            <br>
            <input
              type = "text"
              name = "referenceSeq"
              tal:attributes = "value lastReferenceSeq"
              style = "width:100%"
            ><br>
          <input type="button" value="Clear field"
                 onClick = "clearForm(this.form, 'referenceSeq');"><br>
          </div>
          <br>
          <div style="border: 1px solid grey; padding: 20px">
            <b>Observed sequence:</b><br>
            <br>
            Example: <tt>ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</tt><br>
            <br>
            <input
              type = "text"
              name = "variantSeq"
              tal:attributes = "value lastVariantSeq"
              style = "width:100%"
            ><br>
            <input type="button" value="Clear field"
                   onClick = "clearForm(this.form, 'variantSeq');"><br>
          </div>
          <br>
          <input type="submit" value="Submit">
        </form>
      </div>
      <div tal:condition = "description">
        <br>
        <h3>Variant Description Extractor results:</h3>
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
        <div class="messages">
          <p tal:repeat = "m messages" tal:content = "m/description"
            tal:attributes = "class m/class; title string:${m/level} (origin: ${m/origin})"></p>
          <p tal:content = "summary"></p>
        </div>
        <div tal:condition = "not:errors">
          <br>
          <b>Genomic description:</b><br>
          <br>
          <tt>g.<div tal:replace = "description"></div></tt>
          <br>
          <br>
          <br>
          <b>Overview of the raw variants:</b><br>
          <br>
          <table class = "laTable">
            <tr>
              <td>Start</td>
              <td>End</td>
              <td>Type</td>
              <td>Deleted</td>
              <td>Inserted</td>
              <td>Shift</td>
              <td>Description</td>
            </tr>
            <tr tal:repeat = "i visualisation">
              <td tal:repeat = "j i" tal:content = "j"></td>
            </tr>
          </table>
        </div>
83
84
85
86
87
      </div> <!-- description -->
      <br>
    </div>
  </body>
</html>