description-extractor.html

{% extends "base.html" %}

{% set active_page = "description-extractor" %}
{% set page_title = "Variant Description Extractor" %}

{% block content %}

<p class="alert alert-warning">
Please note that this is an experimental service and we are currently limiting
input sequences to 1000bp.
</p>

<p>
Extract the HGVS variant description from a reference sequence and an observed
sequence. For now, we require the user to fill in two sequences. After the
testing phase, we plan to use the underlying algorithm for:
</p>

<ul>
  <li>
    Disambiguation in the name checker. This will enable full support for complex variants.
  </li>
  <li>
    Comparison of two reference sequences. Useful for migrating a variant description to an other reference sequence.
  </li>
  <li>
    Implementation of a Reference Sequence Editor.
  </li>
</ul>

<p>
The algorithm is implemented in
the <a href="https://github.com/mutalyzer/description-extractor">HGVS variant
description extractor</a>. To apply it on longer input sequences than accepted
on this page, you can download that package and run it locally.
</p>

<p>
Please supply a reference sequence and an observed sequence.
</p>

<form enctype="multipart/form-data" action="{{ url_for('.description_extractor') }}" method="post" class="form" id="invoer">
  <div class="row">
    <h4>Reference input</h4>
    <div class="col-md-6">
      <div class="form-group" id="input-methods">
        <div class="radio">
          <label>
            <input type="radio" name="reference_method" value="raw_method" class="input-select" data-context="select-form1" data-for="reference_raw_method" {{ 'checked' if reference_method == 'raw_method' or not reference_method }}>
            Enter a sequence (FASTA, FASTQ, or plain text).
          </label>
        </div>
        <div class="radio">
          <label>
            <input type="radio" name="reference_method" value="file_method" class="input-select" data-context="select-form1" data-for="reference_file_method" {{ 'checked' if reference_method == 'file_method' }}>
            Upload a file (FASTA, FASTQ, or plain text).
          </label>
        </div>
        <div class="radio">
          <label>
            <input type="radio" name="reference_method" value="refseq_method" class="input-select" data-context="select-form1" data-for="reference_refseq_method" {{ 'checked' if reference_method == 'refseq_method' }}>
            Enter a RefSeq accession number.
          </label>
        </div>
      </div>
    </div>

    <div id="select-form1">
      <div class="col-md-6">
        <div class="subform" id="reference_raw_method" style="display: {{ '' if reference_method == 'raw_method' or not reference_method else 'none' }}">
          <div class="form-group">
            <label for="reference_sequence">Reference sequence</label>
            <textarea  name="reference_sequence" id="reference_sequence" class="form-control form-pre" placeholder="Reference sequence">{{ reference_sequence }}</textarea>
            <p>Example: <code class="example-input" data-for="reference_sequence">ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA</code></p>
          </div>
        </div>
      </div>
      <div class="col-md-6">
        <div class="subform" id="reference_file_method" style="display: {{ 'none' if reference_method != 'file_method' }}">
          <div class="form-group">
            <label for="reference_file">Reference file</label>
            <input type="file" name="reference_file" id="reference_file">
          </div>
        </div>
      </div>
      <div class="col-md-6">
        <div class="subform" id="reference_refseq_method" style="display: {{ 'none' if reference_method != 'refseq_method' }}">
          <div class="form-group">
            <label for="reference_accession_number">Reference accession number</label>
            <input type="text" name="reference_accession_number" id="reference_accession_number" value="{{ reference_accession_number }}" class="form-control form-pre" placeholder="Reference accession number">
            <p>Example: <code class="example-input" data-for="reference_accession_number">NM_198697.1</code></p>
          </div>
        </div>
      </div>
    </div>
  </div>

  <div class="row">
    <h4>Sample input</h4>
    <div class="col-md-6">
      <div class="form-group" id="input-methods">
        <div class="radio">
          <label>
            <input type="radio" name="sample_method" value="raw_method" class="input-select" data-context="select-form2" data-for="sample_raw_method" {{ 'checked' if sample_method == 'raw_method' or not sample_method }}>
            Enter a sequence (FASTA, FASTQ, or plain text).
          </label>
        </div>
        <div class="radio">
          <label>
            <input type="radio" name="sample_method" value="file_method" class="input-select" data-context="select-form2" data-for="sample_file_method" {{ 'checked' if sample_method == 'file_method' }}>
            Upload a file (FASTA, FASTQ, or plain text).
          </label>
        </div>
        <div class="radio">
          <label>
            <input type="radio" name="sample_method" value="refseq_method" class="input-select" data-context="select-form2" data-for="sample_refseq_method" {{ 'checked' if sample_method == 'refseq_method' }}>
            Enter a RefSeq accession number.
          </label>
        </div>
      </div>
    </div>

    <div id="select-form2">
      <div class="col-md-6">
        <div class="subform" id="sample_raw_method" style="display: {{ '' if sample_method == 'raw_method' or not sample_method else 'none' }}">
          <div class="form-group">
            <label for="sample_sequence">Sample sequence</label>
            <textarea name="sample_sequence" id="sample_sequence" class="form-control form-pre" placeholder="Sample sequence">{{ sample_sequence }}</textarea>
            <p>Example: <code class="example-input" data-for="sample_sequence">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
          </div>
        </div>
      </div>
      <div class="col-md-6">
        <div class="subform" id="sample_file_method" style="display: {{ 'none' if sample_method != 'file_method' }}">
          <div class="form-group">
            <label for="sample_file">Reference file</label>
            <input type="file" name="sample_file" id="sample_file">
          </div>
        </div>
      </div>
      <div class="col-md-6">
        <div class="subform" id="sample_refseq_method" style="display: {{ 'none' if sample_method != 'refseq_method' }}">
          <div class="form-group">
            <label for="sample_accession_number">Sample accession number</label>
            <input type="text" name="sample_accession_number" id="sample_accession_number" value="{{ sample_accession_number }}" class="form-control form-pre" placeholder="Sample accession number">
            <p>Example: <code class="example-input" data-for="sample_accession_number">NM_198697.2</code></p>
          </div>
        </div>
      </div>
    </div>
  </div>
  <div class="form-group">
    <input type="submit" class="btn btn-primary" value="Extract variant description">
    <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/DescriptionExtractor" target="new" class="btn btn-default pull-right">Help</a>
  </div>
</form>

{% if reference_method and sample_method %}
  <hr>
  {% for m in messages %}
    {% if m.class == "error" %}
      <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
    {% elif m.class == "warning" %}
      <p class="alert alert-warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
    {% elif m.class == "information" %}
      <p class="alert alert-info" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
    {% elif m.class == "debug" %}
      <p class="alert alert-info" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
    {% endif %}
  {% endfor %}

  {% if summary == "0 Errors, 0 Warnings." %}
    <p class="alert alert-success summary">{{ summary }}</p>
  {% else %}
    <p>{{summary}}</p>
  {% endif %}

  {% if not errors %}
    <hr>

    <h4>Input</h4>
    <table class="table">
      <thead>
        <tr>
          <th>Field</th>
          <th>Value</th>
        </tr>
      </thead>
      <tbody>
        <tr>
          <td>Reference input</td>
          <td>
            {% if reference_method == 'raw_method' %}
              <code>{{ reference_sequence|short(40) }}</code>
            {% elif reference_method == 'file_method' %}
              File upload
            {% elif reference_method == 'refseq_method' %}
              {{ reference_accession_number }}
            {% endif %}
          </td>
        </tr>
        <tr>
          <td>Sample input</td>
          <td>
            {% if sample_method == 'raw_method' %}
              <code>{{ sample_sequence|short(40) }}</code>
            {% elif sample_method == 'file_method' %}
              File upload
            {% elif sample_method == 'refseq_method' %}
              {{ sample_accession_number }}
            {% endif %}
          </td>
        </tr>
      </tbody>
    </table>

    <h4>Description</h4>
    <p><pre class="description">{{ raw_vars|string }}</pre></p>

    <h4>Overview of the raw variants</h4>
    <table class="table">
      <thead>
        <tr>
          <th>Start</th>
          <th>End</th>
          <th>Type</th>
          <th>Deleted</th>
          <th>Inserted</th>
          <th>Shift</th>
          <th>Description</th>
        </tr>
      </thead>
      <tbody>
      {% for raw_var in raw_vars %}
        <tr>
          <td>{{ raw_var.start }}</td>
          <td>{{ raw_var.end }}</td>
          <td>{{ raw_var.type }}</td>
          <td><code>{{ raw_var.deleted|string|short }}</code></td>
          <td><code>{{ raw_var.inserted|string|short }}</code></td>
          <td>{{ raw_var.shift }}</td>
          <td>{% if raw_var|string|length > 20 %}Too long to show{% else %}<code>{{ raw_var|string }}</code>{% endif %}</td>
        </tr>
      {% endfor %}
      </tbody>
    </table>
  {% endif %}{# not errors #}
{% endif %}{# description #}

{% endblock content %}