diff --git a/mutalyzer/describe.py b/mutalyzer/describe.py
index 82c8d6c46e963fe0f5bd8c5d72f6deb0bf67377b..09c133d885509d2db7de41115eabb2f2d18d1c1e 100644
--- a/mutalyzer/describe.py
+++ b/mutalyzer/describe.py
@@ -10,7 +10,6 @@ from __future__ import unicode_literals
import collections
-from Bio.SeqUtils import seq3
from Bio.Data import CodonTable
from mutalyzer.util import palinsnoop, roll
@@ -302,7 +301,8 @@ def describe_dna(s1, s2):
description = Allele()
in_transposition = 0
- extracted = extractor.extract(unicode(s1), len(s1), unicode(s2), len(s2), 0)
+ extracted = extractor.extract(s1.encode('utf-8'), len(s1),
+ s2.encode('utf-8'), len(s2), 0)
for variant in extracted.variants:
# print (variant.type, variant.reference_start,
# variant.reference_end, variant.sample_start,
@@ -354,9 +354,9 @@ def describe_protein(s1, s2):
Give an allele description of the change from {s1} to {s2}.
:arg s1: Sequence 1.
- :type s1: str
+ :type s1: unicode
:arg s2: Sequence 2.
- :type s2: str
+ :type s2: unicode
:returns: A list of RawVar objects, representing the allele.
:rtype: list(RawVar)
@@ -384,8 +384,8 @@ def describe_protein(s1, s2):
s1_part = s1
s2_part = s2
- for variant in extractor.extract(str(s1_part), len(s1_part),
- str(s2_part), len(s2_part), 1):
+ for variant in extractor.extract(s1_part.encode('utf-8'), len(s1_part),
+ s2_part.encode('utf-8'), len(s2_part), 1):
description.append(var_to_rawvar(s1, s2, variant,
container=ProteinVar))
diff --git a/mutalyzer/entrypoints/mutalyzer.py b/mutalyzer/entrypoints/mutalyzer.py
index a548376e074909401d3512a4f32a720bf8139946..08864546e84539502e4ce8a66875e2da56b78152 100644
--- a/mutalyzer/entrypoints/mutalyzer.py
+++ b/mutalyzer/entrypoints/mutalyzer.py
@@ -19,7 +19,7 @@ from .. import variantchecker
class MyEncoder(json.JSONEncoder):
def default(self, o):
json_object = o.__dict__
- json_object.update({"hgvs": str(o), "weight": o.weight()})
+ json_object.update({"hgvs": unicode(o), "weight": o.weight()})
return json_object
#default
diff --git a/mutalyzer/extractor_loader.py b/mutalyzer/extractor_loader.py
index 81f43ccead409525b3c1b32b4112350e56ffc8d9..ee8b097e50518f008daafbde2bd7357da648bf37 100644
--- a/mutalyzer/extractor_loader.py
+++ b/mutalyzer/extractor_loader.py
@@ -1,5 +1,7 @@
#!/usr/bin/env python
+from __future__ import unicode_literals
+
import sys
import json
diff --git a/mutalyzer/test.py b/mutalyzer/test.py
index acdca95dd7b58c417a84951d49c5ea5844c9932a..f733aec814afeda4f4c22ef9b8cabfaecb1b2221 100644
--- a/mutalyzer/test.py
+++ b/mutalyzer/test.py
@@ -1,23 +1,25 @@
-#!/usr/bin/env python
-
-import json
-
-import describe
-
-class MyEncoder(json.JSONEncoder):
- def default(self, o):
- return o.__dict__
-
-def main():
- ref = "ACGTCGATTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGATATTTTT"
- alt = "ACGTCGGTTCGCTAGCTTCGGGGGATAGATAGATATATAGAGATATTTTT"
-
- extracted_allele = describe.describe_dna(ref, alt)
-
- print extracted_allele
- print json.dumps({"reference_sequence": ref, "sample_sequence": alt,
- "allele_description": extracted_allele}, cls=MyEncoder)
-#main
-
-if __name__ == "__main__":
- main()
+#!/usr/bin/env python
+
+from __future__ import unicode_literals
+
+import json
+
+import describe
+
+class MyEncoder(json.JSONEncoder):
+ def default(self, o):
+ return o.__dict__
+
+def main():
+ ref = "ACGTCGATTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGATATTTTT"
+ alt = "ACGTCGGTTCGCTAGCTTCGGGGGATAGATAGATATATAGAGATATTTTT"
+
+ extracted_allele = describe.describe_dna(ref, alt)
+
+ print extracted_allele
+ print json.dumps({"reference_sequence": ref, "sample_sequence": alt,
+ "allele_description": extracted_allele}, cls=MyEncoder)
+#main
+
+if __name__ == "__main__":
+ main()
diff --git a/mutalyzer/util.py b/mutalyzer/util.py
index 6b7987b31c8f9a7bed62507572f0c417589d6c4a..63f916d39fde7e22e8a9202aaab245ecc1803d97 100644
--- a/mutalyzer/util.py
+++ b/mutalyzer/util.py
@@ -434,7 +434,7 @@ def longest_common_suffix(s1, s2):
@type s2: unicode
@return: The longest common suffix of s1 and s2.
- @rtype: string
+ @rtype: unicode
"""
return longest_common_prefix(s1[::-1], s2[::-1])[::-1]
#longest_common_suffix
@@ -680,7 +680,7 @@ def visualise_sequence(sequence, max_length=25, flank_size=6):
@type flank_size: int
@return: Either the original sequence, or an abbreviation of it.
- @rtype: str
+ @rtype: unicode
"""
if len(sequence) > max_length:
return '%s [%ibp] %s' % (sequence[:flank_size],
diff --git a/mutalyzer/variant.py b/mutalyzer/variant.py
index a8e512a255dbad2319f0617d744d27c031652916..ab7a5e85ced3ee713f3e0b5bd43a56ad447ad8ee 100644
--- a/mutalyzer/variant.py
+++ b/mutalyzer/variant.py
@@ -1,6 +1,10 @@
"""
"""
+from __future__ import unicode_literals
+
+from Bio.SeqUtils import seq3
+
from extractor import extractor
from mutalyzer import models
@@ -18,11 +22,11 @@ class HGVSList(list):
"""
Container for a list of sequences or variants.
"""
- def __str__(self):
+ def __unicode__(self):
if len(self) > 1:
- return "[{}]".format(';'.join(map(str, self)))
- return str(self[0])
- #__str__
+ return "[{}]".format(';'.join(map(unicode, self)))
+ return unicode(self[0])
+ #__unicode__
def weight(self):
weight = sum(map(lambda x: x.weight(), self))
@@ -47,7 +51,7 @@ class ISeq(object):
weight_position=1):
"""
:arg sequence: Literal inserted sequence.
- :type sequence: str
+ :type sequence: unicode
:arg start: Start position for a transposed sequence.
:type start: int
:arg end: End position for a transposed sequence.
@@ -66,7 +70,7 @@ class ISeq(object):
self.type = "ins"
#__init__
- def __str__(self):
+ def __unicode__(self):
if self.type == "ins":
return self.sequence
@@ -75,7 +79,7 @@ class ISeq(object):
inverted = "inv" if self.reverse else ""
return "{}_{}{}".format(self.start, self.end, inverted)
- #__str__
+ #__unicode__
def __nonzero__(self):
return bool(self.sequence)
@@ -118,9 +122,9 @@ class DNAVar(models.DNAVar):
:arg sample_end_offset:
:type sample_end_offset: int
:arg type: Variant type.
- :type type: str
+ :type type: unicode
:arg deleted: Deleted part of the reference sequence.
- :type deleted: str
+ :type deleted: unicode
:arg inserted: Inserted part.
:type inserted: object
:arg shift: Amount of freedom.
@@ -143,12 +147,12 @@ class DNAVar(models.DNAVar):
self.shift = shift
#__init__
- def __str__(self):
+ def __unicode__(self):
"""
Give the HGVS description of the raw variant stored in this class.
:returns: The HGVS description of the raw variant stored in this class.
- :rtype: str
+ :rtype: unicode
"""
if self.type == "unknown":
return "?"
@@ -169,7 +173,7 @@ class DNAVar(models.DNAVar):
#if
return description + "{}>{}".format(self.deleted, self.inserted)
- #__str__
+ #__unicode__
def weight(self):
if self.type == "unknown":
@@ -204,9 +208,9 @@ class ProteinVar(models.ProteinVar):
:arg sample_end: End position.
:type sample_end: int
:arg type: Variant type.
- :type type: str
+ :type type: unicode
:arg deleted: Deleted part of the reference sequence.
- :type deleted: str
+ :type deleted: unicode
:arg inserted: Inserted part.
:type inserted: object
:arg shift: Amount of freedom.
@@ -225,7 +229,7 @@ class ProteinVar(models.ProteinVar):
self.term = term
#__init__
- def __str__(self):
+ def __unicode__(self):
"""
Give the HGVS description of the raw variant stored in this class.
@@ -233,7 +237,7 @@ class ProteinVar(models.ProteinVar):
correct description. Also see the comment in the class definition.
:returns: The HGVS description of the raw variant stored in this class.
- :rtype: str
+ :rtype: unicode
"""
if self.type == "unknown":
return "?"
@@ -262,5 +266,5 @@ class ProteinVar(models.ProteinVar):
if self.term:
return description + "fs*{}".format(self.term)
return description
- #__str__
+ #__unicode__
#ProteinVar
diff --git a/mutalyzer/website/views.py b/mutalyzer/website/views.py
index 5bb2ae3576c049e40ad7968aebc1fe8550041f87..41db5354ab97fb9ffc41d495c879635cc8c6daa4 100644
--- a/mutalyzer/website/views.py
+++ b/mutalyzer/website/views.py
@@ -278,9 +278,9 @@ def name_checker():
extracted = extractedProt = '(skipped)'
if allele:
- extracted = str(allele) #describe.allele_description(allele)
+ extracted = unicode(allele) #describe.allele_description(allele)
if prot_allele:
- extractedProt = str(prot_allele) #describe.allele_description(prot_allele)
+ extractedProt = unicode(prot_allele) #describe.allele_description(prot_allele)
else:
extracted = extractedProt = ''
@@ -700,7 +700,7 @@ def description_extractor():
'Variant sequence is not DNA.')
raw_vars = describe.describe_dna(reference_sequence, variant_sequence)
- description = str(raw_vars) #describe.allele_description(raw_vars)
+ description = unicode(raw_vars) #describe.allele_description(raw_vars)
errors, warnings, summary = output.Summary()
messages = map(util.message_info, output.getMessages())