diff --git a/.travis.yml b/.travis.yml
index 771b6f7ae2c3e61e334805c0be0c81ac73b850b8..bfd46701c8be6d8c70d9746dcbdf16e77c9fcfde 100644
--- a/.travis.yml
+++ b/.travis.yml
@@ -3,6 +3,8 @@ language: python
python:
- "2.7"
before_install:
+ - sudo apt-get update -qq
+ - sudo apt-get install -y swig
- pip install -r requirements.txt
install:
- pip install .
diff --git a/doc/install.rst b/doc/install.rst
index ab615afb40260ca9457d79d60c29cb2a222f23a2..3db1005f8040c33a16bebb9ae0d384778f66570e 100644
--- a/doc/install.rst
+++ b/doc/install.rst
@@ -100,7 +100,7 @@ covered here.
Assuming you created and activated a virtual environment for Mutalyzer,
install all required Python packages::
- $ sudo apt-get install python-dev libmysqlclient-dev libxml2-dev libxslt-dev
+ $ sudo apt-get install python-dev libmysqlclient-dev libxml2-dev libxslt-dev swig
$ pip install -r requirements.txt
Install Mutalyzer::
diff --git a/mutalyzer/describe.py b/mutalyzer/describe.py
deleted file mode 100644
index d81254c39aeed1febbb7b5545ae48b82e3dfc7cb..0000000000000000000000000000000000000000
--- a/mutalyzer/describe.py
+++ /dev/null
@@ -1,837 +0,0 @@
-#!/usr/bin/python
-
-"""
-Prototype of a module that can generate a HGVS description of the variant(s)
-leading from one sequence to an other.
-
-@requires: Bio.Seq
-"""
-
-from __future__ import unicode_literals
-
-import collections
-from Bio.SeqUtils import seq3
-from Bio.Data import CodonTable
-
-from mutalyzer.util import longest_common_prefix, longest_common_suffix
-from mutalyzer.util import palinsnoop, roll, reverse_complement
-from mutalyzer import models
-
-
-# Maximum size of the LCS matrix
-MAX_MATRIX_SIZE = 8000000
-
-
-class LCS(object):
- """
- Class that calculates a Longest Common Substring matrix once and provides
- a function to find the LCS of a submatrix.
- """
-
- __delim = ' '
-
- def __init__(self, s1, s2, lcp, s1_end, s2_end, DNA=False):
- """
- Initialise the class.
-
- @arg s1: A string.
- @type s1: unicode
- @arg s2: A string.
- @type s2: unicode
- @arg lcp: The length of the longest common prefix of {s1} and {s2}.
- @type lcp: int
- @arg s1_end: End of the substring in {s1}.
- @type s1_end:
- @arg s2_end: End of the substring in {s2}.
- @type s2_end: int
- @arg DNA:
- @type DNA: bool
- """
- self.__lcp = lcp
- self.__s1 = s1[self.__lcp:s1_end]
- self.__s2 = s2[self.__lcp:s2_end]
- self.__s2_len = s2_end - lcp
- self.__matrix = self.LCSMatrix(self.__s1, self.__s2)
-
- self.__s2_rc = None
- self.__matrix_rc = None
- if DNA:
- self.__s2_rc = reverse_complement(s2[self.__lcp:s2_end])
- self.__matrix_rc = self.LCSMatrix(self.__s1, self.__s2_rc)
- #if
- #__init__
-
- def __unicode__(self):
- """
- Return a graphical representation of the LCS matrix, mainly for
- debugging.
-
- @returns: A graphical representation of the LCS matrix.
- @rtype: unicode
- """
- return self.visMatrix((0, len(self.__s1)), (0, len(self.__s2)))
- #__unicode__
-
- def visMatrix(self, r1, r2, rc=False):
- """
- Return a graphical representation of the LCS matrix, mainly for
- debugging.
-
- @returns: A graphical representation of the LCS matrix.
- @rtype: unicode
- """
- nr1 = r1[0] - self.__lcp, r1[1] - self.__lcp
- nr2 = r2[0] - self.__lcp, r2[1] - self.__lcp
-
- M = self.__matrix
- s2 = self.__s2
- if rc:
- M = self.__matrix_rc
- s2 = self.__s2_rc
-
- out = self.__delim.join(self.__delim + '-' + s2[nr2[0]:nr2[1]]) + '\n'
- for i in range(nr1[0], nr1[1] + 1):
- out += (('-' + self.__s1)[i] + self.__delim +
- self.__delim.join(map(lambda x: unicode(M[i][x]),
- range(nr2[0], nr2[1] + 1))) + '\n')
-
- return out
- #visMatrix
-
- def LCSMatrix(self, s1, s2):
- """
- Calculate the Longest Common Substring matrix.
-
- @arg s1: A string.
- @type s1: unicode
- @arg s2: A string.
- @type s2: unicode
-
- @returns: A matrix with the LCS of {s1}[i], {s2}[j] at position i, j.
- @rval: list[list[int]]
- """
- y_max = len(s1) + 1
- x_max = len(s2) + 1
- M = [[0] * x_max for i in range(y_max)]
-
- for x in range(1, y_max):
- for y in range(1, x_max):
- if s1[x - 1] == s2[y - 1]:
- M[x][y] = M[x - 1][y - 1] + 1
-
- return M
- #LCSMatrix
-
- def findMax(self, r1, r2, rc=False):
- """
- Find the LCS in a submatrix of {M}, given by the ranges {r1} and {r2}.
-
- @arg r1: A range for the first dimension of M.
- @type r1: tuple(int, int)
- @arg r2: A range for the second dimension of M.
- @type r2: tuple(int, int)
- @arg rc: Use the reverse complement matrix.
- @type rc: bool
-
- @returns:
- @rtype: tuple(int, int, int)
- """
- longest, x_longest, y_longest = 0, 0, 0
- nr1 = r1[0] - self.__lcp, r1[1] - self.__lcp
- nr2 = r2[0] - self.__lcp, r2[1] - self.__lcp
-
- M = self.__matrix
- if rc:
- M = self.__matrix_rc
- nr2 = self.__s2_len - nr2[1], self.__s2_len - nr2[0]
- #if
-
- for i in range(nr1[0], nr1[1] + 1):
- x_relative = i - nr1[0]
-
- for j in range(nr2[0], nr2[1] + 1):
- y_relative = j - nr2[0]
- realVal = min(M[i][j], x_relative, y_relative)
-
- if realVal > longest:
- longest, x_longest, y_longest = (realVal, x_relative,
- y_relative)
- #for
- #for
-
- return x_longest, y_longest, longest
- #findMax
-#LCS
-
-def makeFSTables(table_id):
- """
- For every pair of amino acids, calculate the set of possible amino acids in
- a different reading frame. Do this for both alternative reading frames (+1
- and +2).
-
- @arg table_id: Coding table ID.
- @type table_id: int
- @returns: Two dictionaries for the two alternative reading frames.
- @rtype: tuple(dict, dict)
- """
- # Make the forward translation table.
- table = dict(CodonTable.unambiguous_dna_by_id[table_id].forward_table)
- for i in CodonTable.unambiguous_dna_by_id[table_id].stop_codons:
- table[i] = '*'
-
- # Make the reverse translation table.
- reverse_table = collections.defaultdict(list)
- for i in table:
- reverse_table[table[i]].append(i)
-
- # Make the frame shift tables.
- FS1 = collections.defaultdict(set)
- FS2 = collections.defaultdict(set)
- for AA_i in reverse_table:
- for AA_j in reverse_table:
- for codon_i in reverse_table[AA_i]:
- for codon_j in reverse_table[AA_j]:
- FS1[AA_i + AA_j].add(table[(codon_i + codon_j)[1:4]]) # +1.
- FS2[AA_i + AA_j].add(table[(codon_i + codon_j)[2:5]]) # +2.
- #for
- return FS1, FS2
-#makeFSTables
-
-def __makeOverlaps(peptide):
- """
- Make a list of overlapping 2-mers of {peptide} in order of appearance.
-
- @arg peptide: A peptide sequence.
- @type peptide: unicode
- @returns: All 2-mers of {peptide} in order of appearance.
- @rtype: list(unicode)
- """
- return map(lambda x: peptide[x:x+2], range(len(peptide) - 1))
-#__makeOverlaps
-
-def __options(pList, peptidePrefix, FS, output):
- """
- Enumerate all peptides that could result from a frame shift.
-
- @arg pList: List of overlapping 2-mers of a peptide.
- @type pList: list(unicode)
- @arg peptidePrefix: Prefix of a peptide in the alternative reading frame.
- @type peptidePrefix: unicode
- @arg FS: Frame shift table.
- @type FS: dict
- @arg output: List of peptides, should be empty initially.
- @type output: list(unicode)
- """
- if not pList:
- output.append(peptidePrefix)
- return
- #if
- for i in FS[pList[0]]:
- __options(pList[1:], peptidePrefix + i, FS, output)
-#__options
-
-def enumFS(peptide, FS):
- """
- Enumerate all peptides that could result from a frame shift.
-
- @arg peptide: Original peptide sequence.
- @type peptide: unicode
- @arg FS: Frame shift table.
- @type FS: dict
- """
- output = []
-
- __options(__makeOverlaps(peptide), "", FS, output)
- return output
-#enumFS
-
-def fitFS(peptide, altPeptide, FS):
- """
- Check whether peptide {altPeptide} is a possible frame shift of peptide
- {peptide}.
-
- @arg peptide: Original peptide sequence.
- @type peptide: unicode
- @arg altPeptide: Observed peptide sequence.
- @type altPeptide: unicode
- @arg FS: Frame shift table.
- @type FS: dict
- """
- # Todo: This is a temporary fix to prevent crashing on frameshift
- # detection (I think bug #124).
- return False
-
- if len(peptide) < len(altPeptide):
- return False
-
- pList = __makeOverlaps(peptide)
-
- for i in range(len(altPeptide)):
- if not altPeptide[i] in FS[pList[i]]:
- return False
- return True
-#fitFS
-
-class DescribeRawVar(models.RawVar):
- """
- Container for a raw variant.
-
- To use this class correctly, do not supply more than the minimum amount of
- data. The {description()} function may not work properly if too much
- information is given.
-
- Example: if {end} is initialised for a substitution, a range will be
- retuned, resulting in a description like: 100_100A>T
-
- Note: As a workaround for a classname conflict in Spyne, this class is
- named `DescribeRawVar` instead of just `RawVar`. We might want to reconsider
- this name at some point.
- """
-
- def __init__(self, DNA=True, start=0, start_offset=0, end=0, end_offset=0,
- type="none", deleted="", inserted="", shift=0, startAA="", endAA="",
- term=0):
- """
- Initialise the class with the appropriate values.
-
- @arg start: Start position.
- @type start: int
- @arg start_offset:
- @type start_offset: int
- @arg end: End position.
- @type end: int
- @arg end_offset:
- @type end_offset: int
- @arg type: Variant type.
- @type type: unicode
- @arg deleted: Deleted part of the reference sequence.
- @type deleted: unicode
- @arg inserted: Inserted part.
- @type inserted: unicode
- @arg shift: Amount of freedom.
- @type shift: int
- """
- # TODO: Will this container be used for all variants, or only genomic?
- # start_offset and end_offset may be never used.
- self.DNA = DNA
- self.start = start
- self.start_offset = start_offset
- self.end = end
- self.end_offset = end_offset
- self.type = type
- self.deleted = deleted
- self.inserted = inserted
- self.shift = shift
- self.startAA = startAA
- self.endAA = endAA
- self.term = term
- self.hgvs = self.description()
- self.hgvsLength = self.descriptionLength()
- #__init__
-
- def __DNADescription(self):
- """
- Give the HGVS description of the raw variant stored in this class.
-
- Note that this function relies on the absence of values to make the
- correct description. Also see the comment in the class definition.
-
- @returns: The HGVS description of the raw variant stored in this class.
- @rtype: unicode
- """
- if not self.start:
- return "="
-
- descr = "%i" % self.start
-
- if self.end:
- descr += "_%i" % self.end
-
- if self.type != "subst":
- descr += "%s" % self.type
-
- if self.inserted:
- return descr + "%s" % self.inserted
- return descr
- #if
-
- return descr + "%s>%s" % (self.deleted, self.inserted)
- #__DNADescription
-
- def __proteinDescription(self):
- """
- Give the HGVS description of the raw variant stored in this class.
-
- Note that this function relies on the absence of values to make the
- correct description. Also see the comment in the class definition.
-
- @returns: The HGVS description of the raw variant stored in this class.
- @rtype: unicode
- """
- if self.type == "unknown":
- return "?"
- if not self.start:
- return "="
-
- descr = ""
- if not self.deleted:
- if self.type == "ext":
- descr += '*'
- else:
- descr += "%s" % seq3(self.startAA)
- #if
- else:
- descr += "%s" % seq3(self.deleted)
- descr += "%i" % self.start
- if self.end:
- descr += "_%s%i" % (seq3(self.endAA), self.end)
- if self.type not in ["subst", "stop", "ext", "fs"]:
- descr += self.type
- if self.inserted:
- descr += "%s" % seq3(self.inserted)
-
- if self.type == "stop":
- return descr + '*'
- if self.term:
- return descr + "%s*%i" % (self.type, self.term)
- return descr
- #__proteinDescription
-
- def __DNADescriptionLength(self):
- """
- Give the standardised length of the HGVS description of the raw variant
- stored in this class.
-
- Note that this function relies on the absence of values to make the
- correct description. Also see the comment in the class definition.
-
- @returns: The standardised length of the HGVS description of the raw
- variant stored in this class.
- @rtype: int
- """
- if not self.start : # `=' or `?'
- return 1
-
- descrLen = 1 # Start position.
-
- if self.end : # '_' and end position.
- descrLen += 2
-
- if self.type != "subst":
- descrLen += len(self.type)
-
- if self.inserted:
- return descrLen + len(self.inserted)
- return descrLen
- #if
-
- return 4 # Start position, '>' and end position.
- #__DNAdescriptionLength
-
- def __proteinDescriptionLength(self):
- """
- Give the standardised length of the HGVS description of the raw variant
- stored in this class.
-
- Note that this function relies on the absence of values to make the
- correct description. Also see the comment in the class definition.
-
- @returns: The standardised length of the HGVS description of the raw
- variant stored in this class.
- @rtype: int
- """
- if not self.start: # =
- return 1
-
- descrLen = 1 # Start position.
- if not self.deleted and self.type == "ext":
- descrLen += 1 # *
- else:
- descrLen += 3 # One amino acid.
- if self.end:
- descrLen += 5 # `_' + one amino acid + end position.
- if self.type not in ["subst", "stop", "ext", "fs"]:
- descrLen += len(self.type)
- if self.inserted:
- descrLen += 3 * len(self.inserted)
- if self.type == "stop":
- return descrLen + 1 # *
- if self.term:
- return descrLen + len(self.type) + 2 # `*' + length until stop.
- return descrLen
- #__proteinDescriptionLength
-
- def description(self):
- """
- """
- if self.DNA:
- return self.__DNADescription()
- return self.__proteinDescription()
- #description
-
- def descriptionLength(self):
- """
- Give the standardised length of the HGVS description of the raw variant
- stored in this class.
-
- @returns: The standardised length of the HGVS description of the raw
- variant stored in this class.
- @rtype: int
- """
- if self.DNA:
- return self.__DNADescriptionLength()
- return self.__proteinDescriptionLength()
- #descriptionLength
-#DescribeRawVar
-
-def alleleDescription(allele):
- """
- Convert a list of raw variants to an HGVS allele description.
-
- @arg allele: A list of raw variants representing an allele description.
- @type allele: list(DescribeRawVar)
-
- @returns: The HGVS description of {allele}.
- @rval: unicode
- """
- if len(allele) > 1:
- return "[%s]" % ';'.join(map(lambda x : x.hgvs, allele))
- return allele[0].hgvs
-#alleleDescription
-
-def alleleDescriptionLength(allele):
- """
- Calculate the standardised length of an HGVS allele description.
-
- @arg allele: A list of raw variants representing an allele description.
- @type allele: list(DescribeRawVar)
-
- @returns: The standardised length of the HGVS description of {allele}.
- @rval: int
- """
- # NOTE: Do we need to count the ; and [] ?
- return sum(map(lambda x : x.hgvsLength, allele))
-#alleleDescriptionLength
-
-def printpos(s, start, end, fill = 0):
- """
- For debugging purposes.
- """
- # TODO: See if this can partially replace or be merged with the
- # visualisation in the __mutate() function of mutator.py
- fs = 10 # Flank size.
-
- return "%s %s%s %s" % (s[start - fs:start], s[start:end], '-' * fill,
- s[end:end + fs])
-#printpos
-
-def DNA_description(M, s1, s2, s1_start, s1_end, s2_start, s2_end):
- """
- Give an allele description of the change from {s1} to {s2} in the range
- {s1_start}..{s1_end} on {s1} and {s2_start}..{s2_end} on {s2}.
-
- arg s1: Sequence 1.
- type s1: unicode
- arg s2: Sequence 2.
- type s2: unicode
- arg s1_start: Start of the range on {s1}.
- type s1_start: int
- arg s1_end: End of the range on {s1}.
- type s1_end: int
- arg s2_start: Start of the range on {s2}.
- type s2_start: int
- arg s2_end: End of the range on {s2}.
- type s2_end: int
-
- @returns: A list of DescribeRawVar objects, representing the allele.
- @rval: list(DescribeRawVar)
- """
- # TODO: Instead of copying this function and adjusting it to make it work
- # for proteins, consider disabling parts like the inversion.
- # TODO: Think about frameshift descriptions.
-
- # Nothing happened.
- if s1 == s2:
- return [DescribeRawVar()]
-
- # Insertion / Duplication.
- if s1_start == s1_end:
- ins_length = s2_end - s2_start
- shift5, shift3 = roll(s2, s2_start + 1, s2_end)
- shift = shift5 + shift3
-
- s1_start += shift3
- s1_end += shift3
- s2_start += shift3
- s2_end += shift3
-
- if s2_start - ins_length >= 0 and \
- s1[s1_start - ins_length:s1_start] == s2[s2_start:s2_end]:
-
- if ins_length == 1:
- return [DescribeRawVar(start=s1_start, type="dup", shift=shift)]
- return [DescribeRawVar(start=s1_start - ins_length + 1, end=s1_end,
- type="dup", shift=shift)]
- #if
- return [DescribeRawVar(start=s1_start, end=s1_start + 1,
- inserted=s2[s2_start:s2_end], type="ins", shift=shift)]
- #if
-
- # Deletion.
- if s2_start == s2_end:
- shift5, shift3 = roll(s1, s1_start + 1, s1_end)
- shift = shift5 + shift3
-
- s1_start += shift3 + 1
- s1_end += shift3
-
- if s1_start == s1_end:
- return [DescribeRawVar(start=s1_start, type="del", shift=shift)]
- return [DescribeRawVar(start=s1_start, end=s1_end, type="del", shift=shift)]
- #if
-
- # Substitution.
- if s1_start + 1 == s1_end and s2_start + 1 == s2_end:
- return [DescribeRawVar(start=s1_start + 1, deleted=s1[s1_start],
- inserted=s2[s2_start], type="subst")]
-
- # Simple InDel.
- if s1_start + 1 == s1_end:
- return [DescribeRawVar(start=s1_start + 1, inserted=s2[s2_start:s2_end],
- type="delins")]
-
- # TODO: Refactor the code after this point.
-
- # At this stage, we either have an inversion, an indel or a Compound
- # variant.
- s1_end_f, s2_end_f, lcs_f_len = M.findMax((s1_start, s1_end),
- (s2_start, s2_end))
- s1_end_r, s2_end_r, lcs_r_len = M.findMax((s1_start, s1_end),
- (s2_start, s2_end), rc=True)
-
- # Palindrome snooping.
- trim = palinsnoop(s1[s1_start + s1_end_r - lcs_r_len:s1_start + s1_end_r])
- if trim == -1 : # Full palindrome.
- lcs_r_len = 0 # s1_end_r and s2_end_r should not be used after this.
-
- # Inversion or Compound variant.
- default = [DescribeRawVar(start=s1_start + 1, end=s1_end,
- inserted=s2[s2_start:s2_end], type="delins")]
-
- if not (lcs_f_len or lcs_r_len) : # Optimisation, not really needed.
- return default
-
- # Inversion.
- if lcs_f_len <= lcs_r_len:
- if trim > 0 : # Partial palindrome.
- s1_end_r -= trim
- s2_end_r -= trim
- lcs_r_len -= 2 * trim
- #if
-
- # Simple Inversion.
- if s2_end - s2_start == lcs_r_len and s1_end - s1_start == lcs_r_len:
- return [DescribeRawVar(start=s1_start + 1, end=s1_end, type="inv")]
-
- r1_len = s1_end_r - lcs_r_len
- r2_len = s1_end - s1_start - s1_end_r
- m1_len = s2_end_r - lcs_r_len
- m2_len = s2_end - s2_start - s2_end_r
-
- # The flanks of the inversion (but not both) can be empty, so we
- # generate descriptions conditionally.
- leftRv = []
- rightRv = []
- if r1_len or m2_len:
- lcs = len(longest_common_suffix(s1[s1_start:s1_start + r1_len],
- s2[s2_start:s2_start + m2_len]))
- leftRv = DNA_description(M, s1, s2,
- s1_start, s1_start + r1_len - lcs,
- s2_start, s2_start + m2_len - lcs)
- #if
- if r2_len or m1_len:
- lcp = len(longest_common_prefix(s1[s1_end - r2_len:s1_end],
- s2[s2_end - m1_len:s2_end]))
- rightRv = DNA_description(M, s1, s2,
- s1_end - r2_len + lcp, s1_end, s2_end - m1_len + lcp, s2_end)
- #if
-
- partial = leftRv + [DescribeRawVar(start=s1_start + r1_len + 1,
- end=s1_end - r2_len, type="inv")] + rightRv
- #if
-
- # Compound variant.
- else:
- r1_len = s1_end_f - lcs_f_len
- r2_len = s1_end - s1_start - s1_end_f
- m1_len = s2_end_f - lcs_f_len
- m2_len = s2_end - s2_start - s2_end_f
-
- partial = DNA_description(M, s1, s2, s1_start, s1_start + r1_len,
- s2_start, s2_start + m1_len) + DNA_description(M, s1, s2,
- s1_end - r2_len, s1_end, s2_end - m2_len, s2_end)
- #else
-
- if alleleDescriptionLength(partial) <= alleleDescriptionLength(default):
- return partial
- return default
-#DNA_description
-
-def protein_description(M, s1, s2, s1_start, s1_end, s2_start, s2_end):
- """
- Give an allele description of the change from {s1} to {s2} in the range
- {s1_start}..{s1_end} on {s1} and {s2_start}..{s2_end} on {s2}.
-
- arg s1: Sequence 1.
- type s1: unicode
- arg s2: Sequence 2.
- type s2: unicode
- arg s1_start: Start of the range on {s1}.
- type s1_start: int
- arg s1_end: End of the range on {s1}.
- type s1_end: int
- arg s2_start: Start of the range on {s2}.
- type s2_start: int
- arg s2_end: End of the range on {s2}.
- type s2_end: int
-
- @returns: A list of DescribeRawVar objects, representing the allele.
- @rval: list(DescribeRawVar)
- """
- if s1 == '?' or s2 == '?':
- return [DescribeRawVar(DNA=False, type="unknown")]
-
- # One of the sequences is missing.
- if not (s1 and s2):
- return [DescribeRawVar(DNA=False)]
-
- # Nothing happened.
- if s1 == s2:
- return [DescribeRawVar(DNA=False)]
-
- # Substitution.
- if s1_start + 1 == s1_end and s2_start + 1 == s2_end:
- return [DescribeRawVar(DNA=False, start=s1_start + 1, deleted=s1[s1_start],
- inserted=s2[s2_start], type="subst")]
-
- # Insertion / Duplication / Extention.
- if s1_start == s1_end:
- if len(s1) == s1_start + 1:
- return [DescribeRawVar(DNA=False, start=s1_start + 1,
- inserted=s2[s2_start], term=abs(len(s1) - len(s2)),
- type="ext")]
- ins_length = s2_end - s2_start
- shift5, shift3 = roll(s2, s2_start + 1, s2_end)
- shift = shift5 + shift3
-
- s1_start += shift3
- s1_end += shift3
- s2_start += shift3
- s2_end += shift3
-
- if s2_start - ins_length >= 0 and \
- s1[s1_start - ins_length:s1_start] == s2[s2_start:s2_end]:
-
- if ins_length == 1:
- return [DescribeRawVar(DNA=False, start=s1_start,
- startAA=s1[s1_start - 1], type="dup", shift=shift)]
- return [DescribeRawVar(DNA=False, start=s1_start - ins_length + 1,
- startAA=s1[s1_start - ins_length], end=s1_end,
- endAA=s1[s1_end - 1], type="dup", shift=shift)]
- #if
- return [DescribeRawVar(DNA=False, start=s1_start, startAA=s1[s1_start - 1],
- end=s1_start + 1, endAA=s1[s1_end], inserted=s2[s2_start:s2_end],
- type="ins", shift=shift)]
- #if
-
- # Deletion / Inframe stop.
- if s2_start == s2_end:
- if len(s2) == s2_end + 1:
- return [DescribeRawVar(DNA=False, start=s1_start + 1, startAA=s1[s1_start],
- type="stop")]
- shift5, shift3 = roll(s1, s1_start + 1, s1_end)
- shift = shift5 + shift3
-
- s1_start += shift3 + 1
- s1_end += shift3
-
- if s1_start == s1_end:
- return [DescribeRawVar(DNA=False, start=s1_start, startAA=s1[s1_start - 1],
- type="del", shift=shift)]
- return [DescribeRawVar(DNA=False, start=s1_start, startAA=s1[s1_start - 1],
- end=s1_end, endAA=s1[s1_end - 1], type="del", shift=shift)]
- #if
-
- # Simple InDel.
- if s1_start + 1 == s1_end:
- return [DescribeRawVar(DNA=False, start=s1_start + 1, startAA=s1[s1_start],
- inserted=s2[s2_start:s2_end], type="delins")]
-
- # Frameshift.
- if len(s1) == s1_end + 1 and len(s2) == s2_end + 1:
- # TODO: the FS tables should be made for all coding tables in advance.
- FS1, FS2 = makeFSTables(1) # Standard coding table.
-
- if (fitFS(s1[s1_start + 1:], s2[s2_start + 1:], FS1) or
- fitFS(s1[s1_start + 1:], s2[s2_start + 1:], FS2) or
- fitFS(s2[s2_start + 1:], s1[s1_start + 2:], FS1) or
- fitFS(s2[s2_start + 1:], s1[s1_start + 2:], FS2)):
- return [DescribeRawVar(DNA=False, start=s1_start + 1, deleted=s1[s1_start],
- inserted=s2[s2_start], term=len(s2) - s2_start, type="fs")]
- #if
-
- # At this point, we have an indel.
- s1_end_f, s2_end_f, lcs_f_len = M.findMax((s1_start, s1_end),
- (s2_start, s2_end))
-
- # InDel.
- default = [DescribeRawVar(DNA=False, start=s1_start + 1, startAA=s1[s1_start],
- end=s1_end, endAA=s1[s1_end], inserted=s2[s2_start:s2_end],
- type="delins")]
-
- if not lcs_f_len : # Optimisation, not really needed.
- return default
-
- r1_len = s1_end_f - lcs_f_len
- r2_len = s1_end - s1_start - s1_end_f
- m1_len = s2_end_f - lcs_f_len
- m2_len = s2_end - s2_start - s2_end_f
-
- partial = protein_description(M, s1, s2, s1_start, s1_start + r1_len,
- s2_start, s2_start + m1_len) + protein_description(M, s1, s2,
- s1_end - r2_len, s1_end, s2_end - m2_len, s2_end)
-
- if alleleDescriptionLength(partial) <= alleleDescriptionLength(default):
- return partial
- return default
-#protein_description
-
-def describe(original, mutated, DNA=True):
- """
- Convenience function for DNA_description().
-
- @arg original:
- @type original: unicode
- @arg mutated:
- @type mutated: unicode
-
- @returns: A list of DescribeRawVar objects, representing the allele.
- @rval: list(DescribeRawVar)
- """
- s1 = original
- s2 = mutated
- lcp = len(longest_common_prefix(s1, s2))
- lcs = len(longest_common_suffix(s1[lcp:], s2[lcp:]))
- s1_end = len(s1) - lcs
- s2_end = len(s2) - lcs
-
- if (s1_end - lcp) * (s2_end - lcp) > MAX_MATRIX_SIZE:
- return
-
- if not DNA:
- M = LCS(s1, s2, lcp, s1_end, s2_end)
- return protein_description(M, s1, s2, lcp, s1_end, lcp, s2_end)
- #if
- M = LCS(s1, s2, lcp, s1_end, s2_end, DNA=True)
- return DNA_description(M, s1, s2, lcp, s1_end, lcp, s2_end)
-#describe
diff --git a/mutalyzer/entrypoints/mutalyzer.py b/mutalyzer/entrypoints/mutalyzer.py
index 6717161d1d4795c923f70cfa6846358ace2972c8..c455ae1ed8e290c8982d7883880c9950c613e0e0 100644
--- a/mutalyzer/entrypoints/mutalyzer.py
+++ b/mutalyzer/entrypoints/mutalyzer.py
@@ -8,14 +8,24 @@ Mutalyzer command-line name checker.
from __future__ import unicode_literals
import argparse
-import sys
+import json
+
+import extractor
from . import _cli_string
-from .. import describe
from .. import output
from .. import variantchecker
+class MyEncoder(json.JSONEncoder):
+ def default(self, o):
+ json_object = o.__dict__
+ json_object.update({"hgvs": unicode(o), "weight": o.weight()})
+
+ return json_object
+ #default
+#MyEncoder
+
def check_name(description):
"""
Run the name checker.
@@ -93,22 +103,32 @@ def check_name(description):
for i in O.getOutput("legends") :
print i
- allele = describe.describe(O.getIndexedOutput("original", 0),
- O.getIndexedOutput("mutated", 0))
- prot_allele = describe.describe(O.getIndexedOutput("oldprotein", 0),
- O.getIndexedOutput("newprotein", 0, default=""), DNA=False)
+ reference_sequence = O.getIndexedOutput("original", 0)
+ sample_sequence = O.getIndexedOutput("mutated", 0)
+
+ described_allele = extractor.describe_dna(reference_sequence,
+ sample_sequence)
+ #described_protein_allele = describe.describe(
+ # O.getIndexedOutput("oldprotein", 0),
+ # O.getIndexedOutput("newprotein", 0, default=""),
+ # DNA=False)
+ described_protein_allele = ""
- extracted = extractedProt = '(skipped)'
+ described = described_protein = '(skipped)'
- if allele:
- extracted = describe.alleleDescription(allele)
- if prot_allele:
- extractedProt = describe.alleleDescription(prot_allele)
+ if described_allele:
+ described = described_allele
+ if described_protein_allele:
+ described_protein = described_protein_allele
print "\nExperimental services:"
- print extracted
- print extractedProt
+ print described
+ print described_protein
#print "+++ %s" % O.getOutput("myTranscriptDescription")
+ print json.dumps({
+ #"reference_sequence": reference_sequence,
+ #"sample_sequence": sample_sequence,
+ "allele_description": described_allele}, cls=MyEncoder)
def main():
diff --git a/mutalyzer/extractor_loader.py b/mutalyzer/extractor_loader.py
new file mode 100644
index 0000000000000000000000000000000000000000..ee8b097e50518f008daafbde2bd7357da648bf37
--- /dev/null
+++ b/mutalyzer/extractor_loader.py
@@ -0,0 +1,37 @@
+#!/usr/bin/env python
+
+from __future__ import unicode_literals
+
+import sys
+
+import json
+
+import describe
+
+class MyEncoder(json.JSONEncoder):
+ def default(self, o):
+ return o.__dict__
+
+def main():
+ if len(sys.argv) < 3:
+ print "usage: " + sys.argv[0] + " reference sample"
+ exit()
+ #if
+
+ f = open(sys.argv[1], "r")
+ ref = f.read()
+ f.close()
+ f = open(sys.argv[2], "r")
+ alt = f.read()
+ f.close()
+
+ extracted_allele = describe.describe_dna(ref, alt)
+
+ #print "Description Extractor Version " + describe.extractor.VERSION
+ print extracted_allele
+ #print "JSON: " + json.dumps({"reference_sequence": ref, "sample_sequence": alt, "allele_description": extracted_allele}, cls=MyEncoder)
+
+#main
+
+if __name__ == "__main__":
+ main()
diff --git a/mutalyzer/models.py b/mutalyzer/models.py
index 18d934f7dbf6f3ba39fc06eaad9bc0320a67fb03..7ebade7f8fa429b92845cac6f3f13a784474bb69 100644
--- a/mutalyzer/models.py
+++ b/mutalyzer/models.py
@@ -105,23 +105,73 @@ class RawVar(ComplexModel):
"""
__namespace__ = SOAP_NAMESPACE
- DNA = Mandatory.Boolean
start = Mandatory.Integer
start_offset = Mandatory.Integer
end = Mandatory.Integer
end_offset = Mandatory.Integer
+ sample_start = Mandatory.Integer
+ sample_start_offset = Mandatory.Integer
+ sample_end = Mandatory.Integer
+ sample_end_offset = Mandatory.Integer
type = Mandatory.Unicode
deleted = Mandatory.Unicode
inserted = Mandatory.Unicode
+ weight = Mandatory.Integer
shift = Mandatory.Integer
- startAA = Mandatory.Unicode
- endAA = Mandatory.Unicode
- term = Mandatory.Integer
- hgvs = Mandatory.Unicode
- hgvsLength = Mandatory.Integer
+ description = Mandatory.Unicode
#RawVar
+class _RawVar(ComplexModel):
+ """
+ Used in MutalyzerOutput data type.
+ """
+ __namespace__ = SOAP_NAMESPACE
+
+ start = Mandatory.Integer
+ end = Mandatory.Integer
+ sample_start = Mandatory.Integer
+ sample_end = Mandatory.Integer
+ type = Mandatory.Unicode
+ deleted = Mandatory.Unicode
+ inserted = Mandatory.Unicode
+ shift = Mandatory.Integer
+ hgvs = Mandatory.Unicode
+ weight = Mandatory.Integer
+#_RawVar
+
+
+class DNAVar(_RawVar):
+ """
+ Used in MutalyzerOutput data type.
+ """
+ __namespace__ = SOAP_NAMESPACE
+
+ start_offset = Mandatory.Integer
+ end_offset = Mandatory.Integer
+ sample_start_offset = Mandatory.Integer
+ sample_end_offset = Mandatory.Integer
+#DNAVar
+
+
+class RNAVar(DNAVar):
+ """
+ Used in MutalyzerOutput data type.
+ """
+ __namespace__ = SOAP_NAMESPACE
+#RNAVar
+
+
+class ProteinVar(_RawVar):
+ """
+ Used in MutalyzerOutput data type.
+ """
+ __namespace__ = SOAP_NAMESPACE
+
+ term = Mandatory.Integer
+#ProteinVar
+
+
class Allele(ComplexModel):
"""
Used in MutalyzerOutput data type.
diff --git a/mutalyzer/services/rpc.py b/mutalyzer/services/rpc.py
index 7e57d76be8a7bb5310f905b4265996d07ab37d5a..770271128c6012bedb2139eff9cd58ce5e7a6edb 100644
--- a/mutalyzer/services/rpc.py
+++ b/mutalyzer/services/rpc.py
@@ -23,6 +23,8 @@ from operator import attrgetter
from sqlalchemy.orm.exc import NoResultFound
from sqlalchemy.sql import func
+import extractor
+
import mutalyzer
from mutalyzer.config import settings
from mutalyzer.db import session
@@ -40,7 +42,6 @@ from mutalyzer import Retriever
from mutalyzer import GenRecord
from mutalyzer import Scheduler
from mutalyzer.models import *
-from mutalyzer import describe
def create_rpc_fault(output):
@@ -1239,9 +1240,28 @@ class MutalyzerService(ServiceBase):
output.addMessage(__file__, -1, 'INFO',
'Received request descriptionExtract')
+ allele = extractor.describe_dna(reference, observed)
+
result = Allele()
- result.allele = describe.describe(reference, observed)
- result.description = describe.alleleDescription(result.allele)
+ result.allele = []
+ for variant in allele:
+ raw_var = RawVar()
+ raw_var.start = variant.start
+ raw_var.start_offset = variant.start_offset
+ raw_var.end = variant.end
+ raw_var.end_offset = variant.end_offset
+ raw_var.sample_start = variant.sample_start
+ raw_var.sample_start_offset = variant.sample_start_offset
+ raw_var.sample_end = variant.sample_end
+ raw_var.sample_end_offset = variant.sample_end_offset
+ raw_var.type = variant.type
+ raw_var.deleted = unicode(variant.deleted)
+ raw_var.inserted = unicode(variant.inserted)
+ raw_var.weight = variant.weight()
+ raw_var.shift = variant.shift
+ raw_var.description = unicode(variant)
+ result.allele.append(raw_var)
+ result.description = unicode(allele)
output.addMessage(__file__, -1, 'INFO',
'Finished processing descriptionExtract')
diff --git a/mutalyzer/test.py b/mutalyzer/test.py
new file mode 100644
index 0000000000000000000000000000000000000000..f733aec814afeda4f4c22ef9b8cabfaecb1b2221
--- /dev/null
+++ b/mutalyzer/test.py
@@ -0,0 +1,25 @@
+#!/usr/bin/env python
+
+from __future__ import unicode_literals
+
+import json
+
+import describe
+
+class MyEncoder(json.JSONEncoder):
+ def default(self, o):
+ return o.__dict__
+
+def main():
+ ref = "ACGTCGATTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGATATTTTT"
+ alt = "ACGTCGGTTCGCTAGCTTCGGGGGATAGATAGATATATAGAGATATTTTT"
+
+ extracted_allele = describe.describe_dna(ref, alt)
+
+ print extracted_allele
+ print json.dumps({"reference_sequence": ref, "sample_sequence": alt,
+ "allele_description": extracted_allele}, cls=MyEncoder)
+#main
+
+if __name__ == "__main__":
+ main()
diff --git a/mutalyzer/util.py b/mutalyzer/util.py
index 6b7987b31c8f9a7bed62507572f0c417589d6c4a..4bf06e3effef5fe56f507e7dd0a82f2594aab8b4 100644
--- a/mutalyzer/util.py
+++ b/mutalyzer/util.py
@@ -31,66 +31,8 @@ import time
from Bio.SeqUtils import seq3
-
-# Taken from BioPython.
-AMBIGUOUS_DNA_COMPLEMENT = {
- 'A': 'T',
- 'C': 'G',
- 'G': 'C',
- 'T': 'A',
- 'M': 'K',
- 'R': 'Y',
- 'W': 'W',
- 'S': 'S',
- 'Y': 'R',
- 'K': 'M',
- 'V': 'B',
- 'H': 'D',
- 'D': 'H',
- 'B': 'V',
- 'X': 'X',
- 'N': 'N'}
-AMBIGUOUS_RNA_COMPLEMENT = {
- 'A': 'U',
- 'C': 'G',
- 'G': 'C',
- 'U': 'A',
- 'M': 'K',
- 'R': 'Y',
- 'W': 'W',
- 'S': 'S',
- 'Y': 'R',
- 'K': 'M',
- 'V': 'B',
- 'H': 'D',
- 'D': 'H',
- 'B': 'V',
- 'X': 'X',
- 'N': 'N'}
-
-
-def _make_translation_table(complement_mapping):
- before = complement_mapping.keys()
- before += [b.lower() for b in before]
- after = complement_mapping.values()
- after += [b.lower() for b in after]
- return {ord(k): v for k, v in zip(before, after)}
-
-
-_dna_complement_table = _make_translation_table(AMBIGUOUS_DNA_COMPLEMENT)
-_rna_complement_table = _make_translation_table(AMBIGUOUS_RNA_COMPLEMENT)
-
-
-def reverse_complement(sequence):
- """
- Reverse complement of a sequence represented as unicode string.
- """
- if 'U' in sequence or 'u' in sequence:
- table = _rna_complement_table
- else:
- table = _dna_complement_table
-
- return ''.join(reversed(sequence.translate(table)))
+# NOTE: This is a temporary fix.
+from extractor.describe import reverse_complement, palinsnoop, roll
def is_utf8_alias(encoding):
@@ -309,87 +251,6 @@ def roll_(s, start, end) :
#roll
-def roll(s, first, last):
- """
- Determine the variability of a variant by looking at cyclic
- permutations. Not all cyclic permutations are tested at each time, it
- is sufficient to check ``aW'' if ``Wa'' matches (with ``a'' a letter,
- ``W'' a word) when rolling to the left for example.
-
- >>> roll('abbabbabbabb', 4, 6)
- (3, 6)
- >>> roll('abbabbabbabb', 5, 5)
- (0, 1)
- >>> roll('abcccccde', 4, 4)
- (1, 3)
-
- @arg s: A reference sequence.
- @type s: any sequence type
- @arg first: First position of the pattern in the reference sequence.
- @type first: int
- @arg last: Last position of the pattern in the reference sequence.
- @type last: int
-
- @return: tuple:
- - left ; Amount of positions that the pattern can be shifted to
- the left.
- - right ; Amount of positions that the pattern can be shifted to
- the right.
- @rtype: tuple(int, int)
- """
- pattern = s[first - 1:last] # Extract the pattern
- pattern_length = len(pattern)
-
- # Keep rolling to the left as long as a cyclic permutation matches.
- minimum = first - 2
- j = pattern_length - 1
- while minimum > -1 and s[minimum] == pattern[j % pattern_length]:
- j -= 1
- minimum -= 1
-
- # Keep rolling to the right as long as a cyclic permutation matches.
- maximum = last
- j = 0
- while maximum < len(s) and s[maximum] == pattern[j % pattern_length]:
- j += 1
- maximum += 1
-
- return first - minimum - 2, maximum - last
-#roll
-
-
-def palinsnoop(s):
- """
- Check a sequence for a reverse-complement-palindromic prefix (and
- suffix). If one is detected, return the length of this prefix. If the
- string equals its reverse complement, return -1.
-
- >>> palinsnoop('TACGCTA')
- 2
- >>> palinsnoop('TACGTA')
- -1
- >>> palinsnoop('TACGCTT')
- 0
-
- @arg s: A nucleotide sequence.
- @type s: unicode
-
- @return: The number of elements that are palindromic or -1 if the string
- is a 'palindrome'.
- @rtype: int
- """
- s_revcomp = reverse_complement(s)
-
- for i in range(int(math.ceil(len(s) / 2.0))):
- if s[i] != s_revcomp[i]:
- # The first i elements are 'palindromic'.
- return i
-
- # Perfect 'palindrome'.
- return -1
-#palinsnoop
-
-
def longest_common_prefix(s1, s2):
"""
Calculate the longest common prefix of two strings.
@@ -434,7 +295,7 @@ def longest_common_suffix(s1, s2):
@type s2: unicode
@return: The longest common suffix of s1 and s2.
- @rtype: string
+ @rtype: unicode
"""
return longest_common_prefix(s1[::-1], s2[::-1])[::-1]
#longest_common_suffix
@@ -680,7 +541,7 @@ def visualise_sequence(sequence, max_length=25, flank_size=6):
@type flank_size: int
@return: Either the original sequence, or an abbreviation of it.
- @rtype: str
+ @rtype: unicode
"""
if len(sequence) > max_length:
return '%s [%ibp] %s' % (sequence[:flank_size],
diff --git a/mutalyzer/website/templates/description-extractor.html b/mutalyzer/website/templates/description-extractor.html
index 2f2cb17d774dfee13a1f228a04deb27f8eac7a01..d1d8917a4b82ff92d7145e05a2248ecbd0b6ab6b 100644
--- a/mutalyzer/website/templates/description-extractor.html
+++ b/mutalyzer/website/templates/description-extractor.html
@@ -94,7 +94,7 @@ Please supply a reference sequence and an observed sequence.
<td>{{ raw_var.deleted }}</td>
<td>{{ raw_var.inserted }}</td>
<td>{{ raw_var.shift }}</td>
- <td>{{ raw_var.hgvs }}</td>
+ <td>{{ raw_var }}</td>
</tr>
{% endfor %}
</tbody>
diff --git a/mutalyzer/website/views.py b/mutalyzer/website/views.py
index 992e84a502ba6d46c310f65f0e50b9611b6ac412..36327e1836c4589c610bd7d1c8bd062261fd05f4 100644
--- a/mutalyzer/website/views.py
+++ b/mutalyzer/website/views.py
@@ -19,8 +19,10 @@ from lxml import etree
from spyne.server.http import HttpBase
from sqlalchemy.orm.exc import NoResultFound
+import extractor
+
import mutalyzer
-from mutalyzer import (announce, describe, File, Retriever, Scheduler, stats,
+from mutalyzer import (announce, File, Retriever, Scheduler, stats,
util, variantchecker)
from mutalyzer.config import settings
from mutalyzer.db.models import BATCH_JOB_TYPES
@@ -269,20 +271,18 @@ def name_checker():
# Experimental description extractor.
if (output.getIndexedOutput('original', 0) and
output.getIndexedOutput('mutated', 0)):
- extracted = extractedProt = '(skipped)'
+ allele = extractor.describe_dna(output.getIndexedOutput('original', 0),
+ output.getIndexedOutput('mutated', 0))
+ #prot_allele = describe.describe_protein(
+ # output.getIndexedOutput('oldprotein', 0),
+ # output.getIndexedOutput('newprotein', 0, default=''))
+ prot_allele = ''
- allele = describe.describe(output.getIndexedOutput('original', 0),
- output.getIndexedOutput('mutated', 0))
+ extracted = extractedProt = '(skipped)'
if allele:
- extracted = describe.alleleDescription(allele)
-
- if output.getIndexedOutput('oldprotein', 0):
- prot_allele = describe.describe(
- output.getIndexedOutput('oldprotein', 0),
- output.getIndexedOutput('newprotein', 0, default=''),
- DNA=False)
- if prot_allele:
- extractedProt = describe.alleleDescription(prot_allele)
+ extracted = unicode(allele) #describe.allele_description(allele)
+ if prot_allele:
+ extractedProt = unicode(prot_allele) #describe.allele_description(prot_allele)
else:
extracted = extractedProt = ''
@@ -701,8 +701,8 @@ def description_extractor():
output.addMessage(__file__, 3, 'ENODNA',
'Variant sequence is not DNA.')
- raw_vars = describe.describe(reference_sequence, variant_sequence)
- description = describe.alleleDescription(raw_vars)
+ raw_vars = extractor.describe_dna(reference_sequence, variant_sequence)
+ description = unicode(raw_vars) #describe.allele_description(raw_vars)
errors, warnings, summary = output.Summary()
messages = map(util.message_info, output.getMessages())
diff --git a/requirements.txt b/requirements.txt
index 99065b96b5b3b80ecdffc6fec3d1c9ed1682dd9c..3942920811f24a6c0c015255333e09fa7fcc29ff 100644
--- a/requirements.txt
+++ b/requirements.txt
@@ -1,4 +1,5 @@
-e git+https://github.com/LUMC/magic-python.git#egg=Magic_file_extensions
+-e git+https://github.com/LUMC/extractor.git@f270ef101e909895d58e47420935f2bbfdb28a3b#egg=extractor
Flask==0.10.1
Jinja2==2.7.3
MySQL-python==1.2.5
diff --git a/tests/test_describe.py b/tests/test_describe.py
deleted file mode 100644
index e81c7ce45bf6dbb5776326d75e3f7f410179db6d..0000000000000000000000000000000000000000
--- a/tests/test_describe.py
+++ /dev/null
@@ -1,59 +0,0 @@
-"""
-Tests for the mutalyzer.describe module.
-"""
-
-
-from __future__ import unicode_literals
-
-#import logging; logging.basicConfig()
-import os
-
-import mutalyzer
-from mutalyzer import describe
-
-from utils import MutalyzerTest
-
-
-class TestDescribe(MutalyzerTest):
- """
- Test the mytalyzer.describe module.
- """
- def test1(self):
- """
- Test 1.
- """
- result = describe.describe(
- 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
- 'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
- description = describe.alleleDescription(result)
- assert description == '[5_6insTT;17del;26A>C;35dup]'
-
- def test2(self):
- """
- Test 2.
- """
- result = describe.describe(
- 'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTACTGTG',
- 'TAAGCACCAGGAGTCCATGAAGAAGCTGGATCCTCCCATGGAATCCCCTACTCTACTGTG')
- description = describe.alleleDescription(result)
- assert description == '[26A>C;30C>A;35G>C]'
-
- def test3(self):
- """
- Test 3.
- """
- result = describe.describe(
- 'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTA',
- 'TAAGCACCAGGAGTCCATGAAGAAGCCATGTCCTGCCATGGAATCCCCTACTCTA')
- description = describe.alleleDescription(result)
- assert description == '[26_29inv;30C>G]'
-
- def test4(self):
- """
- Test 4.
- """
- result = describe.describe(
- 'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTA',
- 'TAAGCACCAGGAGTCCATGAAGAAGCCATGTCCTGCCATGAATCCCCTACTCTA')
- description = describe.alleleDescription(result)
- assert description == '[26_29inv;30C>G;41del]'
diff --git a/tests/test_services_json.py b/tests/test_services_json.py
index c405422b8beafb70f5ffefc7c21a2a4380267bf8..843ca8ea5c3340dc268c440ab0d0075188e95c4d 100644
--- a/tests/test_services_json.py
+++ b/tests/test_services_json.py
@@ -241,60 +241,60 @@ class TestServicesJson(MutalyzerTest):
r = self._call('descriptionExtract',
'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
- assert r == {'allele': [{'term': 0,
- 'end': 6,
- 'startAA': '',
+ assert r == {'allele': [{'end': 6,
'deleted': '',
- 'hgvsLength': 8,
+ 'weight': 8,
'inserted': 'TT',
'start_offset': 0,
'start': 5,
- 'hgvs': '5_6insTT',
+ 'description': '5_6insTT',
'shift': 1,
- 'endAA': '',
- 'DNA': True,
'end_offset': 0,
- 'type': 'ins'},
- {'term': 0,
- 'end': 0,
- 'startAA': '',
- 'deleted': '',
- 'hgvsLength': 4,
+ 'type': 'ins',
+ 'sample_start': 6,
+ 'sample_end': 7,
+ 'sample_start_offset': 0,
+ 'sample_end_offset': 0},
+ {'end': 17,
+ 'deleted': 'G',
+ 'weight': 7,
'inserted': '',
'start_offset': 0,
'start': 17,
- 'hgvs': '17del',
+ 'description': '17del',
'shift': 0,
- 'endAA': '',
- 'DNA': True,
'end_offset': 0,
- 'type': 'del'},
- {'term': 0,
- 'end': 0,
- 'startAA': '',
+ 'type': 'del',
+ 'sample_start': 18,
+ 'sample_end': 19,
+ 'sample_start_offset': 0,
+ 'sample_end_offset': 0},
+ {'end': 26,
'deleted': 'A',
- 'hgvsLength': 4,
+ 'weight': 3,
'inserted': 'C',
'start_offset': 0,
'start': 26,
- 'hgvs': '26A>C',
+ 'description': '26A>C',
'shift': 0,
- 'endAA': '',
- 'DNA': True,
'end_offset': 0,
- 'type': 'subst'},
- {'term': 0,
- 'end': 0,
- 'startAA': '',
+ 'type': 'subst',
+ 'sample_start': 27,
+ 'sample_end': 27,
+ 'sample_start_offset': 0,
+ 'sample_end_offset': 0},
+ {'end': 35,
'deleted': '',
- 'hgvsLength': 4,
- 'inserted': '',
+ 'weight': 5,
+ 'inserted': 'G',
'start_offset': 0,
'start': 35,
- 'hgvs': '35dup',
+ 'description': '35dup',
'shift': 1,
- 'endAA': '',
- 'DNA': True,
'end_offset': 0,
- 'type': 'dup'}],
+ 'type': 'dup',
+ 'sample_start': 37,
+ 'sample_end': 37,
+ 'sample_start_offset': 0,
+ 'sample_end_offset': 0}],
'description': '[5_6insTT;17del;26A>C;35dup]'}
diff --git a/tests/test_services_soap.py b/tests/test_services_soap.py
index df21a98fcfc0743524d17327f7e43c89942f8b15..e60470ad074841d4bc2522e3a9045f4e5c6f297c 100644
--- a/tests/test_services_soap.py
+++ b/tests/test_services_soap.py
@@ -760,59 +760,59 @@ facilisi."""
assert all(all((v_real[k] == v_expected[k]) or not(v_real[k] or v_expected[k])
for k in v_expected)
for v_real, v_expected in
- zip(r['allele'].RawVar, [{'term': 0,
- 'end': 6,
- 'startAA': '',
+ zip(r['allele'].RawVar, [{'end': 6,
'deleted': '',
- 'hgvsLength': 8,
+ 'weight': 8,
'inserted': 'TT',
'start_offset': 0,
'start': 5,
- 'hgvs': '5_6insTT',
+ 'description': '5_6insTT',
'shift': 1,
- 'endAA': '',
- 'DNA': True,
'end_offset': 0,
- 'type': 'ins'},
- {'term': 0,
- 'end': 0,
- 'startAA': '',
- 'deleted': '',
- 'hgvsLength': 4,
+ 'type': 'ins',
+ 'sample_start': 6,
+ 'sample_end': 7,
+ 'sample_start_offset': 0,
+ 'sample_end_offset': 0},
+ {'end': 17,
+ 'deleted': 'G',
+ 'weight': 7,
'inserted': '',
'start_offset': 0,
'start': 17,
- 'hgvs': '17del',
+ 'description': '17del',
'shift': 0,
- 'endAA': '',
- 'DNA': True,
'end_offset': 0,
- 'type': 'del'},
- {'term': 0,
- 'end': 0,
- 'startAA': '',
+ 'type': 'del',
+ 'sample_start': 18,
+ 'sample_end': 19,
+ 'sample_start_offset': 0,
+ 'sample_end_offset': 0},
+ {'end': 26,
'deleted': 'A',
- 'hgvsLength': 4,
+ 'weight': 3,
'inserted': 'C',
'start_offset': 0,
'start': 26,
- 'hgvs': '26A>C',
+ 'description': '26A>C',
'shift': 0,
- 'endAA': '',
- 'DNA': True,
'end_offset': 0,
- 'type': 'subst'},
- {'term': 0,
- 'end': 0,
- 'startAA': '',
+ 'type': 'subst',
+ 'sample_start': 27,
+ 'sample_end': 27,
+ 'sample_start_offset': 0,
+ 'sample_end_offset': 0},
+ {'end': 35,
'deleted': '',
- 'hgvsLength': 4,
- 'inserted': '',
+ 'weight': 5,
+ 'inserted': 'G',
'start_offset': 0,
'start': 35,
- 'hgvs': '35dup',
+ 'description': '35dup',
'shift': 1,
- 'endAA': '',
- 'DNA': True,
'end_offset': 0,
- 'type': 'dup'}]))
+ 'type': 'dup',
+ 'sample_start': 37,
+ 'sample_end': 37,
+ 'sample_start_offset': 0,
+ 'sample_end_offset': 0}]))