From e6f19d1cd7b274095505020bf0d5093c4a752e74 Mon Sep 17 00:00:00 2001
From: Martijn Vermaat <martijn@vermaat.name>
Date: Mon, 21 Jul 2014 15:03:26 +0200
Subject: [PATCH] Move from nose to pytest for unit tests
See http://pytest.org/
---
doc/development.rst | 4 +-
doc/install.rst | 10 +-
requirements.txt | 2 +-
tests/test_crossmap.py | 217 +++++++++++----------
tests/test_describe.py | 9 +-
tests/test_grammar.py | 3 +-
tests/test_mapping.py | 47 +++--
tests/test_mutator.py | 261 +++++++++++++------------
tests/test_parsers_genbank.py | 3 +-
tests/test_scheduler.py | 8 +-
tests/test_services_json.py | 17 +-
tests/test_services_soap.py | 212 ++++++++++----------
tests/test_variantchecker.py | 351 ++++++++++++++--------------------
tests/test_website.py | 35 ++--
14 files changed, 546 insertions(+), 633 deletions(-)
diff --git a/doc/development.rst b/doc/development.rst
index 310a3a62..315db3c8 100644
--- a/doc/development.rst
+++ b/doc/development.rst
@@ -27,7 +27,7 @@ In general, try to follow the `PEP 8`_ guidelines for Python code and `PEP
Unit tests
----------
-To run the unit tests with `nose`_, just run ``nosetests -v``.
+To run the unit tests with `pytest`_, just run ``py.test``.
Working with feature branches
@@ -128,7 +128,7 @@ Releasing a new version is done as follows:
git commit -am 'Open development for X.Y.Z+1'
-.. _nose: https://nose.readthedocs.org/
+.. _pytest: http://pytest.org/
.. _PEP 8: http://www.python.org/dev/peps/pep-0008/
.. _PEP 257: http://www.python.org/dev/peps/pep-0257/
.. _SemVer: http://semver.org/
diff --git a/doc/install.rst b/doc/install.rst
index a3444dc4..ab615afb 100644
--- a/doc/install.rst
+++ b/doc/install.rst
@@ -103,11 +103,7 @@ install all required Python packages::
$ sudo apt-get install python-dev libmysqlclient-dev libxml2-dev libxslt-dev
$ pip install -r requirements.txt
-Now might be a good time to run the unit tests::
-
- $ nosetests -v
-
-If everything's okay, install Mutalyzer::
+Install Mutalyzer::
$ python setup.py install
@@ -120,6 +116,10 @@ If everything's okay, install Mutalyzer::
only links from the installation directory to the source code such that
any changes you make to it are directly available in the environment.
+Now might be a good time to run the unit tests::
+
+ $ py.test
+
.. seealso::
`virtualenv`_
diff --git a/requirements.txt b/requirements.txt
index 1add561a..dc3e7ac8 100644
--- a/requirements.txt
+++ b/requirements.txt
@@ -1,7 +1,7 @@
MySQL-python==1.2.5
biopython==1.63
lxml==3.3.3
-nose==1.3.0
+pytest==2.6.1
pyparsing==2.0.1
pytz==2013.9
requests==2.2.1
diff --git a/tests/test_crossmap.py b/tests/test_crossmap.py
index d1500999..ff9d6d75 100644
--- a/tests/test_crossmap.py
+++ b/tests/test_crossmap.py
@@ -4,7 +4,6 @@ Tests for the Crossmap module.
#import logging; logging.basicConfig()
-from nose.tools import *
from mutalyzer.Crossmap import Crossmap
@@ -24,9 +23,9 @@ class TestCrossmap(MutalyzerTest):
103528, 119465, 119537, 144687, 144810, 148418, 149215]
cds = [27925, 74736]
cm = Crossmap(rna, cds, 1)
- assert_equal(cm._Crossmap__crossmapping,
- [-304, -181, -180, 15, 16, 117, 118, 205, 206, 325, 326,
- 398, 399, 522, 523, 1320])
+ assert (cm._Crossmap__crossmapping ==
+ [-304, -181, -180, 15, 16, 117, 118, 205, 206, 325, 326, 398,
+ 399, 522, 523, 1320])
def test_splice_sites_reverse(self):
"""
@@ -37,9 +36,9 @@ class TestCrossmap(MutalyzerTest):
76535, 92453, 92554, 123276, 123470, 146090, 146213]
cds = [76479, 123290]
cm = Crossmap(rna, cds, -1)
- assert_equal(cm._Crossmap__crossmapping,
- [1320, 523, 522, 399, 398, 326, 325, 206, 205, 118, 117,
- 16, 15, -180, -181, -304])
+ assert (cm._Crossmap__crossmapping ==
+ [1320, 523, 522, 399, 398, 326, 325, 206, 205, 118, 117, 16,
+ 15, -180, -181, -304])
def test_g2x(self):
"""
@@ -51,20 +50,20 @@ class TestCrossmap(MutalyzerTest):
cds = [27925, 74736]
cm = Crossmap(rna, cds, 1)
# Fix for r536: disable the -u and +d convention.
- #assert_equal(cm.tuple2string(cm.g2x(5001)), '-304-u1')
- assert_equal(cm.tuple2string(cm.g2x(5001)), '-305')
- assert_equal(cm.tuple2string(cm.g2x(5124)), '-182')
- assert_equal(cm.tuple2string(cm.g2x(5126)), '-181+1')
- assert_equal(cm.tuple2string(cm.g2x(27924)), '-1')
- assert_equal(cm.tuple2string(cm.g2x(27925)), '1')
- assert_equal(cm.tuple2string(cm.g2x(58660)), '16-1')
- assert_equal(cm.tuple2string(cm.g2x(74736)), '174')
- assert_equal(cm.tuple2string(cm.g2x(74737)), '*1')
- assert_equal(cm.tuple2string(cm.g2x(103408)), '*32-1')
- assert_equal(cm.tuple2string(cm.g2x(103410)), '*33')
+ #assert cm.tuple2string(cm.g2x(5001)) == '-304-u1'
+ assert cm.tuple2string(cm.g2x(5001)) == '-305'
+ assert cm.tuple2string(cm.g2x(5124)) == '-182'
+ assert cm.tuple2string(cm.g2x(5126)) == '-181+1'
+ assert cm.tuple2string(cm.g2x(27924)) == '-1'
+ assert cm.tuple2string(cm.g2x(27925)) == '1'
+ assert cm.tuple2string(cm.g2x(58660)) == '16-1'
+ assert cm.tuple2string(cm.g2x(74736)) == '174'
+ assert cm.tuple2string(cm.g2x(74737)) == '*1'
+ assert cm.tuple2string(cm.g2x(103408)) == '*32-1'
+ assert cm.tuple2string(cm.g2x(103410)) == '*33'
# Fix for r536: disable the -u and +d convention.
- #assert_equal(cm.tuple2string(cm.g2x(149216)), '*1146+d1')
- assert_equal(cm.tuple2string(cm.g2x(149216)), '*1147')
+ #assert cm.tuple2string(cm.g2x(149216)) == '*1146+d1'
+ assert cm.tuple2string(cm.g2x(149216)) == '*1147'
def test_g2x_reverse(self):
"""
@@ -76,20 +75,20 @@ class TestCrossmap(MutalyzerTest):
cds = [76479, 123290]
cm = Crossmap(rna, cds, -1)
# Fix for r536: disable the -u and +d convention.
- #assert_equal(cm.tuple2string(cm.g2x(146214)), '-304-u1')
- assert_equal(cm.tuple2string(cm.g2x(146214)), '-305')
- assert_equal(cm.tuple2string(cm.g2x(146091)), '-182')
- assert_equal(cm.tuple2string(cm.g2x(146089)), '-181+1')
- assert_equal(cm.tuple2string(cm.g2x(123291)), '-1')
- assert_equal(cm.tuple2string(cm.g2x(123290)), '1')
- assert_equal(cm.tuple2string(cm.g2x(92555)), '16-1')
- assert_equal(cm.tuple2string(cm.g2x(76479)), '174')
- assert_equal(cm.tuple2string(cm.g2x(76478)), '*1')
- assert_equal(cm.tuple2string(cm.g2x(47807)), '*32-1')
- assert_equal(cm.tuple2string(cm.g2x(47805)), '*33')
+ #assert cm.tuple2string(cm.g2x(146214)) == '-304-u1'
+ assert cm.tuple2string(cm.g2x(146214)) == '-305'
+ assert cm.tuple2string(cm.g2x(146091)) == '-182'
+ assert cm.tuple2string(cm.g2x(146089)) == '-181+1'
+ assert cm.tuple2string(cm.g2x(123291)) == '-1'
+ assert cm.tuple2string(cm.g2x(123290)) == '1'
+ assert cm.tuple2string(cm.g2x(92555)) == '16-1'
+ assert cm.tuple2string(cm.g2x(76479)) == '174'
+ assert cm.tuple2string(cm.g2x(76478)) == '*1'
+ assert cm.tuple2string(cm.g2x(47807)) == '*32-1'
+ assert cm.tuple2string(cm.g2x(47805)) == '*33'
# Fix for r536: disable the -u and +d convention.
- #assert_equal(cm.tuple2string(cm.g2x(1999)), '*1146+d1')
- assert_equal(cm.tuple2string(cm.g2x(1999)), '*1147')
+ #assert cm.tuple2string(cm.g2x(1999)) == '*1146+d1'
+ assert cm.tuple2string(cm.g2x(1999)) == '*1147'
def test_x2g_more(self):
"""
@@ -100,17 +99,17 @@ class TestCrossmap(MutalyzerTest):
103528, 119465, 119537, 144687, 144810, 148418, 149215]
cds = [27925, 74736]
cm = Crossmap(rna, cds, 1)
- assert_equal(cm.x2g(-304, -1), 5001)
- assert_equal(cm.x2g(-182, 0), 5124)
- assert_equal(cm.x2g(-181, 1), 5126)
- assert_equal(cm.x2g(-1, 0), 27924)
- assert_equal(cm.x2g(1, 0), 27925)
- assert_equal(cm.x2g(16, -1), 58660)
- assert_equal(cm.x2g(174, 0), 74736)
- assert_equal(cm.x2g(cm.main2int('*1'), 0), 74737)
- assert_equal(cm.x2g(cm.main2int('*32'), -1), 103408)
- assert_equal(cm.x2g(cm.main2int('*33'), 0), 103410)
- assert_equal(cm.x2g(cm.main2int('*1146'), 1), 149216)
+ assert cm.x2g(-304, -1) == 5001
+ assert cm.x2g(-182, 0) == 5124
+ assert cm.x2g(-181, 1) == 5126
+ assert cm.x2g(-1, 0) == 27924
+ assert cm.x2g(1, 0) == 27925
+ assert cm.x2g(16, -1) == 58660
+ assert cm.x2g(174, 0) == 74736
+ assert cm.x2g(cm.main2int('*1'), 0) == 74737
+ assert cm.x2g(cm.main2int('*32'), -1) == 103408
+ assert cm.x2g(cm.main2int('*33'), 0) == 103410
+ assert cm.x2g(cm.main2int('*1146'), 1) == 149216
def test_x2g_more_reverse(self):
"""
@@ -121,17 +120,17 @@ class TestCrossmap(MutalyzerTest):
76535, 92453, 92554, 123276, 123470, 146090, 146213]
cds = [76479, 123290]
cm = Crossmap(rna, cds, -1)
- assert_equal(cm.x2g(-304, -1), 146214)
- assert_equal(cm.x2g(-182, 0), 146091)
- assert_equal(cm.x2g(-181, 1), 146089)
- assert_equal(cm.x2g(-1, 0), 123291)
- assert_equal(cm.x2g(1, 0), 123290)
- assert_equal(cm.x2g(16, -1), 92555)
- assert_equal(cm.x2g(174, 0), 76479)
- assert_equal(cm.x2g(cm.main2int('*1'), 0), 76478)
- assert_equal(cm.x2g(cm.main2int('*32'), -1), 47807)
- assert_equal(cm.x2g(cm.main2int('*33'), 0), 47805)
- assert_equal(cm.x2g(cm.main2int('*1146'), 1), 1999)
+ assert cm.x2g(-304, -1) == 146214
+ assert cm.x2g(-182, 0) == 146091
+ assert cm.x2g(-181, 1) == 146089
+ assert cm.x2g(-1, 0) == 123291
+ assert cm.x2g(1, 0) == 123290
+ assert cm.x2g(16, -1) == 92555
+ assert cm.x2g(174, 0) == 76479
+ assert cm.x2g(cm.main2int('*1'), 0) == 76478
+ assert cm.x2g(cm.main2int('*32'), -1) == 47807
+ assert cm.x2g(cm.main2int('*33'), 0) == 47805
+ assert cm.x2g(cm.main2int('*1146'), 1) == 1999
def test_g2x_missing_exons(self):
"""
@@ -145,7 +144,7 @@ class TestCrossmap(MutalyzerTest):
cds = [27925, 74736]
cm1 = Crossmap(rna1, cds, 1)
cm2 = Crossmap(rna2, cds, 1)
- assert_equal(cm1.g2x(27925), cm2.g2x(27925))
+ assert cm1.g2x(27925) == cm2.g2x(27925)
def test_g2x_missing_exons_reverse(self):
"""
@@ -160,7 +159,7 @@ class TestCrossmap(MutalyzerTest):
cds = [76479, 123290]
cm1 = Crossmap(rna1, cds, -1)
cm2 = Crossmap(rna2, cds, -1)
- assert_equal(cm1.g2x(123290), cm2.g2x(123290))
+ assert cm1.g2x(123290) == cm2.g2x(123290)
def test_splice_sites_noncoding(self):
"""
@@ -170,9 +169,9 @@ class TestCrossmap(MutalyzerTest):
rna = [5002, 5125, 27745, 27939, 58661, 58762, 74680, 74767, 103409,
103528, 119465, 119537, 144687, 144810, 148418, 149215]
cm = Crossmap(rna, [], 1)
- assert_equal(cm._Crossmap__crossmapping,
- [1, 124, 125, 319, 320, 421, 422, 509, 510, 629, 630,
- 702, 703, 826, 827, 1624])
+ assert (cm._Crossmap__crossmapping ==
+ [1, 124, 125, 319, 320, 421, 422, 509, 510, 629, 630, 702,
+ 703, 826, 827, 1624])
def test_splice_sites_noncoding_reverse(self):
"""
@@ -182,9 +181,9 @@ class TestCrossmap(MutalyzerTest):
rna = [2000, 2797, 6405, 6528, 31678, 31750, 47687, 47806, 76448,
76535, 92453, 92554, 123276, 123470, 146090, 146213]
cm = Crossmap(rna, [], -1)
- assert_equal(cm._Crossmap__crossmapping,
- [1624, 827, 826, 703, 702, 630, 629, 510, 509, 422, 421,
- 320, 319, 125, 124, 1])
+ assert (cm._Crossmap__crossmapping ==
+ [1624, 827, 826, 703, 702, 630, 629, 510, 509, 422, 421, 320,
+ 319, 125, 124, 1])
def test_g2x_noncoding(self):
"""
@@ -195,13 +194,13 @@ class TestCrossmap(MutalyzerTest):
103528, 119465, 119537, 144687, 144810, 148418, 149215]
cm = Crossmap(rna, [], 1)
# Fix for r536: disable the -u and +d convention.
- #assert_equal(cm.tuple2string(cm.g2x(5001)), '1-u1')
- assert_equal(cm.tuple2string(cm.g2x(5001)), '-1')
- assert_equal(cm.tuple2string(cm.g2x(5002)), '1')
- assert_equal(cm.tuple2string(cm.g2x(5126)), '124+1')
+ #assert cm.tuple2string(cm.g2x(5001)) == '1-u1'
+ assert cm.tuple2string(cm.g2x(5001)) == '-1'
+ assert cm.tuple2string(cm.g2x(5002)) == '1'
+ assert cm.tuple2string(cm.g2x(5126)) == '124+1'
# Fix for r536: disable the -u and +d convention.
- #assert_equal(cm.tuple2string(cm.g2x(149216)), '1624+d1')
- assert_equal(cm.tuple2string(cm.g2x(149216)), '*1')
+ #assert cm.tuple2string(cm.g2x(149216)) == '1624+d1'
+ assert cm.tuple2string(cm.g2x(149216)) == '*1'
def test_g2x_noncoding_reverse(self):
"""
@@ -212,13 +211,13 @@ class TestCrossmap(MutalyzerTest):
76535, 92453, 92554, 123276, 123470, 146090, 146213]
cm = Crossmap(rna, [], -1)
# Fix for r536: disable the -u and +d convention.
- #assert_equal(cm.tuple2string(cm.g2x(146214)), '1-u1')
- assert_equal(cm.tuple2string(cm.g2x(146214)), '-1')
- assert_equal(cm.tuple2string(cm.g2x(146213)), '1')
- assert_equal(cm.tuple2string(cm.g2x(146089)), '124+1')
+ #assert cm.tuple2string(cm.g2x(146214)) == '1-u1'
+ assert cm.tuple2string(cm.g2x(146214)) == '-1'
+ assert cm.tuple2string(cm.g2x(146213)) == '1'
+ assert cm.tuple2string(cm.g2x(146089)) == '124+1'
# Fix for r536: disable the -u and +d convention.
- #assert_equal(cm.tuple2string(cm.g2x(1999)), '1624+d1')
- assert_equal(cm.tuple2string(cm.g2x(1999)), '*1')
+ #assert cm.tuple2string(cm.g2x(1999)) == '1624+d1'
+ assert cm.tuple2string(cm.g2x(1999)) == '*1'
def test_x2g_noncoding(self):
"""
@@ -228,10 +227,10 @@ class TestCrossmap(MutalyzerTest):
rna = [5002, 5125, 27745, 27939, 58661, 58762, 74680, 74767, 103409,
103528, 119465, 119537, 144687, 144810, 148418, 149215]
cm = Crossmap(rna, [], 1)
- assert_equal(cm.x2g(1, -1), 5001)
- assert_equal(cm.x2g(1, 0), 5002)
- assert_equal(cm.x2g(124, 1), 5126)
- assert_equal(cm.x2g(1624, 1), 149216)
+ assert cm.x2g(1, -1) == 5001
+ assert cm.x2g(1, 0) == 5002
+ assert cm.x2g(124, 1) == 5126
+ assert cm.x2g(1624, 1) == 149216
def test_x2g_noncoding_reverse(self):
"""
@@ -241,10 +240,10 @@ class TestCrossmap(MutalyzerTest):
rna = [2000, 2797, 6405, 6528, 31678, 31750, 47687, 47806, 76448,
76535, 92453, 92554, 123276, 123470, 146090, 146213]
cm = Crossmap(rna, [], -1)
- assert_equal(cm.x2g(1, -1), 146214)
- assert_equal(cm.x2g(1, 0), 146213)
- assert_equal(cm.x2g(124, 1), 146089)
- assert_equal(cm.x2g(1624, 1), 1999)
+ assert cm.x2g(1, -1) == 146214
+ assert cm.x2g(1, 0) == 146213
+ assert cm.x2g(124, 1) == 146089
+ assert cm.x2g(1624, 1) == 1999
def test_cds_one_exon(self):
"""
@@ -253,10 +252,10 @@ class TestCrossmap(MutalyzerTest):
rna = [1, 80, 81, 3719]
cds = [162, 2123]
cm = Crossmap(rna, cds, 1)
- assert_equal(cm._Crossmap__crossmapping, [-161, -82, -81, 3558])
- assert_equal(cm.x2g(1, 0), 162)
- assert_equal(cm.tuple2string(cm.g2x(2123)), '1962')
- assert_equal(cm.tuple2string(cm.g2x(2124)), '*1')
+ assert cm._Crossmap__crossmapping == [-161, -82, -81, 3558]
+ assert cm.x2g(1, 0) == 162
+ assert cm.tuple2string(cm.g2x(2123)) == '1962'
+ assert cm.tuple2string(cm.g2x(2124)) == '*1'
def test_cds_start_on_splice_site(self):
"""
@@ -267,15 +266,15 @@ class TestCrossmap(MutalyzerTest):
23894775, 23894899, 23898506, 23899304]
cds = [23777833, 23898680]
cm = Crossmap(rna, cds, 1)
- assert_equal(cm._Crossmap__crossmapping,
- [-156, -1, 1, 196, 197, 299, 300, 388, 389, 509, 510,
- 583, 584, 708, 709, 1507])
- assert_equal(cm.x2g(1, 0), 23777833)
+ assert (cm._Crossmap__crossmapping ==
+ [-156, -1, 1, 196, 197, 299, 300, 388, 389, 509, 510, 583,
+ 584, 708, 709, 1507])
+ assert cm.x2g(1, 0) == 23777833
# Fix for r536: disable the -u and +d convention.
- #assert_equal(cm.tuple2string(cm.g2x(2123)), '-156-u23752936')
- #assert_equal(cm.tuple2string(cm.g2x(2124)), '-156-u23752935')
- assert_equal(cm.tuple2string(cm.g2x(2123)), '-23753092')
- assert_equal(cm.tuple2string(cm.g2x(2124)), '-23753091')
+ #assert cm.tuple2string(cm.g2x(2123)) == '-156-u23752936'
+ #assert cm.tuple2string(cm.g2x(2124)) == '-156-u23752935'
+ assert cm.tuple2string(cm.g2x(2123)) == '-23753092'
+ assert cm.tuple2string(cm.g2x(2124)) == '-23753091'
def test_cds_start_on_splice_site_reverse(self):
"""
@@ -287,9 +286,9 @@ class TestCrossmap(MutalyzerTest):
23898506, 23899304]
cds = [23755214, 23778028]
cm = Crossmap(rna, cds, -1)
- assert_equal(cm._Crossmap__crossmapping,
- [196, 1, -1, -103, -104, -192, -193, -313, -314, -387,
- -388, -512, -513, -1311])
+ assert (cm._Crossmap__crossmapping ==
+ [196, 1, -1, -103, -104, -192, -193, -313, -314, -387, -388,
+ -512, -513, -1311])
def test_cds_start_on_splice_site_other(self):
"""
@@ -300,9 +299,9 @@ class TestCrossmap(MutalyzerTest):
23894775, 23894899, 23898506, 23899304]
cds = [23755214, 23898680]
cm = Crossmap(rna, cds, 1)
- assert_equal(cm._Crossmap__crossmapping,
- [-155, 1, 2, 197, 198, 300, 301, 389, 390, 510, 511, 584,
- 585, 709, 710, 1508])
+ assert (cm._Crossmap__crossmapping ==
+ [-155, 1, 2, 197, 198, 300, 301, 389, 390, 510, 511, 584, 585,
+ 709, 710, 1508])
def test_cds_start_on_splice_site_other_reverse(self):
"""
@@ -314,9 +313,9 @@ class TestCrossmap(MutalyzerTest):
23898506, 23899304]
cds = [23755214, 23808749]
cm = Crossmap(rna, cds, -1)
- assert_equal(cm._Crossmap__crossmapping,
- [197, 2, 1, -102, -103, -191, -192, -312, -313, -386,
- -387, -511, -512, -1310])
+ assert (cm._Crossmap__crossmapping ==
+ [197, 2, 1, -102, -103, -191, -192, -312, -313, -386, -387,
+ -511, -512, -1310])
def test_cds_start_on_transcript_start(self):
"""
@@ -328,7 +327,7 @@ class TestCrossmap(MutalyzerTest):
23898506, 23899304]
cds = [23777833, 23899304]
cm = Crossmap(rna, cds, 1)
- assert_equal(cm.x2g(-1, 0), cm.x2g(1, -1))
+ assert cm.x2g(-1, 0) == cm.x2g(1, -1)
def test_cds_start_on_transcript_start_reverse(self):
"""
@@ -340,7 +339,7 @@ class TestCrossmap(MutalyzerTest):
23898506, 23899304]
cds = [23777833, 23899304]
cm = Crossmap(rna, cds, -1)
- assert_equal(cm.x2g(-1, 0), cm.x2g(1, -1))
+ assert cm.x2g(-1, 0) == cm.x2g(1, -1)
def test_cds_is_exon(self):
"""
@@ -349,8 +348,7 @@ class TestCrossmap(MutalyzerTest):
rna = [27745, 27939, 58661, 58762, 74680, 74767]
cds = [58661, 58762]
cm = Crossmap(rna, cds, 1)
- assert_equal(cm._Crossmap__crossmapping,
- [-195, -1, 1, 102, 103, 190])
+ assert cm._Crossmap__crossmapping == [-195, -1, 1, 102, 103, 190]
def test_cds_is_exon_reverse(self):
"""
@@ -359,5 +357,4 @@ class TestCrossmap(MutalyzerTest):
rna = [27745, 27939, 58661, 58762, 74680, 74767]
cds = [58661, 58762]
cm = Crossmap(rna, cds, -1)
- assert_equal(cm._Crossmap__crossmapping,
- [297, 103, 102, 1, -1, -88])
+ assert cm._Crossmap__crossmapping == [297, 103, 102, 1, -1, -88]
diff --git a/tests/test_describe.py b/tests/test_describe.py
index 8a7967a2..8315213e 100644
--- a/tests/test_describe.py
+++ b/tests/test_describe.py
@@ -5,7 +5,6 @@ Tests for the mutalyzer.describe module.
#import logging; logging.basicConfig()
import os
-from nose.tools import *
import mutalyzer
from mutalyzer import describe
@@ -25,7 +24,7 @@ class TestDescribe(MutalyzerTest):
'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
description = describe.alleleDescription(result)
- assert_equal(description, '[5_6insTT;17del;26A>C;35dup]')
+ assert description == '[5_6insTT;17del;26A>C;35dup]'
def test2(self):
"""
@@ -35,7 +34,7 @@ class TestDescribe(MutalyzerTest):
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTACTGTG',
'TAAGCACCAGGAGTCCATGAAGAAGCTGGATCCTCCCATGGAATCCCCTACTCTACTGTG')
description = describe.alleleDescription(result)
- assert_equal(description, '[26A>C;30C>A;35G>C]')
+ assert description == '[26A>C;30C>A;35G>C]'
def test3(self):
"""
@@ -45,7 +44,7 @@ class TestDescribe(MutalyzerTest):
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTA',
'TAAGCACCAGGAGTCCATGAAGAAGCCATGTCCTGCCATGGAATCCCCTACTCTA')
description = describe.alleleDescription(result)
- assert_equal(description, '[26_29inv;30C>G]')
+ assert description == '[26_29inv;30C>G]'
def test4(self):
"""
@@ -55,4 +54,4 @@ class TestDescribe(MutalyzerTest):
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTA',
'TAAGCACCAGGAGTCCATGAAGAAGCCATGTCCTGCCATGAATCCCCTACTCTA')
description = describe.alleleDescription(result)
- assert_equal(description, '[26_29inv;30C>G;41del]')
+ assert description == '[26_29inv;30C>G;41del]'
diff --git a/tests/test_grammar.py b/tests/test_grammar.py
index 4c4d6f09..1ebaa399 100644
--- a/tests/test_grammar.py
+++ b/tests/test_grammar.py
@@ -5,7 +5,6 @@ Tests for the mutalyzer.grammar module.
#import logging; logging.basicConfig()
import os
-from nose.tools import *
import mutalyzer
from mutalyzer.grammar import Grammar
@@ -28,7 +27,7 @@ class TestGrammar(MutalyzerTest):
Parse a variant description.
"""
self.grammar.parse(description)
- assert_equal(self.output.getOutput('parseError'), [])
+ assert self.output.getOutput('parseError') == []
def test_some_variants(self):
"""
diff --git a/tests/test_mapping.py b/tests/test_mapping.py
index 3acb53cb..5ebdc60e 100644
--- a/tests/test_mapping.py
+++ b/tests/test_mapping.py
@@ -4,7 +4,6 @@ Tests for the mapping module.
#import logging; logging.basicConfig()
-from nose.tools import *
from sqlalchemy import or_
from mutalyzer.db.models import Assembly
@@ -41,7 +40,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_003002.2:c.274G>T')
- assert_equal(genomic, 'NC_000011.9:g.111959695G>T')
+ assert genomic == 'NC_000011.9:g.111959695G>T'
coding = converter.chrom2c(genomic, 'list')
assert 'NM_003002.2:c.274G>T' in coding
# Fix for r536: disable the -u and +d convention.
@@ -54,7 +53,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NR_028383.1:n.-2173C>A')
- assert_equal(genomic, 'NC_000011.9:g.111959695G>T')
+ assert genomic == 'NC_000011.9:g.111959695G>T'
coding = converter.chrom2c(genomic, 'list')
assert 'NM_003002.2:c.274G>T' in coding
# Fix for r536: disable the -u and +d convention.
@@ -67,7 +66,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_003002.2:c.[274G>T;278A>G]')
- assert_equal(genomic, 'NC_000011.9:g.[111959695G>T;111959699A>G]')
+ assert genomic == 'NC_000011.9:g.[111959695G>T;111959699A>G]'
coding = converter.chrom2c(genomic, 'list')
assert 'NM_003002.2:c.[274G>T;278A>G]' in coding
assert 'NR_028383.1:n.[-2173C>A;-2177T>C]' in coding
@@ -88,7 +87,7 @@ class TestConverter(MutalyzerTest):
# investigated really).
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_000500.5:c.92C>T')
- assert_equal(genomic, 'NC_000006.11:g.32006291C>T')
+ assert genomic == 'NC_000006.11:g.32006291C>T'
coding = converter.chrom2c(genomic, 'list')
assert 'NM_000500.5:c.92C>T' in coding
@@ -136,7 +135,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_003002.2:c.-1_274del')
- assert_equal(genomic, 'NC_000011.9:g.111957631_111959695del')
+ assert genomic == 'NC_000011.9:g.111957631_111959695del'
coding = converter.chrom2c(genomic, 'list')
assert 'NM_003002.2:c.-1_274del' in coding
@@ -146,9 +145,9 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_003002.2:c.274_-1del')
- assert_equal(genomic, None)
+ assert genomic == None
erange = self.output.getMessagesWithErrorCode('ERANGE')
- assert_equal(len(erange), 1)
+ assert len(erange) == 1
def test_range_order_reverse_correct(self):
"""
@@ -157,7 +156,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_001162505.1:c.-1_40del')
- assert_equal(genomic, 'NC_000020.10:g.48770135_48770175del')
+ assert genomic == 'NC_000020.10:g.48770135_48770175del'
coding = converter.chrom2c(genomic, 'list')
assert 'NM_001162505.1:c.-1_40del' in coding
@@ -167,9 +166,9 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_001162505.1:c.40_-1del')
- assert_equal(genomic, None)
+ assert genomic == None
erange = self.output.getMessagesWithErrorCode('ERANGE')
- assert_equal(len(erange), 1)
+ assert len(erange) == 1
def test_range_order_incorrect_chrom2c(self):
"""
@@ -177,9 +176,9 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
coding = converter.chrom2c('NC_000011.9:g.111959695_111957631del', 'list')
- assert_equal(coding, None)
+ assert coding == None
erange = self.output.getMessagesWithErrorCode('ERANGE')
- assert_equal(len(erange), 1)
+ assert len(erange) == 1
def test_delins_large_ins_c2chrom(self):
"""
@@ -187,7 +186,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_003002.2:c.274delinsTAAA')
- assert_equal(genomic, 'NC_000011.9:g.111959695delinsTAAA')
+ assert genomic == 'NC_000011.9:g.111959695delinsTAAA'
coding = converter.chrom2c(genomic, 'list')
assert 'NM_003002.2:c.274delinsTAAA' in coding
@@ -197,7 +196,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_003002.2:c.274delGinsTAAA')
- assert_equal(genomic, 'NC_000011.9:g.111959695delinsTAAA')
+ assert genomic == 'NC_000011.9:g.111959695delinsTAAA'
coding = converter.chrom2c(genomic, 'list')
assert 'NM_003002.2:c.274delinsTAAA' in coding
@@ -240,7 +239,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NC_012920.1(ND4_v001):c.1271del')
- assert_equal(genomic, 'NC_012920.1:m.12030del')
+ assert genomic == 'NC_012920.1:m.12030del'
def test_nm_without_selector_chrom2c(self):
"""
@@ -248,7 +247,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_017780.2:c.109A>T')
- assert_equal(genomic, 'NC_000008.10:g.61654100A>T')
+ assert genomic == 'NC_000008.10:g.61654100A>T'
def test_nm_with_selector_chrom2c(self):
"""
@@ -256,7 +255,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_017780.2(CHD7_v001):c.109A>T')
- assert_equal(genomic, 'NC_000008.10:g.61654100A>T')
+ assert genomic == 'NC_000008.10:g.61654100A>T'
def test_nm_c2chrom_no_selector(self):
"""
@@ -274,7 +273,7 @@ class TestConverter(MutalyzerTest):
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_017780.2(CHD8):c.109A>T')
erange = self.output.getMessagesWithErrorCode('EACCNOTINDB')
- assert_equal(len(erange), 1)
+ assert len(erange) == 1
def test_incorrect_selector_version_c2chrom(self):
"""
@@ -283,7 +282,7 @@ class TestConverter(MutalyzerTest):
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_017780.2(CHD7_v002):c.109A>T')
erange = self.output.getMessagesWithErrorCode('EACCNOTINDB')
- assert_equal(len(erange), 1)
+ assert len(erange) == 1
def test_no_selector_version_c2chrom(self):
"""
@@ -291,7 +290,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_017780.2(CHD7):c.109A>T')
- assert_equal(genomic, 'NC_000008.10:g.61654100A>T')
+ assert genomic == 'NC_000008.10:g.61654100A>T'
def test_incorrect_selector_no_selector_version_c2chrom(self):
"""
@@ -300,7 +299,7 @@ class TestConverter(MutalyzerTest):
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_017780.2(CHD8):c.109A>T')
erange = self.output.getMessagesWithErrorCode('EACCNOTINDB')
- assert_equal(len(erange), 1)
+ assert len(erange) == 1
def test_ins_seq_chrom2c(self):
"""
@@ -326,7 +325,7 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_012459.2:c.10_11insATC')
- assert_equal(genomic, 'NC_000011.9:g.111957482_111957483insGAT')
+ assert genomic == 'NC_000011.9:g.111957482_111957483insGAT'
def test_ins_seq_seq_c2chrom_reverse(self):
"""
@@ -334,4 +333,4 @@ class TestConverter(MutalyzerTest):
"""
converter = self._converter('hg19')
genomic = converter.c2chrom('NM_012459.2:c.10_11ins[TTT;ATC]')
- assert_equal(genomic, 'NC_000011.9:g.111957482_111957483ins[GAT;AAA]')
+ assert genomic == 'NC_000011.9:g.111957482_111957483ins[GAT;AAA]'
diff --git a/tests/test_mutator.py b/tests/test_mutator.py
index 43117c69..36c5b8d1 100644
--- a/tests/test_mutator.py
+++ b/tests/test_mutator.py
@@ -7,7 +7,6 @@ Tests for the mutalyzer.mutator module.
import re
import os
import random
-from nose.tools import *
from Bio.Seq import Seq
import mutalyzer
@@ -49,7 +48,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(_seq(l))
# Numbering is 1-based
for i in range(1, l + 1):
- assert_equal(m.shift(i), i)
+ assert m.shift(i) == i
def test_shift_del_example(self):
"""
@@ -57,9 +56,9 @@ class TestMutator(MutalyzerTest):
"""
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 2)
- assert_equal(m.shift(1), 1)
- assert_equal(m.shift(2), 2)
- assert_equal(m.shift(3), 2)
+ assert m.shift(1) == 1
+ assert m.shift(2) == 2
+ assert m.shift(3) == 2
def test_shift_del(self):
"""
@@ -70,9 +69,9 @@ class TestMutator(MutalyzerTest):
m = self._mutator(_seq(l))
m.deletion(d, d)
for p in range(1, d + 1):
- assert_equal(m.shift(p), p)
+ assert m.shift(p) == p
for p in range(d + 1, l + 1):
- assert_equal(m.shift(p), p - 1)
+ assert m.shift(p) == p - 1
def test_shift_del2(self):
"""
@@ -83,9 +82,9 @@ class TestMutator(MutalyzerTest):
m = self._mutator(_seq(l))
m.deletion(d, d + 1)
for p in range(1, d + 2):
- assert_equal(m.shift(p), p)
+ assert m.shift(p) == p
for p in range(d + 2, l + 1):
- assert_equal(m.shift(p), p - 2)
+ assert m.shift(p) == p - 2
def test_shift_ins_example(self):
"""
@@ -93,9 +92,9 @@ class TestMutator(MutalyzerTest):
"""
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'A')
- assert_equal(m.shift(1), 1)
- assert_equal(m.shift(2), 2)
- assert_equal(m.shift(3), 4)
+ assert m.shift(1) == 1
+ assert m.shift(2) == 2
+ assert m.shift(3) == 4
def test_shift_ins(self):
"""
@@ -106,9 +105,9 @@ class TestMutator(MutalyzerTest):
m = self._mutator(_seq(l))
m.insertion(i, 'T')
for p in range(1, i + 1):
- assert_equal(m.shift(p), p)
+ assert m.shift(p) == p
for p in range(i + 1, l + 1):
- assert_equal(m.shift(p), p + 1)
+ assert m.shift(p) == p + 1
def test_shift_ins2(self):
"""
@@ -119,9 +118,9 @@ class TestMutator(MutalyzerTest):
m = self._mutator(_seq(l))
m.insertion(i, 'TT')
for p in range(1, i + 1):
- assert_equal(m.shift(p), p)
+ assert m.shift(p) == p
for p in range(i + 1, l + 1):
- assert_equal(m.shift(p), p + 2)
+ assert m.shift(p) == p + 2
def test_shift_sites_no_change(self):
"""
@@ -137,7 +136,7 @@ class TestMutator(MutalyzerTest):
l = 30
sites = [4, 9, 14, 19, 25, 27]
m = self._mutator(_seq(l))
- assert_equal(m.shift_sites(sites), sites)
+ assert m.shift_sites(sites) == sites
def test_shift_sites_acc_del_before(self):
"""
@@ -149,7 +148,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.deletion(13, 13) # g.13del
- assert_equal(m.shift_sites(sites), [4, 9, 13, 16, 24, 26])
+ assert m.shift_sites(sites) == [4, 9, 13, 16, 24, 26]
def test_shift_sites_acc_del_after(self):
"""
@@ -159,7 +158,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.deletion(14, 14) # g.14del
- assert_equal(m.shift_sites(sites), [4, 9, 14, 16, 24, 26])
+ assert m.shift_sites(sites) == [4, 9, 14, 16, 24, 26]
def test_shift_sites_don_del_before(self):
"""
@@ -169,7 +168,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.deletion(17, 17) # g.17del
- assert_equal(m.shift_sites(sites), [4, 9, 14, 16, 24, 26])
+ assert m.shift_sites(sites) == [4, 9, 14, 16, 24, 26]
def test_shift_sites_don_del_after(self):
"""
@@ -181,7 +180,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.deletion(18, 18) # g.18del
- assert_equal(m.shift_sites(sites), [4, 9, 14, 17, 24, 26])
+ assert m.shift_sites(sites) == [4, 9, 14, 17, 24, 26]
def test_shift_sites_acc_del2_before(self):
"""
@@ -193,7 +192,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.deletion(12, 13) # g.12_13del
- assert_equal(m.shift_sites(sites), [4, 9, 12, 15, 23, 25])
+ assert m.shift_sites(sites) == [4, 9, 12, 15, 23, 25]
def test_shift_sites_acc_del2_on(self):
"""
@@ -207,7 +206,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.deletion(13, 14) # g.13_14del
- assert_equal(m.shift_sites(sites), [4, 9, 13, 15, 23, 25])
+ assert m.shift_sites(sites) == [4, 9, 13, 15, 23, 25]
def test_shift_sites_acc_del2_after(self):
"""
@@ -217,7 +216,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.deletion(14, 15) # g.14_15del
- assert_equal(m.shift_sites(sites), [4, 9, 14, 15, 23, 25])
+ assert m.shift_sites(sites) == [4, 9, 14, 15, 23, 25]
def test_shift_sites_don_del2_before(self):
"""
@@ -227,7 +226,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.deletion(16, 17) # g.16_17del
- assert_equal(m.shift_sites(sites), [4, 9, 14, 15, 23, 25])
+ assert m.shift_sites(sites) == [4, 9, 14, 15, 23, 25]
def test_shift_sites_don_del2_on(self):
"""
@@ -241,7 +240,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.deletion(17, 18) # g.17_18del
- assert_equal(m.shift_sites(sites), [4, 9, 14, 16, 23, 25])
+ assert m.shift_sites(sites) == [4, 9, 14, 16, 23, 25]
def test_shift_sites_don_del2_after(self):
"""
@@ -253,7 +252,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.deletion(18, 19) # g.18_19del
- assert_equal(m.shift_sites(sites), [4, 9, 14, 17, 23, 25])
+ assert m.shift_sites(sites) == [4, 9, 14, 17, 23, 25]
def test_shift_sites_acc_ins_before(self):
"""
@@ -265,7 +264,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(12, 'A') # g.12_13insA
- assert_equal(m.shift_sites(sites), [4, 9, 15, 18, 26, 28])
+ assert m.shift_sites(sites) == [4, 9, 15, 18, 26, 28]
def test_shift_sites_acc_ins_on(self):
"""
@@ -275,7 +274,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(13, 'A') # g.13_14insA
- assert_equal(m.shift_sites(sites), [4, 9, 14, 18, 26, 28])
+ assert m.shift_sites(sites) == [4, 9, 14, 18, 26, 28]
def test_shift_sites_first_acc_ins_on(self):
"""
@@ -285,7 +284,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(3, 'A') # g.3_4insA
- assert_equal(m.shift_sites(sites), [5, 10, 15, 18, 26, 28])
+ assert m.shift_sites(sites) == [5, 10, 15, 18, 26, 28]
def test_shift_sites_acc_ins_after(self):
"""
@@ -295,7 +294,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(14, 'A') # g.14_15insA
- assert_equal(m.shift_sites(sites), [4, 9, 14, 18, 26, 28])
+ assert m.shift_sites(sites) == [4, 9, 14, 18, 26, 28]
def test_shift_sites_don_ins_before(self):
"""
@@ -305,7 +304,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(16, 'A') # g.16_17insA
- assert_equal(m.shift_sites(sites), [4, 9, 14, 18, 26, 28])
+ assert m.shift_sites(sites) == [4, 9, 14, 18, 26, 28]
def test_shift_sites_don_ins_on(self):
"""
@@ -315,7 +314,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(17, 'A') # g.17_18insA
- assert_equal(m.shift_sites(sites), [4, 9, 14, 18, 26, 28])
+ assert m.shift_sites(sites) == [4, 9, 14, 18, 26, 28]
def test_shift_sites_last_don_ins_on(self):
"""
@@ -325,7 +324,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(27, 'A') # g.27_28insA
- assert_equal(m.shift_sites(sites), [4, 9, 14, 17, 25, 27])
+ assert m.shift_sites(sites) == [4, 9, 14, 17, 25, 27]
def test_shift_sites_don_ins_after(self):
"""
@@ -337,7 +336,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(18, 'A') # g.18_19insA
- assert_equal(m.shift_sites(sites), [4, 9, 14, 17, 26, 28])
+ assert m.shift_sites(sites) == [4, 9, 14, 17, 26, 28]
def test_shift_sites_acc_ins2_before(self):
"""
@@ -349,7 +348,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(12, 'AT') # g.12_13insAT
- assert_equal(m.shift_sites(sites), [4, 9, 16, 19, 27, 29])
+ assert m.shift_sites(sites) == [4, 9, 16, 19, 27, 29]
def test_shift_sites_first_acc_ins2_on(self):
"""
@@ -359,7 +358,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(3, 'AT') # g.3_4insAT
- assert_equal(m.shift_sites(sites), [6, 11, 16, 19, 27, 29])
+ assert m.shift_sites(sites) == [6, 11, 16, 19, 27, 29]
def test_shift_sites_acc_ins2_after(self):
"""
@@ -369,7 +368,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(14, 'AT') # g.14_15insAT
- assert_equal(m.shift_sites(sites), [4, 9, 14, 19, 27, 29])
+ assert m.shift_sites(sites) == [4, 9, 14, 19, 27, 29]
def test_shift_sites_don_ins2_before(self):
"""
@@ -379,7 +378,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(16, 'AT') # g.16_17insAT
- assert_equal(m.shift_sites(sites), [4, 9, 14, 19, 27, 29])
+ assert m.shift_sites(sites) == [4, 9, 14, 19, 27, 29]
def test_shift_sites_last_don_ins2_on(self):
"""
@@ -389,7 +388,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(27, 'AT') # g.27_28insAT
- assert_equal(m.shift_sites(sites), [4, 9, 14, 17, 25, 27])
+ assert m.shift_sites(sites) == [4, 9, 14, 17, 25, 27]
def test_shift_sites_don_ins2_after(self):
"""
@@ -401,7 +400,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(18, 'AT') # g.18_19insAT
- assert_equal(m.shift_sites(sites), [4, 9, 14, 17, 27, 29])
+ assert m.shift_sites(sites) == [4, 9, 14, 17, 27, 29]
def test_shift_sites_acc_ins3_before(self):
"""
@@ -413,7 +412,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(12, 'ATT') # g.12_13insATT
- assert_equal(m.shift_sites(sites), [4, 9, 17, 20, 28, 30])
+ assert m.shift_sites(sites) == [4, 9, 17, 20, 28, 30]
def test_shift_sites_acc_ins3_on(self):
"""
@@ -423,7 +422,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(13, 'ATT') # g.13_14insATT
- assert_equal(m.shift_sites(sites), [4, 9, 14, 20, 28, 30])
+ assert m.shift_sites(sites) == [4, 9, 14, 20, 28, 30]
def test_shift_sites_first_acc_ins3_on(self):
"""
@@ -433,7 +432,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(3, 'ATT') # g.3_4insATT
- assert_equal(m.shift_sites(sites), [7, 12, 17, 20, 28, 30])
+ assert m.shift_sites(sites) == [7, 12, 17, 20, 28, 30]
def test_shift_sites_acc_ins3_after(self):
"""
@@ -443,7 +442,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(14, 'ATT') # g.14_15insATT
- assert_equal(m.shift_sites(sites), [4, 9, 14, 20, 28, 30])
+ assert m.shift_sites(sites) == [4, 9, 14, 20, 28, 30]
def test_shift_sites_don_ins3_before(self):
"""
@@ -453,7 +452,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(16, 'ATT') # g.16_17insATT
- assert_equal(m.shift_sites(sites), [4, 9, 14, 20, 28, 30])
+ assert m.shift_sites(sites) == [4, 9, 14, 20, 28, 30]
def test_shift_sites_don_ins3_on(self):
"""
@@ -463,7 +462,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(17, 'ATT') # g.17_18insATT
- assert_equal(m.shift_sites(sites), [4, 9, 14, 20, 28, 30])
+ assert m.shift_sites(sites) == [4, 9, 14, 20, 28, 30]
def test_shift_sites_last_don_ins3_on(self):
"""
@@ -473,7 +472,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(27, 'ATT') # g.27_28insATT
- assert_equal(m.shift_sites(sites), [4, 9, 14, 17, 25, 27])
+ assert m.shift_sites(sites) == [4, 9, 14, 17, 25, 27]
def test_shift_sites_don_ins3_after(self):
"""
@@ -485,7 +484,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 14, 17, 25, 27]
m = self._mutator(_seq(l))
m.insertion(18, 'ATT') # g.18_19insATT
- assert_equal(m.shift_sites(sites), [4, 9, 14, 17, 28, 30])
+ assert m.shift_sites(sites) == [4, 9, 14, 17, 28, 30]
def test_shift_sites_adj_del_before1(self):
"""
@@ -502,7 +501,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.deletion(16, 16) # g.16del
- assert_equal(m.shift_sites(sites), [4, 9, 10, 16, 17, 26])
+ assert m.shift_sites(sites) == [4, 9, 10, 16, 17, 26]
def test_shift_sites_adj_del_before(self):
"""
@@ -512,7 +511,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.deletion(17, 17) # g.17del
- assert_equal(m.shift_sites(sites), [4, 9, 10, 16, 17, 26])
+ assert m.shift_sites(sites) == [4, 9, 10, 16, 17, 26]
def test_shift_sites_adj_del_after(self):
"""
@@ -522,7 +521,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.deletion(18, 18) # g.18del
- assert_equal(m.shift_sites(sites), [4, 9, 10, 17, 18, 26])
+ assert m.shift_sites(sites) == [4, 9, 10, 17, 18, 26]
def test_shift_sites_adj_del_after1(self):
"""
@@ -532,7 +531,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.deletion(19, 19) # g.19del
- assert_equal(m.shift_sites(sites), [4, 9, 10, 17, 18, 26])
+ assert m.shift_sites(sites) == [4, 9, 10, 17, 18, 26]
def test_shift_sites_adj_ins_before(self):
"""
@@ -542,7 +541,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.insertion(16, 'A') # g.16_17insA
- assert_equal(m.shift_sites(sites), [4, 9, 10, 18, 19, 28])
+ assert m.shift_sites(sites) == [4, 9, 10, 18, 19, 28]
def test_shift_sites_adj_ins_on(self):
"""
@@ -558,7 +557,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.insertion(17, 'A') # g.17_18insA
- assert_equal(m.shift_sites(sites), [4, 9, 10, 18, 19, 28])
+ assert m.shift_sites(sites) == [4, 9, 10, 18, 19, 28]
def test_shift_sites_adj_ins_after(self):
"""
@@ -568,7 +567,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.insertion(18, 'A') # g.18_19insA
- assert_equal(m.shift_sites(sites), [4, 9, 10, 17, 18, 28])
+ assert m.shift_sites(sites) == [4, 9, 10, 17, 18, 28]
def test_shift_sites_adj_del2_before1(self):
"""
@@ -578,7 +577,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.deletion(15, 16) # g.15_16del
- assert_equal(m.shift_sites(sites), [4, 9, 10, 15, 16, 25])
+ assert m.shift_sites(sites) == [4, 9, 10, 15, 16, 25]
def test_shift_sites_adj_del2_before(self):
"""
@@ -588,7 +587,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.deletion(16, 17) # g.16_17del
- assert_equal(m.shift_sites(sites), [4, 9, 10, 15, 16, 25])
+ assert m.shift_sites(sites) == [4, 9, 10, 15, 16, 25]
def test_shift_sites_adj_del2_on(self):
"""
@@ -603,7 +602,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.deletion(17, 18) # g.17_18del
- assert_equal(m.shift_sites(sites), [4, 9, 10, 16, 17, 25])
+ assert m.shift_sites(sites) == [4, 9, 10, 16, 17, 25]
def test_shift_sites_adj_del2_after(self):
"""
@@ -613,7 +612,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.deletion(18, 19) # g.18_19del
- assert_equal(m.shift_sites(sites), [4, 9, 10, 17, 18, 25])
+ assert m.shift_sites(sites) == [4, 9, 10, 17, 18, 25]
def test_shift_sites_adj_del2_after1(self):
"""
@@ -623,7 +622,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.deletion(19, 20) # g.19_20del
- assert_equal(m.shift_sites(sites), [4, 9, 10, 17, 18, 25])
+ assert m.shift_sites(sites) == [4, 9, 10, 17, 18, 25]
def test_shift_sites_adj_ins2_before(self):
"""
@@ -633,7 +632,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.insertion(16, 'AT') # g.16_17insAT
- assert_equal(m.shift_sites(sites), [4, 9, 10, 19, 20, 29])
+ assert m.shift_sites(sites) == [4, 9, 10, 19, 20, 29]
def test_shift_sites_adj_ins2_on(self):
"""
@@ -649,7 +648,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.insertion(17, 'AT') # g.17_18insAT
- assert_equal(m.shift_sites(sites), [4, 9, 10, 19, 20, 29])
+ assert m.shift_sites(sites) == [4, 9, 10, 19, 20, 29]
def test_shift_sites_adj_ins2_after(self):
"""
@@ -659,7 +658,7 @@ class TestMutator(MutalyzerTest):
sites = [4, 9, 10, 17, 18, 27]
m = self._mutator(_seq(l))
m.insertion(18, 'AT') # g.18_19insAT
- assert_equal(m.shift_sites(sites), [4, 9, 10, 17, 18, 29])
+ assert m.shift_sites(sites) == [4, 9, 10, 17, 18, 29]
def test_del(self):
"""
@@ -667,7 +666,7 @@ class TestMutator(MutalyzerTest):
"""
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 2)
- assert_equal(str(m.mutated), str(Seq('ACGATCG')))
+ assert str(m.mutated) == str(Seq('ACGATCG'))
def test_largedel(self):
"""
@@ -675,7 +674,7 @@ class TestMutator(MutalyzerTest):
"""
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 7)
- assert_equal(str(m.mutated), str(Seq('AG')))
+ assert str(m.mutated) == str(Seq('AG'))
def test_ins(self):
"""
@@ -683,7 +682,7 @@ class TestMutator(MutalyzerTest):
"""
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'A')
- assert_equal(str(m.mutated), str(Seq('ATACGATCG')))
+ assert str(m.mutated) == str(Seq('ATACGATCG'))
def test_largeins(self):
"""
@@ -691,7 +690,7 @@ class TestMutator(MutalyzerTest):
"""
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'ATCG')
- assert_equal(str(m.mutated), str(Seq('ATATCGCGATCG')))
+ assert str(m.mutated) == str(Seq('ATATCGCGATCG'))
def test_sub(self):
"""
@@ -699,7 +698,7 @@ class TestMutator(MutalyzerTest):
"""
m = self._mutator(Seq('ATCGATCG'))
m.substitution(3, 'G')
- assert_equal(str(m.mutated), str(Seq('ATGGATCG')))
+ assert str(m.mutated) == str(Seq('ATGGATCG'))
def test_adjecent_del_sub_1(self):
"""
@@ -710,7 +709,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 2)
m.substitution(3, 'G')
- assert_equal(str(m.mutated), str(Seq('AGGATCG')))
+ assert str(m.mutated) == str(Seq('AGGATCG'))
def test_adjecent_del_sub_2(self):
"""
@@ -719,7 +718,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(3, 3)
m.substitution(2, 'G')
- assert_equal(str(m.mutated), str(Seq('AGGATCG')))
+ assert str(m.mutated) == str(Seq('AGGATCG'))
def test_near_adjecent_del_sub_1(self):
"""
@@ -728,7 +727,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 2)
m.substitution(4, 'T')
- assert_equal(str(m.mutated), str(Seq('ACTATCG')))
+ assert str(m.mutated) == str(Seq('ACTATCG'))
def test_near_adjecent_del_sub_2(self):
"""
@@ -737,7 +736,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(4, 4)
m.substitution(2, 'G')
- assert_equal(str(m.mutated), str(Seq('AGCATCG')))
+ assert str(m.mutated) == str(Seq('AGCATCG'))
def test_adjecent_largedel_sub_1(self):
"""
@@ -747,7 +746,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 6)
m.substitution(7, 'T')
- assert_equal(str(m.mutated), str(Seq('ATG')))
+ assert str(m.mutated) == str(Seq('ATG'))
def test_adjecent_largedel_sub_2(self):
"""
@@ -757,7 +756,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(3, 7)
m.substitution(2, 'C')
- assert_equal(str(m.mutated), str(Seq('ACG')))
+ assert str(m.mutated) == str(Seq('ACG'))
def test_near_adjecent_largedel_sub_1(self):
"""
@@ -766,7 +765,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 5)
m.substitution(7, 'T')
- assert_equal(str(m.mutated), str(Seq('ATTG')))
+ assert str(m.mutated) == str(Seq('ATTG'))
def test_near_adjecent_largedel_sub_2(self):
"""
@@ -775,7 +774,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(4, 7)
m.substitution(2, 'C')
- assert_equal(str(m.mutated), str(Seq('ACCG')))
+ assert str(m.mutated) == str(Seq('ACCG'))
def test_adjectent_del_ins_1(self):
"""
@@ -784,7 +783,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 2)
m.insertion(2, 'G')
- assert_equal(str(m.mutated), str(Seq('AGCGATCG')))
+ assert str(m.mutated) == str(Seq('AGCGATCG'))
def test_adjectent_del_ins_2(self):
"""
@@ -793,7 +792,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(3, 3)
m.insertion(2, 'A')
- assert_equal(str(m.mutated), str(Seq('ATAGATCG')))
+ assert str(m.mutated) == str(Seq('ATAGATCG'))
def test_near_adjectent_del_ins(self):
"""
@@ -802,7 +801,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 2)
m.insertion(3, 'T')
- assert_equal(str(m.mutated), str(Seq('ACTGATCG')))
+ assert str(m.mutated) == str(Seq('ACTGATCG'))
def test_adjecent_ins_sub_1(self):
"""
@@ -812,7 +811,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'A')
m.substitution(3, 'G')
- assert_equal(str(m.mutated), str(Seq('ATAGGATCG')))
+ assert str(m.mutated) == str(Seq('ATAGGATCG'))
def test_adjecent_ins_sub_2(self):
"""
@@ -822,7 +821,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'A')
m.substitution(2, 'G')
- assert_equal(str(m.mutated), str(Seq('AGACGATCG')))
+ assert str(m.mutated) == str(Seq('AGACGATCG'))
def test_near_adjecent_ins_sub(self):
"""
@@ -832,7 +831,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'A')
m.substitution(4, 'T')
- assert_equal(str(m.mutated), str(Seq('ATACTATCG')))
+ assert str(m.mutated) == str(Seq('ATACTATCG'))
def test_adjecent_largeins_sub_1(self):
"""
@@ -842,7 +841,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'ATCG')
m.substitution(3, 'G')
- assert_equal(str(m.mutated), str(Seq('ATATCGGGATCG')))
+ assert str(m.mutated) == str(Seq('ATATCGGGATCG'))
def test_adjecent_largeins_sub_2(self):
"""
@@ -852,7 +851,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'ATCG')
m.substitution(2, 'G')
- assert_equal(str(m.mutated), str(Seq('AGATCGCGATCG')))
+ assert str(m.mutated) == str(Seq('AGATCGCGATCG'))
def test_near_adjecent_largeins_sub(self):
"""
@@ -862,7 +861,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'ATCG')
m.substitution(4, 'T')
- assert_equal(str(m.mutated), str(Seq('ATATCGCTATCG')))
+ assert str(m.mutated) == str(Seq('ATATCGCTATCG'))
def test_adjecent_del_del_1(self):
"""
@@ -871,7 +870,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 2)
m.deletion(3, 3)
- assert_equal(str(m.mutated), str(Seq('AGATCG')))
+ assert str(m.mutated) == str(Seq('AGATCG'))
def test_adjecent_del_del_2(self):
"""
@@ -880,7 +879,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(3, 3)
m.deletion(2, 2)
- assert_equal(str(m.mutated), str(Seq('AGATCG')))
+ assert str(m.mutated) == str(Seq('AGATCG'))
def test_adjecent_delins_snp_1(self):
"""
@@ -889,7 +888,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 2, 'A')
m.substitution(3, 'G')
- assert_equal(str(m.mutated), str(Seq('AAGGATCG')))
+ assert str(m.mutated) == str(Seq('AAGGATCG'))
def test_adjecent_delins_snp_2(self):
"""
@@ -898,7 +897,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 3, 'A')
m.substitution(2, 'G')
- assert_equal(str(m.mutated), str(Seq('AGAGATCG')))
+ assert str(m.mutated) == str(Seq('AGAGATCG'))
def test_adjecent_largedelins_eq_snp_1(self):
"""
@@ -908,7 +907,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAAAA')
m.substitution(7, 'G')
- assert_equal(str(m.mutated), str(Seq('AAAAAAGG')))
+ assert str(m.mutated) == str(Seq('AAAAAAGG'))
def test_adjecent_largedelins_min_snp_1(self):
"""
@@ -918,7 +917,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAA')
m.substitution(7, 'G')
- assert_equal(str(m.mutated), str(Seq('AAAAGG')))
+ assert str(m.mutated) == str(Seq('AAAAGG'))
def test_adjecent_largedelins_plus_snp_1(self):
"""
@@ -928,7 +927,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAAAAAA')
m.substitution(7, 'G')
- assert_equal(str(m.mutated), str(Seq('AAAAAAAAGG')))
+ assert str(m.mutated) == str(Seq('AAAAAAAAGG'))
def test_adjecent_largedelins_eq_snp_2(self):
"""
@@ -938,7 +937,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAAAA')
m.substitution(2, 'G')
- assert_equal(str(m.mutated), str(Seq('AGAAAAAG')))
+ assert str(m.mutated) == str(Seq('AGAAAAAG'))
def test_adjecent_largedelins_min_snp_2(self):
"""
@@ -948,7 +947,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAA')
m.substitution(2, 'G')
- assert_equal(str(m.mutated), str(Seq('AGAAAG')))
+ assert str(m.mutated) == str(Seq('AGAAAG'))
def test_adjecent_largedelins_plus_snp_2(self):
"""
@@ -958,7 +957,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAAAAAA')
m.substitution(2, 'G')
- assert_equal(str(m.mutated), str(Seq('AGAAAAAAAG')))
+ assert str(m.mutated) == str(Seq('AGAAAAAAAG'))
def test_adjecent_delins_del_1(self):
"""
@@ -967,7 +966,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 2, 'A')
m.deletion(3, 3)
- assert_equal(str(m.mutated), str(Seq('AAGATCG')))
+ assert str(m.mutated) == str(Seq('AAGATCG'))
def test_adjecent_delins_del_2(self):
"""
@@ -976,7 +975,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 3, 'A')
m.deletion(2, 2)
- assert_equal(str(m.mutated), str(Seq('AAGATCG')))
+ assert str(m.mutated) == str(Seq('AAGATCG'))
def test_adjecent_largedelins_eq_del_1(self):
"""
@@ -986,7 +985,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAAAA')
m.deletion(7, 7)
- assert_equal(str(m.mutated), str(Seq('AAAAAAG')))
+ assert str(m.mutated) == str(Seq('AAAAAAG'))
def test_adjecent_largedelins_min_del_1(self):
"""
@@ -996,7 +995,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAA')
m.deletion(7, 7)
- assert_equal(str(m.mutated), str(Seq('AAAAG')))
+ assert str(m.mutated) == str(Seq('AAAAG'))
def test_adjecent_largedelins_plus_del_1(self):
"""
@@ -1006,7 +1005,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAAAAAA')
m.deletion(7, 7)
- assert_equal(str(m.mutated), str(Seq('AAAAAAAAG')))
+ assert str(m.mutated) == str(Seq('AAAAAAAAG'))
def test_adjecent_largedelins_eq_del_2(self):
"""
@@ -1016,7 +1015,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAAAA')
m.deletion(2, 2)
- assert_equal(str(m.mutated), str(Seq('AAAAAAG')))
+ assert str(m.mutated) == str(Seq('AAAAAAG'))
def test_adjecent_largedelins_min_del_2(self):
"""
@@ -1026,7 +1025,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAA')
m.deletion(2, 2)
- assert_equal(str(m.mutated), str(Seq('AAAAG')))
+ assert str(m.mutated) == str(Seq('AAAAG'))
def test_adjecent_largedelins_plus_del_2(self):
"""
@@ -1036,7 +1035,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAAAAAA')
m.deletion(2, 2)
- assert_equal(str(m.mutated), str(Seq('AAAAAAAAG')))
+ assert str(m.mutated) == str(Seq('AAAAAAAAG'))
def test_adjectent_delins_ins_1(self):
"""
@@ -1045,7 +1044,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 2, 'A')
m.insertion(2, 'G')
- assert_equal(str(m.mutated), str(Seq('AAGCGATCG')))
+ assert str(m.mutated) == str(Seq('AAGCGATCG'))
def test_adjectent_delins_ins_2(self):
"""
@@ -1054,7 +1053,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 3, 'A')
m.insertion(2, 'G')
- assert_equal(str(m.mutated), str(Seq('ATGAGATCG')))
+ assert str(m.mutated) == str(Seq('ATGAGATCG'))
def test_adjectent_largedelins_eq_ins_1(self):
"""
@@ -1063,7 +1062,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAAAA')
m.insertion(6, 'G')
- assert_equal(str(m.mutated), str(Seq('AAAAAAGCG')))
+ assert str(m.mutated) == str(Seq('AAAAAAGCG'))
def test_adjectent_largedelins_min_ins_1(self):
"""
@@ -1072,7 +1071,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAA')
m.insertion(6, 'G')
- assert_equal(str(m.mutated), str(Seq('AAAAGCG')))
+ assert str(m.mutated) == str(Seq('AAAAGCG'))
def test_adjectent_largedelins_plus_ins_1(self):
"""
@@ -1081,7 +1080,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAAAAAA')
m.insertion(6, 'G')
- assert_equal(str(m.mutated), str(Seq('AAAAAAAAGCG')))
+ assert str(m.mutated) == str(Seq('AAAAAAAAGCG'))
def test_adjectent_largedelins_eq_ins_2(self):
"""
@@ -1090,7 +1089,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAAAA')
m.insertion(2, 'G')
- assert_equal(str(m.mutated), str(Seq('ATGAAAAAG')))
+ assert str(m.mutated) == str(Seq('ATGAAAAAG'))
def test_adjectent_largedelins_min_ins_2(self):
"""
@@ -1099,7 +1098,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAA')
m.insertion(2, 'G')
- assert_equal(str(m.mutated), str(Seq('ATGAAAG')))
+ assert str(m.mutated) == str(Seq('ATGAAAG'))
def test_adjectent_largedelins_plus_ins_2(self):
"""
@@ -1108,7 +1107,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAAAAAA')
m.insertion(2, 'G')
- assert_equal(str(m.mutated), str(Seq('ATGAAAAAAAG')))
+ assert str(m.mutated) == str(Seq('ATGAAAAAAAG'))
def test_adjectent_delins_del_delins(self):
"""
@@ -1117,7 +1116,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 3, 'A')
m.delins(4, 4, 'T')
- assert_equal(str(m.mutated), str(Seq('AATATCG')))
+ assert str(m.mutated) == str(Seq('AATATCG'))
def test_adjectent_largedelins_plus_delins_1(self):
"""
@@ -1126,7 +1125,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAAAAAA')
m.delins(7, 7, 'T')
- assert_equal(str(m.mutated), str(Seq('AAAAAAAATG')))
+ assert str(m.mutated) == str(Seq('AAAAAAAATG'))
def test_adjectent_largedelins_plus_delins_2(self):
"""
@@ -1135,7 +1134,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAAAAAA')
m.delins(2, 2, 'C')
- assert_equal(str(m.mutated), str(Seq('ACAAAAAAAG')))
+ assert str(m.mutated) == str(Seq('ACAAAAAAAG'))
def test_adjectent_largedelins_min_delins_1(self):
"""
@@ -1144,7 +1143,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(2, 6, 'AAA')
m.delins(7, 7, 'T')
- assert_equal(str(m.mutated), str(Seq('AAAATG')))
+ assert str(m.mutated) == str(Seq('AAAATG'))
def test_adjectent_largedelins_min_delins_2(self):
"""
@@ -1153,7 +1152,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.delins(3, 7, 'AAA')
m.delins(2, 2, 'C')
- assert_equal(str(m.mutated), str(Seq('ACAAAG')))
+ assert str(m.mutated) == str(Seq('ACAAAG'))
def test_adjectent_del_dup_1(self):
"""
@@ -1162,7 +1161,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 2)
m.duplication(3, 3)
- assert_equal(str(m.mutated), str(Seq('ACCGATCG')))
+ assert str(m.mutated) == str(Seq('ACCGATCG'))
def test_adjectent_del_dup_2(self):
"""
@@ -1171,7 +1170,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(3, 3)
m.duplication(2, 2)
- assert_equal(str(m.mutated), str(Seq('ATTGATCG')))
+ assert str(m.mutated) == str(Seq('ATTGATCG'))
def test_adjectent_ins_dup_1(self):
"""
@@ -1180,7 +1179,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'G')
m.duplication(3, 3)
- assert_equal(str(m.mutated), str(Seq('ATGCCGATCG')))
+ assert str(m.mutated) == str(Seq('ATGCCGATCG'))
def test_adjectent_ins_dup_2(self):
"""
@@ -1189,7 +1188,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'G')
m.duplication(2, 2)
- assert_equal(str(m.mutated), str(Seq('ATTGCGATCG')))
+ assert str(m.mutated) == str(Seq('ATTGCGATCG'))
def test_adjectent_ins_ins_1(self):
"""
@@ -1198,7 +1197,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'G')
m.insertion(3, 'A')
- assert_equal(str(m.mutated), str(Seq('ATGCAGATCG')))
+ assert str(m.mutated) == str(Seq('ATGCAGATCG'))
def test_adjectent_ins_ins_2(self):
"""
@@ -1207,7 +1206,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(3, 'A')
m.insertion(2, 'G')
- assert_equal(str(m.mutated), str(Seq('ATGCAGATCG')))
+ assert str(m.mutated) == str(Seq('ATGCAGATCG'))
def test_ins_ins(self):
"""
@@ -1225,7 +1224,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.inversion(2, 2)
m.inversion(3, 3)
- assert_equal(str(m.mutated), str(Seq('AAGGATCG')))
+ assert str(m.mutated) == str(Seq('AAGGATCG'))
def test_adjecent_inv_inv_2(self):
"""
@@ -1234,7 +1233,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.inversion(3, 3)
m.inversion(2, 2)
- assert_equal(str(m.mutated), str(Seq('AAGGATCG')))
+ assert str(m.mutated) == str(Seq('AAGGATCG'))
def test_adjecent_dup_dup_1(self):
"""
@@ -1243,7 +1242,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.duplication(2, 2)
m.duplication(3, 3)
- assert_equal(str(m.mutated), str(Seq('ATTCCGATCG')))
+ assert str(m.mutated) == str(Seq('ATTCCGATCG'))
def test_adjecent_dup_dup_2(self):
"""
@@ -1252,7 +1251,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.duplication(3, 3)
m.duplication(2, 2)
- assert_equal(str(m.mutated), str(Seq('ATTCCGATCG')))
+ assert str(m.mutated) == str(Seq('ATTCCGATCG'))
def test_adjecent_del_inv_1(self):
"""
@@ -1261,7 +1260,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(2, 2)
m.inversion(3, 3)
- assert_equal(str(m.mutated), str(Seq('AGGATCG')))
+ assert str(m.mutated) == str(Seq('AGGATCG'))
def test_adjecent_del_inv_2(self):
"""
@@ -1270,7 +1269,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.deletion(3, 3)
m.inversion(2, 2)
- assert_equal(str(m.mutated), str(Seq('AAGATCG')))
+ assert str(m.mutated) == str(Seq('AAGATCG'))
def test_adjecent_ins_inv_1(self):
"""
@@ -1279,7 +1278,7 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'G')
m.inversion(3, 3)
- assert_equal(str(m.mutated), str(Seq('ATGGGATCG')))
+ assert str(m.mutated) == str(Seq('ATGGGATCG'))
def test_adjecent_ins_inv_2(self):
"""
@@ -1288,4 +1287,4 @@ class TestMutator(MutalyzerTest):
m = self._mutator(Seq('ATCGATCG'))
m.insertion(2, 'G')
m.inversion(2, 2)
- assert_equal(str(m.mutated), str(Seq('AAGCGATCG')))
+ assert str(m.mutated) == str(Seq('AAGCGATCG'))
diff --git a/tests/test_parsers_genbank.py b/tests/test_parsers_genbank.py
index d66ad1af..7640c496 100644
--- a/tests/test_parsers_genbank.py
+++ b/tests/test_parsers_genbank.py
@@ -4,7 +4,6 @@ Tests for the mutalyzer.parsers.genbank module.
#import logging; logging.basicConfig()
-from nose.tools import *
from mutalyzer.parsers import genbank
@@ -33,4 +32,4 @@ class TestMutator(MutalyzerTest):
(['a b c', 'a b c'], (-1, -1)),
(['a b c d a b', 'a b'], (2, 2))]
for test in tests:
- assert_equal(self.gb_parser._find_mismatch(test[0]), test[1])
+ assert self.gb_parser._find_mismatch(test[0]) == test[1]
diff --git a/tests/test_scheduler.py b/tests/test_scheduler.py
index 1fc3d5ee..a722f331 100644
--- a/tests/test_scheduler.py
+++ b/tests/test_scheduler.py
@@ -10,7 +10,6 @@ import StringIO
#import logging; logging.basicConfig()
from Bio import Entrez
from mock import patch
-from nose.tools import *
from mutalyzer.config import settings
from mutalyzer.db.models import BatchJob, BatchQueueItem
@@ -42,19 +41,18 @@ class TestScheduler(MutalyzerTest):
batch_job = BatchJob.query.filter_by(result_id=result_id).one()
left = batch_job.batch_queue_items.count()
- assert_equal(left, len(variants))
+ assert left == len(variants)
scheduler.process()
left = batch_job.batch_queue_items.count()
- assert_equal(left, 0)
+ assert left == 0
filename = 'batch-job-%s.txt' % result_id
result = open(os.path.join(settings.CACHE_DIR, filename))
next(result) # Header.
- assert_equal(expected,
- [line.strip().split('\t') for line in result])
+ assert expected == [line.strip().split('\t') for line in result]
def test_syntax_checker(self):
"""
diff --git a/tests/test_services_json.py b/tests/test_services_json.py
index f5b1a42c..461e8171 100644
--- a/tests/test_services_json.py
+++ b/tests/test_services_json.py
@@ -3,7 +3,6 @@ Tests for the JSON interface to Mutalyzer.
"""
-from nose.tools import *
import simplejson as json
from spyne.server.null import NullServer
import mutalyzer
@@ -39,7 +38,7 @@ class TestServicesJson(MutalyzerTest):
Running checkSyntax with a valid variant name should return True.
"""
r = self._call('checkSyntax', variant='AB026906.1:c.274G>T')
- assert_equal(r, {'valid': True, 'messages': []})
+ assert r == {'valid': True, 'messages': []}
def test_checksyntax_invalid(self):
"""
@@ -47,7 +46,7 @@ class TestServicesJson(MutalyzerTest):
and give at least one error message.
"""
r = self._call('checkSyntax', variant='0:abcd')
- assert_equal(r['valid'], False)
+ assert r['valid'] == False
assert len(r['messages']) >= 1
def test_checksyntax_empty(self):
@@ -57,7 +56,7 @@ class TestServicesJson(MutalyzerTest):
# The validator doesn't work with NullServer, so we cannot do this
# test. See https://github.com/arskom/spyne/issues/318
#r = self._call('checkSyntax')
- #assert_equal(r['faultcode'], 'Client.ValidationError')
+ #assert r['faultcode'] == 'Client.ValidationError'
pass
@fix(database, hg19, hg19_transcript_mappings)
@@ -68,14 +67,14 @@ class TestServicesJson(MutalyzerTest):
"""
r = self._call('transcriptInfo', LOVD_ver='123', build='hg19',
accNo='NM_002001.2')
- assert_equal(r['trans_start'], -99)
- assert_equal(r['trans_stop'], 1066)
- assert_equal(r['CDS_stop'], 774)
+ assert r['trans_start'] == -99
+ assert r['trans_stop'] == 1066
+ assert r['CDS_stop'] == 774
def test_info(self):
"""
Running the info method should give us some version information.
"""
r = self._call('info')
- assert_equal(type(r['versionParts']), list)
- assert_equal(r['version'], mutalyzer.__version__)
+ assert type(r['versionParts']) == list
+ assert r['version'] == mutalyzer.__version__
diff --git a/tests/test_services_soap.py b/tests/test_services_soap.py
index 53344ca5..7bd68831 100644
--- a/tests/test_services_soap.py
+++ b/tests/test_services_soap.py
@@ -11,7 +11,7 @@ import tempfile
from Bio import Entrez
from mock import patch
-from nose.tools import *
+import pytest
from spyne.server.null import NullServer
from spyne.model.fault import Fault
from suds.client import Client
@@ -77,14 +77,14 @@ class TestServicesSoap(MutalyzerTest):
Running the ping method should return 'pong'.
"""
r = self._call('ping')
- assert_equal(r, 'pong')
+ assert r == 'pong'
def test_checksyntax_valid(self):
"""
Running checkSyntax with a valid variant name should return True.
"""
r = self._call('checkSyntax', 'AB026906.1:c.274G>T')
- assert_equal(r.valid, True)
+ assert r.valid == True
def test_checksyntax_invalid(self):
"""
@@ -92,10 +92,9 @@ class TestServicesSoap(MutalyzerTest):
and give at least one error message.
"""
r = self._call('checkSyntax', '0:abcd')
- assert_equal(r.valid, False)
+ assert r.valid == False
assert len(r.messages.SoapMessage) >= 1
- @raises(Fault)
def test_checksyntax_empty(self):
"""
Running checkSyntax with no variant name should raise exception.
@@ -104,7 +103,8 @@ class TestServicesSoap(MutalyzerTest):
# these type of tests. However, in this case we implemented our own
# check instead of relying on the validator.
# See https://github.com/arskom/spyne/issues/318
- self._call('checkSyntax')
+ with pytest.raises(Fault):
+ self._call('checkSyntax')
@fix(database, hg19, hg19_transcript_mappings)
def test_transcriptinfo_valid(self):
@@ -114,9 +114,9 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('transcriptInfo',
LOVD_ver='123', build='hg19', accNo='NM_002001.2')
- assert_equal(r.trans_start, -99)
- assert_equal(r.trans_stop, 1066)
- assert_equal(r.CDS_stop, 774)
+ assert r.trans_start == -99
+ assert r.trans_stop == 1066
+ assert r.CDS_stop == 774
@fix(database, hg19, hg19_transcript_mappings)
def test_numberconversion_gtoc_valid(self):
@@ -126,7 +126,7 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('numberConversion',
build='hg19', variant='NC_000001.10:g.159272155del')
- assert_equal(type(r.string), list)
+ assert type(r.string) == list
assert 'NM_002001.2:c.1del' in r.string
@fix(database, hg19, hg19_transcript_mappings)
@@ -137,7 +137,7 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('numberConversion',
build='hg19', variant='NM_002001.2:c.1del')
- assert_equal(type(r.string), list)
+ assert type(r.string) == list
assert 'NC_000001.10:g.159272155del' in r.string
@fix(database, hg19, hg19_transcript_mappings)
@@ -148,7 +148,7 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('numberConversion',
build='hg19', variant='NC_000023.10:g.32827640G>A', gene='DMD')
- assert_equal(type(r.string), list)
+ assert type(r.string) == list
assert 'NM_004007.2:c.250C>T' in r.string
assert 'NM_004011.3:c.-397314C>T' in r.string
assert 'NM_004019.2:c.-1542694C>T' in r.string
@@ -161,7 +161,7 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('numberConversion',
build='hg19', variant='chr7:g.345T>C')
- assert_false(r)
+ assert not r
@fix(database, hg19, hg19_transcript_mappings)
def test_numberconversion_gtoc_required_gene(self):
@@ -172,7 +172,7 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('numberConversion',
build='hg19', variant='chr7:g.345T>C', gene='LOC100132858')
- assert_equal(type(r.string), list)
+ assert type(r.string) == list
# Fix for r536: disable the -u and +d convention.
#assert 'XM_001715131.2:c.1155+d19483A>G' in r.string
assert 'XM_001715131.2:c.*19483A>G' in r.string
@@ -185,7 +185,7 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('getTranscriptsByGeneName',
build='hg19', name='DMD')
- assert_equal(type(r.string), list)
+ assert type(r.string) == list
for t in ['NM_004011.3',
'NM_004019.2',
'NM_004007.2']:
@@ -199,7 +199,7 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('getTranscriptsByGeneName',
build='hg19', name='BOGUSGENE')
- assert_false(r)
+ assert not r
@fix(database, cache('AF230870.1'))
def test_gettranscriptsandinfo_valid(self):
@@ -208,7 +208,7 @@ class TestServicesSoap(MutalyzerTest):
give a list of TranscriptInfo objects.
"""
r = self._call('getTranscriptsAndInfo', 'AF230870.1')
- assert_equal(type(r.TranscriptInfo), list)
+ assert type(r.TranscriptInfo) == list
names = [t.name for t in r.TranscriptInfo]
for t in ['mtmC2_v001',
'mtmB2_v001']:
@@ -222,7 +222,7 @@ class TestServicesSoap(MutalyzerTest):
to the gene.
"""
r = self._call('getTranscriptsAndInfo', 'AL449423.14', 'CDKN2A')
- assert_equal(type(r.TranscriptInfo), list)
+ assert type(r.TranscriptInfo) == list
names = [t.name for t in r.TranscriptInfo]
for t in ['CDKN2A_v008',
'CDKN2A_v007']:
@@ -231,7 +231,7 @@ class TestServicesSoap(MutalyzerTest):
'CDKN2B_v001',
'MTAP_v005',
'C9orf53_v001']:
- assert_false(t in names)
+ assert t not in names
@fix(database, hg19, hg19_transcript_mappings)
def test_gettranscriptsmapping(self):
@@ -241,7 +241,7 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('getTranscriptsMapping',
'hg19', 'chrX', 31200000, 31210000, 1)
- assert_equal(type(r.TranscriptMappingInfo), list)
+ assert type(r.TranscriptMappingInfo) == list
names = [t.name for t in r.TranscriptMappingInfo]
for t in ('NM_004011',
'NM_004019',
@@ -255,13 +255,13 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('mappingInfo',
'3.0-beta-06', 'hg19', 'NM_001100.3', 'g.112037014G>T')
- assert_equal(r.endoffset, 117529978)
- assert_equal(r.start_g, 112037014)
- assert_equal(r.startoffset, 117529978)
- assert_equal(r.mutationType, "subst")
- assert_equal(r.end_g, 112037014)
- assert_equal(r.startmain, 1388)
- assert_equal(r.endmain, 1388)
+ assert r.endoffset == 117529978
+ assert r.start_g == 112037014
+ assert r.startoffset == 117529978
+ assert r.mutationType == "subst"
+ assert r.end_g == 112037014
+ assert r.startmain == 1388
+ assert r.endmain == 1388
@fix(database, hg19, hg19_transcript_mappings)
def test_mappinginfo(self):
@@ -270,13 +270,13 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('mappingInfo',
'3.0-beta-06', 'hg19', 'NM_002001.2', 'g.159272168G>T')
- assert_equal(r.endoffset, 0)
- assert_equal(r.start_g, 159272168)
- assert_equal(r.startoffset, 0)
- assert_equal(r.mutationType, 'subst')
- assert_equal(r.end_g, 159272168)
- assert_equal(r.startmain, 14)
- assert_equal(r.endmain, 14)
+ assert r.endoffset == 0
+ assert r.start_g == 159272168
+ assert r.startoffset == 0
+ assert r.mutationType == 'subst'
+ assert r.end_g == 159272168
+ assert r.startmain == 14
+ assert r.endmain == 14
@fix(database, hg19, hg19_transcript_mappings)
def test_mappinginfo_compound(self):
@@ -286,13 +286,13 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('mappingInfo',
'3.0-beta-06', 'hg19', 'NM_002001.2', 'g.[159272168G>T;159272174T>A]')
- assert_equal(r.endoffset, 0)
- assert_equal(r.start_g, 159272168)
- assert_equal(r.startoffset, 0)
- assert_equal(r.mutationType, 'compound')
- assert_equal(r.end_g, 159272174)
- assert_equal(r.startmain, 14)
- assert_equal(r.endmain, 20)
+ assert r.endoffset == 0
+ assert r.start_g == 159272168
+ assert r.startoffset == 0
+ assert r.mutationType == 'compound'
+ assert r.end_g == 159272174
+ assert r.startmain == 14
+ assert r.endmain == 20
@fix(database, hg19, hg19_transcript_mappings)
def test_mappinginfo_reverse(self):
@@ -302,13 +302,13 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('mappingInfo',
'3.0-beta-06', 'hg19', 'NM_004011.3', 'g.31152229_31152239del')
- assert_equal(r.endoffset, 0)
- assert_equal(r.start_g, 31152229)
- assert_equal(r.startoffset, 0)
- assert_equal(r.mutationType, 'del')
- assert_equal(r.end_g, 31152239)
- assert_equal(r.startmain, 6981)
- assert_equal(r.endmain, 6971)
+ assert r.endoffset == 0
+ assert r.start_g == 31152229
+ assert r.startoffset == 0
+ assert r.mutationType == 'del'
+ assert r.end_g == 31152239
+ assert r.startmain == 6981
+ assert r.endmain == 6971
@fix(database, hg19, hg19_transcript_mappings)
def test_mappinginfo_compound_reverse(self):
@@ -318,21 +318,21 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('mappingInfo',
'3.0-beta-06', 'hg19', 'NM_004011.3', 'g.[31152229_31152232del;31152235_31152239del]')
- assert_equal(r.endoffset, 0)
- assert_equal(r.start_g, 31152229)
- assert_equal(r.startoffset, 0)
- assert_equal(r.mutationType, 'compound')
- assert_equal(r.end_g, 31152239)
- assert_equal(r.startmain, 6981)
- assert_equal(r.endmain, 6971)
+ assert r.endoffset == 0
+ assert r.start_g == 31152229
+ assert r.startoffset == 0
+ assert r.mutationType == 'compound'
+ assert r.end_g == 31152239
+ assert r.startmain == 6981
+ assert r.endmain == 6971
def test_info(self):
"""
Running the info method should give us some version information.
"""
r = self._call('info')
- assert_equal(type(r.versionParts.string), list)
- assert_equal(r.version, mutalyzer.__version__)
+ assert type(r.versionParts.string) == list
+ assert r.version == mutalyzer.__version__
@fix(database, cache('AB026906.1', 'AL449423.14', 'NM_003002.2'))
def test_getcache(self):
@@ -346,7 +346,7 @@ class TestServicesSoap(MutalyzerTest):
sync = CacheSync(output)
r = self._call('getCache', created_since)
- assert_equal(len(r.CacheEntry), 3)
+ assert len(r.CacheEntry) == 3
def test_getdbsnpdescriptions(self):
"""
@@ -375,7 +375,7 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('getTranscripts',
build='hg19', chrom='chrX', pos=32237295)
- assert_equal(type(r.string), list)
+ assert type(r.string) == list
for t in ['NM_004011',
'NM_004007']:
assert t in r.string
@@ -388,7 +388,7 @@ class TestServicesSoap(MutalyzerTest):
"""
r = self._call('getTranscripts',
build='hg19', chrom='chrX', pos=32237295, versions=True)
- assert_equal(type(r.string), list)
+ assert type(r.string) == list
for t in ['NM_004011.3',
'NM_004007.2']:
assert t in r.string
@@ -399,8 +399,8 @@ class TestServicesSoap(MutalyzerTest):
Just a runMutalyzer test.
"""
r = self._call('runMutalyzer', 'NM_003002.2:c.274G>T')
- assert_equal(r.errors, 0)
- assert_equal(r.genomicDescription, 'NM_003002.2:n.335G>T')
+ assert r.errors == 0
+ assert r.genomicDescription == 'NM_003002.2:n.335G>T'
assert 'NM_003002.2(SDHD_v001):c.274G>T' in r.transcriptDescriptions.string
@fix(database)
@@ -421,13 +421,13 @@ class TestServicesSoap(MutalyzerTest):
with patch.object(Entrez, 'efetch', mock_efetch):
r = self._call('runMutalyzer', 'NM_003002:c.274G>T')
- assert_equal(r.errors, 0)
- assert_equal(r.referenceId, 'NM_003002.2')
- assert_equal(r.sourceId, 'NM_003002.2')
- assert_equal(r.sourceAccession, 'NM_003002')
- assert_equal(r.sourceVersion, '2')
- assert_equal(r.sourceGi, '222352156')
- assert_equal(r.molecule, 'n')
+ assert r.errors == 0
+ assert r.referenceId == 'NM_003002.2'
+ assert r.sourceId == 'NM_003002.2'
+ assert r.sourceAccession == 'NM_003002'
+ assert r.sourceVersion == '2'
+ assert r.sourceGi == '222352156'
+ assert r.molecule == 'n'
@fix(database, cache('NM_003002.2'))
def test_runmutalyzer_reference_info_nm_version(self):
@@ -435,13 +435,13 @@ class TestServicesSoap(MutalyzerTest):
Get reference info for an NM variant with version.
"""
r = self._call('runMutalyzer', 'NM_003002.2:c.274G>T')
- assert_equal(r.errors, 0)
- assert_equal(r.referenceId, 'NM_003002.2')
- assert_equal(r.sourceId, 'NM_003002.2')
- assert_equal(r.sourceAccession, 'NM_003002')
- assert_equal(r.sourceVersion, '2')
- assert_equal(r.sourceGi, '222352156')
- assert_equal(r.molecule, 'n')
+ assert r.errors == 0
+ assert r.referenceId == 'NM_003002.2'
+ assert r.sourceId == 'NM_003002.2'
+ assert r.sourceAccession == 'NM_003002'
+ assert r.sourceVersion == '2'
+ assert r.sourceGi == '222352156'
+ assert r.molecule == 'n'
@fix(database, cache('LRG_1'))
def test_runmutalyzer_reference_info_lrg(self):
@@ -449,10 +449,10 @@ class TestServicesSoap(MutalyzerTest):
Get reference info for an LRG variant.
"""
r = self._call('runMutalyzer', 'LRG_1t1:c.266G>T')
- assert_equal(r.errors, 0)
- assert_equal(r.referenceId, 'LRG_1')
- assert_equal(r.sourceId, 'LRG_1')
- assert_equal(r.molecule, 'g')
+ assert r.errors == 0
+ assert r.referenceId == 'LRG_1'
+ assert r.sourceId == 'LRG_1'
+ assert r.molecule == 'g'
@fix(database, cache('NG_012772.1'))
def test_runmutalyzer_reference_info_ng(self):
@@ -472,13 +472,13 @@ class TestServicesSoap(MutalyzerTest):
with patch.object(Entrez, 'efetch', mock_efetch):
r = self._call('runMutalyzer', 'NG_012772:g.18964del')
- assert_equal(r.errors, 0)
- assert_equal(r.referenceId, 'NG_012772.1')
- assert_equal(r.sourceId, 'NG_012772.1')
- assert_equal(r.sourceAccession, 'NG_012772')
- assert_equal(r.sourceVersion, '1')
- assert_equal(r.sourceGi, '256574794')
- assert_equal(r.molecule, 'g')
+ assert r.errors == 0
+ assert r.referenceId == 'NG_012772.1'
+ assert r.sourceId == 'NG_012772.1'
+ assert r.sourceAccession == 'NG_012772'
+ assert r.sourceVersion == '1'
+ assert r.sourceGi == '256574794'
+ assert r.molecule == 'g'
@fix(database, cache('NG_009105.1'))
def test_runmutalyzer_reference_info_ng_version(self):
@@ -486,13 +486,13 @@ class TestServicesSoap(MutalyzerTest):
Get reference info for an NG variant with version.
"""
r = self._call('runMutalyzer', 'NG_009105.1:g.18964del')
- assert_equal(r.errors, 0)
- assert_equal(r.referenceId, 'NG_009105.1')
- assert_equal(r.sourceId, 'NG_009105.1')
- assert_equal(r.sourceAccession, 'NG_009105')
- assert_equal(r.sourceVersion, '1')
- assert_equal(r.sourceGi, '216548283')
- assert_equal(r.molecule, 'g')
+ assert r.errors == 0
+ assert r.referenceId == 'NG_009105.1'
+ assert r.sourceId == 'NG_009105.1'
+ assert r.sourceAccession == 'NG_009105'
+ assert r.sourceVersion == '1'
+ assert r.sourceGi == '216548283'
+ assert r.molecule == 'g'
@fix(database, cache('NG_012772.1'))
def test_runmutalyzer_reference_info_gi(self):
@@ -500,13 +500,13 @@ class TestServicesSoap(MutalyzerTest):
Get reference info for a GI variant.
"""
r = self._call('runMutalyzer', 'gi256574794:g.18964del')
- assert_equal(r.errors, 0)
- assert_equal(r.referenceId, 'NG_012772.1')
- assert_equal(r.sourceId, 'NG_012772.1')
- assert_equal(r.sourceAccession, 'NG_012772')
- assert_equal(r.sourceVersion, '1')
- assert_equal(r.sourceGi, '256574794')
- assert_equal(r.molecule, 'g')
+ assert r.errors == 0
+ assert r.referenceId == 'NG_012772.1'
+ assert r.sourceId == 'NG_012772.1'
+ assert r.sourceAccession == 'NG_012772'
+ assert r.sourceVersion == '1'
+ assert r.sourceGi == '256574794'
+ assert r.molecule == 'g'
@fix(database, cache('NM_000143.3'))
def test_runmutalyzer_exons(self):
@@ -514,7 +514,7 @@ class TestServicesSoap(MutalyzerTest):
Exon table in runMutalyzer output.
"""
r = self._call('runMutalyzer', 'NM_000143.3:c.630_636del')
- assert_equal(r.errors, 0)
+ assert r.errors == 0
expected_exons = [(1, 195, '-63', '132'),
(196, 330, '133', '267'),
(331, 441, '268', '378'),
@@ -525,10 +525,9 @@ class TestServicesSoap(MutalyzerTest):
(1172, 1299, '1109', '1236'),
(1300, 1453, '1237', '1390'),
(1454, 1867, '1391', '*271')]
- assert_equal(len(r.exons.ExonInfo), len(expected_exons))
+ assert len(r.exons.ExonInfo) == len(expected_exons)
for exon, expected_exon in zip(r.exons.ExonInfo, expected_exons):
- assert_equal((exon.gStart, exon.gStop, exon.cStart, exon.cStop),
- expected_exon)
+ assert (exon.gStart, exon.gStop, exon.cStart, exon.cStop) == expected_exon
@fix(database, cache('AB026906.1', 'NM_003002.2', 'AL449423.14'))
def test_batchjob(self):
@@ -553,8 +552,7 @@ class TestServicesSoap(MutalyzerTest):
assert int(result) == 0
result = self._call('getBatchJob', job_id)
- assert_equal(len(result.decode('base64').strip().split('\n')) - 1,
- len(variants))
+ assert len(result.decode('base64').strip().split('\n')) - 1 == len(variants)
@fix(database)
def test_batchjob_newlines_unix(self):
diff --git a/tests/test_variantchecker.py b/tests/test_variantchecker.py
index bd33d09d..1b30786b 100644
--- a/tests/test_variantchecker.py
+++ b/tests/test_variantchecker.py
@@ -4,7 +4,6 @@ Tests for the variantchecker module.
#import logging; logging.basicConfig()
-from nose.tools import *
from mutalyzer.output import Output
from mutalyzer.Retriever import GenBankRetriever
@@ -42,8 +41,8 @@ class TestVariantchecker(MutalyzerTest):
level.
"""
check_variant('AL449423.14(CDKN2A_v001):c.161_163del', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.61937_61939del')
+ assert (self.output.getIndexedOutput('genomicDescription', 0) ==
+ 'AL449423.14:g.61937_61939del')
assert 'AL449423.14(CDKN2A_v001):c.161_163del' \
in self.output.getOutput('descriptions')
assert 'AL449423.14(CDKN2A_i001):p.(Met54_Gly55delinsSer)' \
@@ -57,8 +56,8 @@ class TestVariantchecker(MutalyzerTest):
level.
"""
check_variant('AL449423.14(CDKN2A_v001):c.161_162insATC', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.61938_61939insGAT')
+ assert (self.output.getIndexedOutput('genomicDescription', 0) ==
+ 'AL449423.14:g.61938_61939insGAT')
assert 'AL449423.14(CDKN2A_v001):c.161_162insATC' \
in self.output.getOutput('descriptions')
assert 'AL449423.14(CDKN2A_i001):p.(Met54delinsIleSer)' \
@@ -72,8 +71,8 @@ class TestVariantchecker(MutalyzerTest):
on protein level.
"""
check_variant('AL449423.14(CDKN2A_v001):c.161_162ins[ATC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.61938_61939insGAT')
+ assert (self.output.getIndexedOutput('genomicDescription', 0) ==
+ 'AL449423.14:g.61938_61939insGAT')
assert 'AL449423.14(CDKN2A_v001):c.161_162insATC' \
in self.output.getOutput('descriptions')
assert 'AL449423.14(CDKN2A_i001):p.(Met54delinsIleSer)' \
@@ -88,8 +87,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('AL449423.14(CDKN2A_v001):c.161_162delinsATCCC',
self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.61938_61939delinsGGGAT')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'AL449423.14:g.61938_61939delinsGGGAT'
assert 'AL449423.14(CDKN2A_v001):c.161_162delinsATCCC' \
in self.output.getOutput('descriptions')
assert 'AL449423.14(CDKN2A_i001):p.(Met54delinsAsnPro)' \
@@ -104,8 +102,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('AL449423.14(CDKN2A_v001):c.161_162delins[ATCCC]',
self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.61938_61939delinsGGGAT')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'AL449423.14:g.61938_61939delinsGGGAT'
assert 'AL449423.14(CDKN2A_v001):c.161_162delinsATCCC' \
in self.output.getOutput('descriptions')
assert 'AL449423.14(CDKN2A_i001):p.(Met54delinsAsnPro)' \
@@ -120,8 +117,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('AL449423.14(CDKN2A_v001):c.161_162delTGinsATCCC',
self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.61938_61939delinsGGGAT')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'AL449423.14:g.61938_61939delinsGGGAT'
assert 'AL449423.14(CDKN2A_v001):c.161_162delinsATCCC' \
in self.output.getOutput('descriptions')
assert 'AL449423.14(CDKN2A_i001):p.(Met54delinsAsnPro)' \
@@ -137,8 +133,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('AL449423.14(CDKN2A_v001):c.161_162delTGins[ATCCC]',
self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.61938_61939delinsGGGAT')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'AL449423.14:g.61938_61939delinsGGGAT'
assert 'AL449423.14(CDKN2A_v001):c.161_162delinsATCCC' \
in self.output.getOutput('descriptions')
assert 'AL449423.14(CDKN2A_i001):p.(Met54delinsAsnPro)' \
@@ -215,7 +210,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('NM_003002.2:c.274del', self.output)
wroll = self.output.getMessagesWithErrorCode('WROLLFORWARD')
- assert_equal(len(wroll), 0)
+ assert len(wroll) == 0
@fix(cache('NM_000088.3'))
def test_no_roll_splice(self):
@@ -226,7 +221,7 @@ class TestVariantchecker(MutalyzerTest):
wrollback = self.output.getMessagesWithErrorCode('IROLLBACK')
assert len(wrollback) > 0
wroll = self.output.getMessagesWithErrorCode('WROLLFORWARD')
- assert_equal(len(wroll), 0)
+ assert len(wroll) == 0
@fix(cache('NM_000088.3'))
def test_partial_roll_splice(self):
@@ -280,8 +275,8 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('AL449423.14:g.65470_65471insTAC', self.output)
assert 'AL449423.14(CDKN2A_v001):c.99_100insTAG' in self.output.getOutput('descriptions')
- assert_equal ('AL449423.14:g.65471_65472insACT', self.output.getIndexedOutput('genomicDescription', 0, ''))
- assert_equal(len(self.output.getMessagesWithErrorCode('WROLLFORWARD')), 1)
+ assert 'AL449423.14:g.65471_65472insACT' == self.output.getIndexedOutput('genomicDescription', 0, '')
+ assert len(self.output.getMessagesWithErrorCode('WROLLFORWARD')) == 1
@fix(cache('AL449423.14'))
def test_roll_reverse_ins(self):
@@ -291,8 +286,8 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('AL449423.14:g.65471_65472insACT', self.output)
assert 'AL449423.14(CDKN2A_v001):c.99_100insTAG' in self.output.getOutput('descriptions')
- assert_equal ('AL449423.14:g.65471_65472insACT', self.output.getIndexedOutput('genomicDescription', 0, ''))
- assert_equal(len(self.output.getMessagesWithErrorCode('WROLLFORWARD')), 0)
+ assert 'AL449423.14:g.65471_65472insACT' == self.output.getIndexedOutput('genomicDescription', 0, '')
+ assert len(self.output.getMessagesWithErrorCode('WROLLFORWARD')) == 0
@fix(cache('AL449423.14'))
def test_roll_message_forward(self):
@@ -301,8 +296,8 @@ class TestVariantchecker(MutalyzerTest):
strand (forward).
"""
check_variant('AL449423.14:g.65470_65471insTAC', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('WROLLFORWARD')), 1)
- assert_equal(len(self.output.getMessagesWithErrorCode('WROLLREVERSE')), 0)
+ assert len(self.output.getMessagesWithErrorCode('WROLLFORWARD')) == 1
+ assert len(self.output.getMessagesWithErrorCode('WROLLREVERSE')) == 0
@fix(cache('AL449423.14'))
def test_roll_message_reverse(self):
@@ -311,8 +306,8 @@ class TestVariantchecker(MutalyzerTest):
strand (reverse).
"""
check_variant('AL449423.14(CDKN2A_v001):c.98_99insGTA', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('WROLLFORWARD')), 0)
- assert_equal(len(self.output.getMessagesWithErrorCode('WROLLREVERSE')), 1)
+ assert len(self.output.getMessagesWithErrorCode('WROLLFORWARD')) == 0
+ assert len(self.output.getMessagesWithErrorCode('WROLLREVERSE')) == 1
@fix(cache('NM_000143.3'))
def test_ins_cds_start(self):
@@ -320,7 +315,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion on CDS start boundary should not be included in CDS.
"""
check_variant('NM_000143.3:c.-1_1insCAT', self.output)
- assert_equal(self.output.getIndexedOutput("newprotein", 0), None)
+ assert self.output.getIndexedOutput("newprotein", 0) == None
# Todo: Is this a good test?
@fix(cache('NM_000143.3'))
@@ -329,7 +324,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion after CDS start boundary should be included in CDS.
"""
check_variant('NM_000143.3:c.1_2insCAT', self.output)
- assert_equal(self.output.getIndexedOutput("newprotein", 0), '?')
+ assert self.output.getIndexedOutput("newprotein", 0) == '?'
# Todo: Is this a good test?
@fix(cache('NG_012772.1'))
@@ -339,7 +334,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('NG_012772.1(BRCA2_v001):c.632-5_670del', self.output)
assert len(self.output.getMessagesWithErrorCode('WOVERSPLICE')) > 0
- assert_equal(self.output.getOutput('removedSpliceSites'), [])
+ assert self.output.getOutput('removedSpliceSites') == []
# Todo: For now, the following is how to check if no protein
# prediction is done.
assert not self.output.getOutput('newprotein')
@@ -351,7 +346,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('NG_012772.1(BRCA2_v001):c.632-5_681+7del', self.output)
assert len(self.output.getMessagesWithErrorCode('WOVERSPLICE')) > 0
- assert_equal(self.output.getOutput('removedSpliceSites'), [2])
+ assert self.output.getOutput('removedSpliceSites') == [2]
# Todo: For now, the following is how to check if protein
# prediction is done.
assert self.output.getOutput('newprotein')
@@ -362,8 +357,8 @@ class TestVariantchecker(MutalyzerTest):
Deletion of exactly an exon should be possible.
"""
check_variant('NG_012772.1(BRCA2_v001):c.632_681del', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('WOVERSPLICE')), 0)
- assert_equal(self.output.getOutput('removedSpliceSites'), [2])
+ assert len(self.output.getMessagesWithErrorCode('WOVERSPLICE')) == 0
+ assert self.output.getOutput('removedSpliceSites') == [2]
# Todo: For now, the following is how to check if protein
# prediction is done.
assert self.output.getOutput('newprotein')
@@ -380,7 +375,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('NG_012772.1(BRCA2_v001):c.68-7_316+7del', self.output)
assert len(self.output.getMessagesWithErrorCode('WOVERSPLICE')) > 0
- assert_equal(self.output.getOutput('removedSpliceSites'), [2])
+ assert self.output.getOutput('removedSpliceSites') == [2]
# Todo: For now, the following is how to check if protein
# prediction is done.
assert self.output.getOutput('newprotein')
@@ -393,7 +388,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('NG_012772.1(BRCA2_v001):c.632-5_793+7del', self.output)
assert len(self.output.getMessagesWithErrorCode('WOVERSPLICE')) > 0
- assert_equal(self.output.getOutput('removedSpliceSites'), [4])
+ assert self.output.getOutput('removedSpliceSites') == [4]
# Todo: For now, the following is how to check if protein
# prediction is done.
assert self.output.getOutput('newprotein')
@@ -406,7 +401,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('NG_012772.1(BRCA2_v001):c.622_674del', self.output)
assert len(self.output.getMessagesWithErrorCode('WOVERSPLICE')) > 0
- assert_equal(self.output.getOutput('removedSpliceSites'), [2])
+ assert self.output.getOutput('removedSpliceSites') == [2]
# Todo: For now, the following is how to check if protein
# prediction is done.
assert self.output.getOutput('newprotein')
@@ -418,8 +413,8 @@ class TestVariantchecker(MutalyzerTest):
exons).
"""
check_variant('NG_012772.1(BRCA2_v001):c.681+1_682-1del', self.output)
- assert_equal(self.output.getMessagesWithErrorCode('WOVERSPLICE'), [])
- assert_equal(self.output.getOutput('removedSpliceSites'), [2])
+ assert self.output.getMessagesWithErrorCode('WOVERSPLICE') == []
+ assert self.output.getOutput('removedSpliceSites') == [2]
# Note: The protein prediction is done, but 'newprotein' is not set
# because we have no change. So to check if the prediction is done, we
# check if 'oldprotein' is set and to check if the prediction is
@@ -435,7 +430,7 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('NG_012772.1(BRCA2_v001):c.622_672del', self.output)
assert len(self.output.getMessagesWithErrorCode('WOVERSPLICE')) > 0
- assert_equal(self.output.getOutput('removedSpliceSites'), [2])
+ assert self.output.getOutput('removedSpliceSites') == [2]
# Todo: For now, the following is how to check if protein
# prediction is done.
assert self.output.getOutput('newprotein')
@@ -453,8 +448,7 @@ class TestVariantchecker(MutalyzerTest):
# prediction is done.
assert self.output.getOutput('newprotein')
# Genomic positions should be centered in flanking introns and unsure.
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_012772.1:g.(17550_19725)del')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_012772.1:g.(17550_19725)del'
assert 'NG_012772.1(BRCA2_v001):c.632-?_681+?del' \
in self.output.getOutput('descriptions')
assert 'NG_012772.1(BRCA2_i001):p.(Val211Glufs*10)' \
@@ -479,8 +473,7 @@ class TestVariantchecker(MutalyzerTest):
# prediction is done.
assert self.output.getOutput('newprotein')
# Genomic positions should be centered in flanking introns and unsure.
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_012772.1:g.(7324_11720)del')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_012772.1:g.(7324_11720)del'
assert 'NG_012772.1(BRCA2_v001):c.68-?_316+?del' \
in self.output.getOutput('descriptions')
# Todo: .c notation should still be c.632-?_681+?del, but what about
@@ -500,8 +493,7 @@ class TestVariantchecker(MutalyzerTest):
# prediction is done.
assert self.output.getOutput('newprotein')
# Genomic positions should be centered in flanking introns and unsure.
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_012772.1:g.[(17550_19725)del;19017del]')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_012772.1:g.[(17550_19725)del;19017del]'
assert 'NG_012772.1(BRCA2_v001):c.[632-?_681+?del;681+4del]' \
in self.output.getOutput('descriptions')
# Todo: .c notation should still be c.632-?_681+?del, but what about
@@ -521,8 +513,7 @@ class TestVariantchecker(MutalyzerTest):
# prediction is done.
assert self.output.getOutput('newprotein')
# Genomic positions should be centered in flanking introns and unsure.
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.(60314_63683)del')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'AL449423.14:g.(60314_63683)del'
assert 'AL449423.14(CDKN2A_v001):c.151-?_457+?del' \
in self.output.getOutput('descriptions')
# Todo: .c notation should still be c.632-?_681+?del, but what about
@@ -538,8 +529,8 @@ class TestVariantchecker(MutalyzerTest):
"""
#check_variant('NM_018723.3:c.758_890del', self.output)
check_variant('NM_000143.3:c.739_904del', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('WOVERSPLICE')), 0)
- assert_equal(self.output.getOutput('removedSpliceSites'), [2])
+ assert len(self.output.getMessagesWithErrorCode('WOVERSPLICE')) == 0
+ assert self.output.getOutput('removedSpliceSites') == [2]
# Todo: For now, the following is how to check if protein
# prediction is done.
assert self.output.getOutput('newprotein')
@@ -550,8 +541,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a sequence.
"""
check_variant('NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -562,8 +552,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a sequence on reverse strand.
"""
check_variant('NG_012337.1(TIMM8B_v001):c.12_13insGATC', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_012337.1:g.4911_4912insATCG')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_012337.1:g.4911_4912insATCG'
assert 'NG_012337.1(TIMM8B_v001):c.12_13insGATC' \
in self.output.getOutput('descriptions')
@@ -573,11 +562,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a range.
"""
check_variant('NG_008939.1:g.5207_5208ins4300_4320', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_ins_range_inv(self):
@@ -585,11 +573,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion of an inverse range.
"""
check_variant('NG_008939.1:g.5207_5208ins4300_4320inv', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGCCAGATAATGAGCACAGGAC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGCCAGATAATGAGCACAGGAC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGCCAGATAATGAGCACAGGAC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_ins_seq_list(self):
@@ -597,8 +584,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a sequence as a list.
"""
check_variant('NG_008939.1:g.5207_5208ins[GTCCTGTGCTCATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -608,8 +594,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a sequence as a list on reverse strand.
"""
check_variant('NG_012337.1(TIMM8B_v001):c.12_13ins[GATC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_012337.1:g.4911_4912insATCG')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_012337.1:g.4911_4912insATCG'
assert 'NG_012337.1(TIMM8B_v001):c.12_13insGATC' \
in self.output.getOutput('descriptions')
@@ -619,11 +604,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a range as a list.
"""
check_variant('NG_008939.1:g.5207_5208ins[4300_4320]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_ins_range_inv_list(self):
@@ -631,11 +615,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion of an inverse range as a list.
"""
check_variant('NG_008939.1:g.5207_5208ins[4300_4320inv]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGCCAGATAATGAGCACAGGAC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGCCAGATAATGAGCACAGGAC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGCCAGATAATGAGCACAGGAC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_ins_seq_seq(self):
@@ -643,8 +626,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of two sequences.
"""
check_variant('NG_008939.1:g.5207_5208ins[GTCCTGTGCTC;ATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -654,8 +636,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of two sequences on reverse strand.
"""
check_variant('NG_012337.1(TIMM8B_v001):c.12_13ins[TTT;GATC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_012337.1:g.4911_4912insATCAAAG')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_012337.1:g.4911_4912insATCAAAG'
assert 'NG_012337.1(TIMM8B_v001):c.12_13insTTTGATC' \
in self.output.getOutput('descriptions')
@@ -665,11 +646,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion of two ranges.
"""
check_variant('NG_008939.1:g.5207_5208ins[4300_4309;4310_4320]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_ins_range_range_inv(self):
@@ -677,11 +657,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a range and an inverse range.
"""
check_variant('NG_008939.1:g.5207_5208ins[4300_4309;4310_4320inv]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTGCCAGATAATG')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTGCCAGATAATG'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTGCCAGATAATG' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_ins_seq_range(self):
@@ -689,8 +668,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a sequence and a range.
"""
check_variant('NG_008939.1:g.5207_5208ins[GTCCTGTGCT;4310_4320]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -700,8 +678,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a sequence and an inverse range.
"""
check_variant('NG_008939.1:g.5207_5208ins[GTCCTGTGCT;4310_4320inv]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTGCCAGATAATG')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTGCCAGATAATG'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTGCCAGATAATG' \
in self.output.getOutput('descriptions')
@@ -711,8 +688,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a range and a sequence.
"""
check_variant('NG_008939.1:g.5207_5208ins[4300_4309;CATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -722,8 +698,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of an inverse range and a sequence.
"""
check_variant('NG_008939.1:g.5207_5208ins[4300_4309inv;CATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insAGCACAGGACCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insAGCACAGGACCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insAGCACAGGACCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -733,8 +708,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a sequence (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -744,8 +718,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a sequence as a list (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_157ins[GTCCTGTGCTCATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -755,8 +728,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of two sequences (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_157ins[GTCCTGTGCTC;ATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5208insGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_157insGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -766,7 +738,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a range (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_157ins180_188', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 1
@fix(cache('NG_008939.1'))
def test_ins_range_inv_coding(self):
@@ -774,7 +746,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of an inverse range (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_157ins180_188inv', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 1
@fix(cache('NG_008939.1'))
def test_ins_range_list_coding(self):
@@ -782,7 +754,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of a range as a list (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_157ins[180_188]', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 1
@fix(cache('NG_008939.1'))
def test_ins_range_inv_list_coding(self):
@@ -790,7 +762,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion of an inverse range as a list (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_157ins[180_188inv]', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 1
@fix(cache('NG_008939.1'))
def test_delins_seq(self):
@@ -798,8 +770,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of a sequence.
"""
check_variant('NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -809,11 +780,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of a range.
"""
check_variant('NG_008939.1:g.5207_5212delins4300_4320', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_delins_range_inv(self):
@@ -821,11 +791,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of an inverse range.
"""
check_variant('NG_008939.1:g.5207_5212delins4300_4320inv', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGCCAGATAATGAGCACAGGAC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGCCAGATAATGAGCACAGGAC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGCCAGATAATGAGCACAGGAC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_delins_seq_list(self):
@@ -833,8 +802,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of a sequence as a list.
"""
check_variant('NG_008939.1:g.5207_5212delins[GTCCTGTGCTCATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -844,11 +812,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of a range as a list.
"""
check_variant('NG_008939.1:g.5207_5212delins[4300_4320]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_delins_range_inv_list(self):
@@ -856,11 +823,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of an inverse range as a list.
"""
check_variant('NG_008939.1:g.5207_5212delins[4300_4320inv]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGCCAGATAATGAGCACAGGAC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGCCAGATAATGAGCACAGGAC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGCCAGATAATGAGCACAGGAC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_delins_seq_seq(self):
@@ -868,8 +834,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of two sequences.
"""
check_variant('NG_008939.1:g.5207_5212delins[GTCCTGTGCT;CATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -879,11 +844,10 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of two ranges.
"""
check_variant('NG_008939.1:g.5207_5212delins[4300_4309;4310_4320]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_delins_range_inv_range(self):
@@ -893,11 +857,10 @@ class TestVariantchecker(MutalyzerTest):
Note that the delins is also shortened by one position here.
"""
check_variant('NG_008939.1:g.5207_5212delins[4300_4309inv;4310_4320]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5208_5212delinsGCACAGGACCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5208_5212delinsGCACAGGACCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.157_161delinsGCACAGGACCATTATCTGGC' \
in self.output.getOutput('descriptions')
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 0)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 0
@fix(cache('NG_008939.1'))
def test_delins_seq_range(self):
@@ -905,8 +868,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of a sequence and a range.
"""
check_variant('NG_008939.1:g.5207_5212delins[GTCCTGTGCT;4310_4320]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -918,8 +880,7 @@ class TestVariantchecker(MutalyzerTest):
Note that the delins is also shortened by one position here.
"""
check_variant('NG_008939.1:g.5207_5212delins[GTCCTGTGCT;4310_4320inv]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5211delinsGTCCTGTGCTGCCAGATAAT')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5211delinsGTCCTGTGCTGCCAGATAAT'
assert 'NG_008939.1(PCCB_v001):c.156_160delinsGTCCTGTGCTGCCAGATAAT' \
in self.output.getOutput('descriptions')
@@ -929,8 +890,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of a range and a sequence.
"""
check_variant('NG_008939.1:g.5207_5212delins[4300_4309;CATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -942,8 +902,7 @@ class TestVariantchecker(MutalyzerTest):
Note that the delins is also shortened by one position here.
"""
check_variant('NG_008939.1:g.5207_5212delins[4300_4309inv;CATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5208_5212delinsGCACAGGACCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5208_5212delinsGCACAGGACCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.157_161delinsGCACAGGACCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -953,8 +912,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of a sequence (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -964,8 +922,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of a sequence as a list (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_161delins[GTCCTGTGCTCATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -975,8 +932,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of two sequences (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_161delins[GTCCTGTGCT;CATTATCTGGC]', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5207_5212delinsGTCCTGTGCTCATTATCTGGC'
assert 'NG_008939.1(PCCB_v001):c.156_161delinsGTCCTGTGCTCATTATCTGGC' \
in self.output.getOutput('descriptions')
@@ -986,7 +942,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of a range (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_161delins180_188', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 1
@fix(cache('NG_008939.1'))
def test_delins_range_inv_coding(self):
@@ -994,7 +950,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of an inverse range (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_161delins180_188inv', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 1
@fix(cache('NG_008939.1'))
def test_delins_range_list_coding(self):
@@ -1002,7 +958,7 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of a range as a list (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_161delins[180_188]', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 1
@fix(cache('NG_008939.1'))
def test_delins_range_inv_list_coding(self):
@@ -1010,14 +966,14 @@ class TestVariantchecker(MutalyzerTest):
Insertion-deletion of an inverse range as a list (coding).
"""
check_variant('NG_008939.1(PCCB_v001):c.156_161delins[180_188inv]', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 1
def test_no_reference(self):
"""
Variant description without a reference.
"""
check_variant('g.244355733del', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOREF')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOREF')) == 1
@fix(cache('NM_003002.2'), hg19, hg19_transcript_mappings)
def test_chromosomal_positions(self):
@@ -1026,8 +982,7 @@ class TestVariantchecker(MutalyzerTest):
defined.
"""
check_variant('NM_003002.2:c.274G>T', self.output)
- assert_equal(self.output.getIndexedOutput('rawVariantsChromosomal', 0),
- ('chr11', '+', [('274G>T', (111959695, 111959695))]))
+ assert self.output.getIndexedOutput('rawVariantsChromosomal', 0) == ('chr11', '+', [('274G>T', (111959695, 111959695))])
@fix(cache('NM_002001.2'))
def test_ex_notation(self):
@@ -1036,7 +991,7 @@ class TestVariantchecker(MutalyzerTest):
one exon should delete two splice sites.
"""
check_variant('NM_002001.2:c.EX1del', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('IDELSPLICE')), 1)
+ assert len(self.output.getMessagesWithErrorCode('IDELSPLICE')) == 1
@fix(cache('LRG_1'))
def test_lrg_reference(self):
@@ -1045,9 +1000,8 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('LRG_1t1:c.266G>T', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'LRG_1:g.6855G>T')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'LRG_1:g.6855G>T'
@fix(cache('NM_002001.2'))
def test_gi_reference_plain(self):
@@ -1056,9 +1010,8 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('31317229:c.6del', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- '31317229:n.105del')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicDescription', 0) == '31317229:n.105del'
assert '31317229(FCER1A_v001):c.6del' \
in self.output.getOutput('descriptions')
@@ -1069,9 +1022,8 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('GI31317229:c.6del', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- '31317229:n.105del')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicDescription', 0) == '31317229:n.105del'
assert '31317229(FCER1A_v001):c.6del' \
in self.output.getOutput('descriptions')
@@ -1082,9 +1034,8 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('GI:31317229:c.6del', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- '31317229:n.105del')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicDescription', 0) == '31317229:n.105del'
assert '31317229(FCER1A_v001):c.6del' \
in self.output.getOutput('descriptions')
@@ -1095,9 +1046,8 @@ class TestVariantchecker(MutalyzerTest):
"""
check_variant('NM_002001.2:c.1_3delinsATG', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NM_002001.2:n.=')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NM_002001.2:n.='
assert 'NM_002001.2(FCER1A_v001):c.=' \
in self.output.getOutput('descriptions')
@@ -1109,11 +1059,9 @@ class TestVariantchecker(MutalyzerTest):
ud = REFERENCES['DMD']['accession']
check_variant(ud + ':g.5T>T', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicChromDescription', 0),
- 'NC_000023.10:g.=')
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- ud + ':g.=')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicChromDescription', 0) == 'NC_000023.10:g.='
+ assert self.output.getIndexedOutput('genomicDescription', 0) == ud + ':g.='
assert ud + '(DMD_v001):c.=' \
in self.output.getOutput('descriptions')
@@ -1126,11 +1074,9 @@ class TestVariantchecker(MutalyzerTest):
ud = REFERENCES['DPYD']['accession']
check_variant(ud + '(DPYD_v1):c.85C>T', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicChromDescription', 0),
- 'NC_000001.10:g.98348885G>A')
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- ud + ':g.42731C>T')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicChromDescription', 0) == 'NC_000001.10:g.98348885G>A'
+ assert self.output.getIndexedOutput('genomicDescription', 0) == ud + ':g.42731C>T'
assert ud + '(DPYD_v001):c.85C>T' \
in self.output.getOutput('descriptions')
@@ -1142,11 +1088,9 @@ class TestVariantchecker(MutalyzerTest):
ud = REFERENCES['MARK1']['accession']
check_variant(ud + '(MARK1_v001):c.400T>C', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicChromDescription', 0),
- 'NC_000001.10:g.220773181T>C')
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- ud + ':g.76614T>C')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicChromDescription', 0) == 'NC_000001.10:g.220773181T>C'
+ assert self.output.getIndexedOutput('genomicDescription', 0) == ud + ':g.76614T>C'
assert ud + '(MARK1_v001):c.400T>C' \
in self.output.getOutput('descriptions')
@@ -1160,11 +1104,9 @@ class TestVariantchecker(MutalyzerTest):
ud = REFERENCES['chr9_reverse']['accession']
check_variant(ud + ':g.10624_78132del', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicChromDescription', 0),
- 'NC_000009.11:g.32928508_32996016del')
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- ud + ':g.10624_78132del')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicChromDescription', 0) == 'NC_000009.11:g.32928508_32996016del'
+ assert self.output.getIndexedOutput('genomicDescription', 0) == ud + ':g.10624_78132del'
@fix(cache('MARK1'))
def test_ud_forward_range(self):
@@ -1174,11 +1116,9 @@ class TestVariantchecker(MutalyzerTest):
ud = REFERENCES['MARK1']['accession']
check_variant(ud + '(MARK1_v001):c.400_415del', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicChromDescription', 0),
- 'NC_000001.10:g.220773181_220773196del')
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- ud + ':g.76614_76629del')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicChromDescription', 0) == 'NC_000001.10:g.220773181_220773196del'
+ assert self.output.getIndexedOutput('genomicDescription', 0) == ud + ':g.76614_76629del'
@fix(cache('chr9_reverse'))
def test_ud_reverse_del_length(self):
@@ -1191,11 +1131,9 @@ class TestVariantchecker(MutalyzerTest):
ud = REFERENCES['chr9_reverse']['accession']
check_variant(ud + ':g.10624_78132del67509', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicChromDescription', 0),
- 'NC_000009.11:g.32928508_32996016del')
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- ud + ':g.10624_78132del')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicChromDescription', 0) == 'NC_000009.11:g.32928508_32996016del'
+ assert self.output.getIndexedOutput('genomicDescription', 0) == ud + ':g.10624_78132del'
@fix(cache('DPYD'))
def test_ud_reverse_roll(self):
@@ -1212,11 +1150,9 @@ class TestVariantchecker(MutalyzerTest):
ud = REFERENCES['DPYD']['accession']
check_variant(ud + '(DPYD_v001):c.104del', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicChromDescription', 0),
- 'NC_000001.10:g.98348867del')
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- ud + ':g.42751del')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicChromDescription', 0) == 'NC_000001.10:g.98348867del'
+ assert self.output.getIndexedOutput('genomicDescription', 0) == ud + ':g.42751del'
assert ud + '(DPYD_v001):c.105del' \
in self.output.getOutput('descriptions')
@@ -1235,11 +1171,9 @@ class TestVariantchecker(MutalyzerTest):
ud = REFERENCES['MARK1']['accession']
check_variant(ud + '(MARK1_v001):c.400del', self.output)
error_count, _, _ = self.output.Summary()
- assert_equal(error_count, 0)
- assert_equal(self.output.getIndexedOutput('genomicChromDescription', 0),
- 'NC_000001.10:g.220773182del')
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- ud + ':g.76615del')
+ assert error_count == 0
+ assert self.output.getIndexedOutput('genomicChromDescription', 0) == 'NC_000001.10:g.220773182del'
+ assert self.output.getIndexedOutput('genomicDescription', 0) == ud + ':g.76615del'
assert ud + '(MARK1_v001):c.401del' \
in self.output.getOutput('descriptions')
@@ -1249,8 +1183,7 @@ class TestVariantchecker(MutalyzerTest):
Specify the deleted sequence in a deletion.
"""
check_variant('AL449423.14:g.65471_65472delTC', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.65471_65472del')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'AL449423.14:g.65471_65472del'
assert 'AL449423.14(CDKN2A_v001):c.98_99del' \
in self.output.getOutput('descriptions')
@@ -1260,8 +1193,7 @@ class TestVariantchecker(MutalyzerTest):
Specify the deleted sequence length in a deletion.
"""
check_variant('AL449423.14:g.65471_65472del2', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.65471_65472del')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'AL449423.14:g.65471_65472del'
assert 'AL449423.14(CDKN2A_v001):c.98_99del' \
in self.output.getOutput('descriptions')
@@ -1271,8 +1203,7 @@ class TestVariantchecker(MutalyzerTest):
Specify the deleted sequence in a deletion on the reverse strand.
"""
check_variant('AL449423.14(CDKN2A_v001):c.161_163delTGG', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.61937_61939del')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'AL449423.14:g.61937_61939del'
assert 'AL449423.14(CDKN2A_v001):c.161_163del' \
in self.output.getOutput('descriptions')
@@ -1282,8 +1213,7 @@ class TestVariantchecker(MutalyzerTest):
Specify the deleted sequence length in a deletion on the reverse strand.
"""
check_variant('AL449423.14(CDKN2A_v001):c.161_163del3', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AL449423.14:g.61937_61939del')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'AL449423.14:g.61937_61939del'
assert 'AL449423.14(CDKN2A_v001):c.161_163del' \
in self.output.getOutput('descriptions')
@@ -1294,8 +1224,7 @@ class TestVariantchecker(MutalyzerTest):
using a genomic reference.
"""
check_variant('NG_008939.1:c.155_157delAAC', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5206_5208del')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5206_5208del'
assert 'NG_008939.1(PCCB_v001):c.155_157del' \
in self.output.getOutput('descriptions')
@@ -1306,8 +1235,7 @@ class TestVariantchecker(MutalyzerTest):
using a genomic reference.
"""
check_variant('NG_008939.1:c.155_157del3', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'NG_008939.1:g.5206_5208del')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'NG_008939.1:g.5206_5208del'
assert 'NG_008939.1(PCCB_v001):c.155_157del' \
in self.output.getOutput('descriptions')
@@ -1317,8 +1245,7 @@ class TestVariantchecker(MutalyzerTest):
Inversion variant.
"""
check_variant('AB026906.1:c.274_275inv', self.output)
- assert_equal(self.output.getIndexedOutput('genomicDescription', 0),
- 'AB026906.1:g.7872_7873inv')
+ assert self.output.getIndexedOutput('genomicDescription', 0) == 'AB026906.1:g.7872_7873inv'
assert 'AB026906.1(SDHD_v001):c.274_275inv' \
in self.output.getOutput('descriptions')
@@ -1336,7 +1263,7 @@ class TestVariantchecker(MutalyzerTest):
Currently protein level descriptions are not implemented.
"""
check_variant('NG_009105.1(OPN1LW):p.=', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 1
@fix(cache('NP_064445.1'))
def test_protein_reference(self):
@@ -1344,7 +1271,7 @@ class TestVariantchecker(MutalyzerTest):
Currently protein references are not implemented.
"""
check_variant('NP_064445.1:p.=', self.output)
- assert_equal(len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')), 1)
+ assert len(self.output.getMessagesWithErrorCode('ENOTIMPLEMENTED')) == 1
@fix(cache('A1BG'))
def test_wnomrna_other(self):
diff --git a/tests/test_website.py b/tests/test_website.py
index 04562466..6b1e75d0 100644
--- a/tests/test_website.py
+++ b/tests/test_website.py
@@ -19,7 +19,6 @@ import urllib2
from Bio import Entrez
import lxml.html
-from nose.tools import *
import mutalyzer
from mutalyzer import Scheduler
@@ -46,7 +45,7 @@ class TestWebsite(MutalyzerTest):
Expect the index HTML page.
"""
r = self.app.get('/')
- assert_equal(r.status_code, 200)
+ assert r.status_code == 200
assert 'Welcome to the Mutalyzer website' in r.data
def test_about(self):
@@ -54,7 +53,7 @@ class TestWebsite(MutalyzerTest):
See if people get proper credit.
"""
r = self.app.get('/about')
- assert_equal(r.status, '200 OK')
+ assert r.status == '200 OK'
assert 'Jonathan Vis' in r.data
def test_non_existing(self):
@@ -62,7 +61,7 @@ class TestWebsite(MutalyzerTest):
Expect a 404 response.
"""
r = self.app.get('/this/doesnotexist')
- assert_equal(r.status_code, 404)
+ assert r.status_code == 404
@fix(database)
def test_menu_links(self):
@@ -84,7 +83,7 @@ class TestWebsite(MutalyzerTest):
href = '/' + href
r = self.app.get(href)
- assert_equal(r.status_code, 200)
+ assert r.status_code == 200
def test_description_extractor(self):
"""
@@ -275,7 +274,7 @@ class TestWebsite(MutalyzerTest):
r = self.app.get(result_url)
assert 'text/plain' in r.headers['Content-Type']
assert header in r.data
- assert_equal(len(r.data.strip().split('\n')) - 1, lines)
+ assert len(r.data.strip().split('\n')) - 1 == lines
return r.data
@@ -469,7 +468,7 @@ class TestWebsite(MutalyzerTest):
header='Input\tStatus',
lines=len(variants))
for line in result.splitlines()[1:]:
- assert_equal(len(line.split('\t')), len(variants[0]) * 2)
+ assert len(line.split('\t')) == len(variants[0]) * 2
def test_download_py(self):
"""
@@ -492,7 +491,7 @@ class TestWebsite(MutalyzerTest):
Download a C# example client for the web service.
"""
r = self.app.get('/downloads/client-mono.cs')
- assert_equal(r.headers['Content-Type'], 'text/plain')
+ assert r.headers['Content-Type'] == 'text/plain'
assert 'public static void Main(String [] args) {' in r.data
def test_download_php(self):
@@ -547,7 +546,7 @@ class TestWebsite(MutalyzerTest):
'var': 'g.48374289_48374389del'})
assert 'text/plain' in r.headers['Content-Type']
expected = '\n'.join(['1020', '0', '1072', '48', '48374289', '48374389', 'del'])
- assert_equal(r.data, expected)
+ assert r.data == expected
@fix(database, hg19, hg19_transcript_mappings)
def test_variantinfo_c2g(self):
@@ -561,7 +560,7 @@ class TestWebsite(MutalyzerTest):
'var': 'c.1020_1072+48del'})
assert 'text/plain' in r.headers['Content-Type']
expected = '\n'.join(['1020', '0', '1072', '48', '48374289', '48374389', 'del'])
- assert_equal(r.data, expected)
+ assert r.data == expected
@fix(database, hg19, hg19_transcript_mappings)
def test_variantinfo_c2g_downstream(self):
@@ -576,7 +575,7 @@ class TestWebsite(MutalyzerTest):
'var': 'c.1709+d187del'})
assert 'text/plain' in r.headers['Content-Type']
expected = '\n'.join(['1709', '187', '1709', '187', '48379389', '48379389', 'del'])
- assert_equal(r.data, expected)
+ assert r.data == expected
@fix(database, hg19, hg19_transcript_mappings)
def test_variantinfo_no_variant(self):
@@ -588,9 +587,9 @@ class TestWebsite(MutalyzerTest):
'build': 'hg19',
'acc': 'NM_203473.1'})
assert 'text/plain' in r.headers['Content-Type']
- assert_equal(r.content_type, 'text/plain')
+ assert r.content_type == 'text/plain'
expected = '\n'.join(['-158', '1709', '1371'])
- assert_equal(r.data, expected)
+ assert r.data == expected
@fix(database, hg19, hg19_transcript_mappings)
def test_variantinfo_ivs(self):
@@ -604,7 +603,7 @@ class TestWebsite(MutalyzerTest):
'var': 'c.IVS10+3A>G'})
assert 'text/plain' in r.headers['Content-Type']
expected = '\n'.join(['884', '3', '884', '3', '37059093', '37059093', 'subst'])
- assert_equal(r.data, expected)
+ assert r.data == expected
@fix(database)
def test_upload_local_file(self):
@@ -623,7 +622,7 @@ class TestWebsite(MutalyzerTest):
reference_url = dom.cssselect('#reference_download')[0].attrib['href']
r = self.app.get(reference_url)
- assert_equal(r.data, bz2.BZ2File(path).read())
+ assert r.data == bz2.BZ2File(path).read()
@fix(database)
def test_upload_local_file_invalid(self):
@@ -649,7 +648,7 @@ class TestWebsite(MutalyzerTest):
path = os.path.join(os.path.dirname(os.path.realpath(__file__)),
'data',
'NM_002001.2.gb.bz2')
- assert_equal(r.data, bz2.BZ2File(path).read())
+ assert r.data == bz2.BZ2File(path).read()
@fix(database, cache('NM_002001.2'))
def test_reference_head(self):
@@ -661,7 +660,7 @@ class TestWebsite(MutalyzerTest):
assert '0 Errors' in r.data
r = self.app.head('/reference/NM_002001.2.gb')
- assert_equal(r.status_code, 200)
+ assert r.status_code == 200
@fix(database)
def test_reference_head_none(self):
@@ -669,7 +668,7 @@ class TestWebsite(MutalyzerTest):
Test if non-existing reference files gives a 404 on a HEAD request.
"""
r = self.app.head('/reference/NM_002001.2.gb')
- assert_equal(r.status_code, 404)
+ assert r.status_code == 404
@fix(database, hg19, hg19_transcript_mappings, cache('NM_003002.2'))
def test_bed(self):
--
GitLab