diff --git a/mutalyzer/services/rpc.py b/mutalyzer/services/rpc.py
index 770271128c6012bedb2139eff9cd58ce5e7a6edb..3e3264175fa083ce1b1490c30e11c3fb774705fb 100644
--- a/mutalyzer/services/rpc.py
+++ b/mutalyzer/services/rpc.py
@@ -1240,6 +1240,11 @@ class MutalyzerService(ServiceBase):
output.addMessage(__file__, -1, 'INFO',
'Received request descriptionExtract')
+ if not settings.TESTING and (len(reference) > 1000 or
+ len(observed) > 1000):
+ raise Fault('EMAXSIZE',
+ 'Input sequences are restricted to 1000bp.')
+
allele = extractor.describe_dna(reference, observed)
result = Allele()
diff --git a/mutalyzer/util.py b/mutalyzer/util.py
index 4bf06e3effef5fe56f507e7dd0a82f2594aab8b4..4a3ac13c1dc73d165cff23a68571341629e29dfa 100644
--- a/mutalyzer/util.py
+++ b/mutalyzer/util.py
@@ -29,6 +29,7 @@ import operator
import sys
import time
+from Bio import SeqIO
from Bio.SeqUtils import seq3
# NOTE: This is a temporary fix.
@@ -352,6 +353,46 @@ def is_dna(s):
#is_dna
+def guess_file_type(handle):
+ """
+ Guess the file type of an NGS data file.
+
+ We assume that the stream is rewinded before use, after use, the input
+ stream will be rewinded.
+
+ :arg stream handle: Open readable handle to an NGS data file.
+
+ :returns unicode: Either 'fasta', 'fastq' or 'text'.
+ """
+ token = handle.read(1)
+ handle.seek(0)
+
+ if token == '>':
+ return 'fasta'
+ elif token == '@':
+ return 'fastq'
+ return 'text'
+
+
+def read_dna(handle):
+ """
+ Read the first record in an NGS data file.
+
+ If the format is not recognised as FASTA or FASTQ, we assume that the input
+ is in plain text. In this case, all non-DNA characters are removed.
+
+ :arg stream handle: Open readable handle to an NGS data file.
+
+ :returns unicode: Content of the first record in the file.
+ """
+ file_format = guess_file_type(handle)
+
+ if file_format != 'text':
+ return unicode(SeqIO.parse(handle, file_format).next().seq)
+
+ return ''.join(x for x in unicode(handle.read()) if x in 'ATCG')
+
+
def in_frame_description(s1, s2) :
"""
Give a description of an inframe difference of two proteins. Also give
diff --git a/mutalyzer/website/templates/about.html b/mutalyzer/website/templates/about.html
index 9ebed3da3a04e3be6c5e162cf7a9043acf57e26c..c8ddf49fb25c29424246c0b6c610562b6513839d 100644
--- a/mutalyzer/website/templates/about.html
+++ b/mutalyzer/website/templates/about.html
@@ -17,8 +17,8 @@ F.J. Laros, with the following exceptions:
written by Gerard C.P. Schaafsma.</li>
<li>Current development and maintenance is done by Martijn
Vermaat.</li>
- <li>Automatic extraction of variant descriptions is implemented by
- Jonathan Vis.</li>
+ <li><a href="https://github.com/mutalyzer/description-extractor">Automatic
+ extraction of variant descriptions</a> is implemented by Jonathan Vis.</li>
</ul>
<p>
diff --git a/mutalyzer/website/templates/description-extractor.html b/mutalyzer/website/templates/description-extractor.html
index d1d8917a4b82ff92d7145e05a2248ecbd0b6ab6b..5927bf3e21152477f18311d5b429012ae47c3dc9 100644
--- a/mutalyzer/website/templates/description-extractor.html
+++ b/mutalyzer/website/templates/description-extractor.html
@@ -5,7 +5,10 @@
{% block content %}
-<p class="alert alert-warning">Note that this is an experimental service.</p
+<p class="alert alert-warning">
+Please note that this is an experimental service and we are currently limiting
+input sequences to 1000bp.
+</p>
<p>
Extract the HGVS variant description from a reference sequence and an observed
@@ -25,20 +28,126 @@ testing phase, we plan to use the underlying algorithm for:
</li>
</ul>
+<p>
+The algorithm is implemented in
+the <a href="https://github.com/mutalyzer/description-extractor">HGVS variant
+description extractor</a>. To apply it on longer input sequences than accepted
+on this page, you can download that package and run it locally.
+</p>
+
<p>
Please supply a reference sequence and an observed sequence.
</p>
-<form action="{{ url_for('.description_extractor') }}" method="get" class="form">
- <div class="form-group">
- <label for="reference_sequence">Reference sequence</label>
- <input type="text" name="reference_sequence" id="reference_sequence" value="{{ reference_sequence }}" class="form-control form-pre example-target" placeholder="Reference sequence">
- <p>Example: <code class="example-input">ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA</code></p>
+<form enctype="multipart/form-data" action="{{ url_for('.description_extractor') }}" method="post" class="form" id="invoer">
+ <div class="row">
+ <h4>Reference input</h4>
+ <div class="col-md-6">
+ <div class="form-group" id="input-methods">
+ <div class="radio">
+ <label>
+ <input type="radio" name="reference_method" value="raw_method" class="input-select" data-context="select-form1" data-for="reference_raw_method" {{ 'checked' if reference_method == 'raw_method' or not reference_method }}>
+ Enter a sequence (FASTA, FASTQ, or plain text).
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="reference_method" value="file_method" class="input-select" data-context="select-form1" data-for="reference_file_method" {{ 'checked' if reference_method == 'file_method' }}>
+ Upload a file (FASTA, FASTQ, or plain text).
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="reference_method" value="refseq_method" class="input-select" data-context="select-form1" data-for="reference_refseq_method" {{ 'checked' if reference_method == 'refseq_method' }}>
+ Enter a RefSeq accession number.
+ </label>
+ </div>
+ </div>
+ </div>
+
+ <div id="select-form1">
+ <div class="col-md-6">
+ <div class="subform" id="reference_raw_method" style="display: {{ '' if reference_method == 'raw_method' or not reference_method else 'none' }}">
+ <div class="form-group">
+ <label for="reference_sequence">Reference sequence</label>
+ <textarea name="reference_sequence" id="reference_sequence" class="form-control form-pre example-target" placeholder="Reference sequence">{{ reference_sequence }}</textarea>
+ <p>Example: <code class="example-input" data-for="reference_sequence">ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA</code></p>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-6">
+ <div class="subform" id="reference_file_method" style="display: {{ 'none' if reference_method != 'file_method' }}">
+ <div class="form-group">
+ <label for="reference_file">Reference file</label>
+ <input type="file" name="reference_file" id="reference_file">
+ </div>
+ </div>
+ </div>
+ <div class="col-md-6">
+ <div class="subform" id="reference_refseq_method" style="display: {{ 'none' if reference_method != 'refseq_method' }}">
+ <div class="form-group">
+ <label for="reference_accession_number">Reference accession number</label>
+ <input type="text" name="reference_accession_number" id="reference_accession_number" value="{{ reference_accession_number }}" class="form-control form-pre example-target" placeholder="Reference accession number">
+ <p>Example: <code class="example-input" data-for="reference_accession_number">NM_198697.1</code></p>
+ </div>
+ </div>
+ </div>
+ </div>
</div>
- <div class="form-group">
- <label for="variant_sequence">Observed sequence</label>
- <input type="text" name="variant_sequence" id="variant_sequence" value="{{ variant_sequence }}" class="form-control form-pre example-target-2" placeholder="Observed sequence">
- <p>Example: <code class="example-input-2">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
+
+ <div class="row">
+ <h4>Sample input</h4>
+ <div class="col-md-6">
+ <div class="form-group" id="input-methods">
+ <div class="radio">
+ <label>
+ <input type="radio" name="sample_method" value="raw_method" class="input-select" data-context="select-form2" data-for="sample_raw_method" {{ 'checked' if sample_method == 'raw_method' or not sample_method }}>
+ Enter a sequence (FASTA, FASTQ, or plain text).
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="sample_method" value="file_method" class="input-select" data-context="select-form2" data-for="sample_file_method" {{ 'checked' if sample_method == 'file_method' }}>
+ Upload a file (FASTA, FASTQ, or plain text).
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="sample_method" value="refseq_method" class="input-select" data-context="select-form2" data-for="sample_refseq_method" {{ 'checked' if sample_method == 'refseq_method' }}>
+ Enter a RefSeq accession number.
+ </label>
+ </div>
+ </div>
+ </div>
+
+ <div id="select-form2">
+ <div class="col-md-6">
+ <div class="subform" id="sample_raw_method" style="display: {{ '' if sample_method == 'raw_method' or not sample_method else 'none' }}">
+ <div class="form-group">
+ <label for="sample_sequence">Sample sequence</label>
+ <textarea name="sample_sequence" id="sample_sequence" class="form-control form-pre example-target-2" placeholder="Sample sequence">{{ sample_sequence }}</textarea>
+ <p>Example: <code class="example-input" data-for="sample_sequence">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-6">
+ <div class="subform" id="sample_file_method" style="display: {{ 'none' if sample_method != 'file_method' }}">
+ <div class="form-group">
+ <label for="sample_file">Reference file</label>
+ <input type="file" name="sample_file" id="sample_file">
+ </div>
+ </div>
+ </div>
+ <div class="col-md-6">
+ <div class="subform" id="sample_refseq_method" style="display: {{ 'none' if sample_method != 'refseq_method' }}">
+ <div class="form-group">
+ <label for="sample_accession_number">Sample accession number</label>
+ <input type="text" name="sample_accession_number" id="sample_accession_number" value="{{ sample_accession_number }}" class="form-control form-pre example-target-2" placeholder="Sample accession number">
+ <p>Example: <code class="example-input" data-for="sample_accession_number">NM_198697.2</code></p>
+ </div>
+ </div>
+ </div>
+ </div>
</div>
<div class="form-group">
<input type="submit" class="btn btn-primary" value="Extract variant description">
@@ -46,7 +155,7 @@ Please supply a reference sequence and an observed sequence.
</div>
</form>
-{% if description %}
+{% if reference_method and sample_method %}
<hr>
{% for m in messages %}
{% if m.class == "error" %}
@@ -69,8 +178,44 @@ Please supply a reference sequence and an observed sequence.
{% if not errors %}
<hr>
- <h4>Genomic description</h4>
- <p><code>g.{{ description }}</code></p>
+ <h4>Input</h4>
+ <table class="table">
+ <thead>
+ <tr>
+ <th>Field</th>
+ <th>Value</th>
+ </tr>
+ </thead>
+ <tbody>
+ <tr>
+ <td>Reference input</td>
+ <td>
+ {% if reference_method == 'raw_method' %}
+ <code>{{ reference_sequence|short(40) }}</code>
+ {% elif reference_method == 'file_method' %}
+ File upload
+ {% elif reference_method == 'refseq_method' %}
+ {{ reference_accession_number }}
+ {% endif %}
+ </td>
+ </tr>
+ <tr>
+ <td>Sample input</td>
+ <td>
+ {% if sample_method == 'raw_method' %}
+ <code>{{ sample_sequence|short(40) }}</code>
+ {% elif sample_method == 'file_method' %}
+ File upload
+ {% elif sample_method == 'refseq_method' %}
+ {{ sample_accession_number }}
+ {% endif %}
+ </td>
+ </tr>
+ </tbody>
+ </table>
+
+ <h4>Description</h4>
+ <p><pre class="description">{{ raw_vars|string }}</pre></p>
<h4>Overview of the raw variants</h4>
<table class="table">
@@ -86,17 +231,17 @@ Please supply a reference sequence and an observed sequence.
</tr>
</thead>
<tbody>
- {% for raw_var in raw_vars %}
- <tr>
- <td>{{ raw_var.start }}</td>
- <td>{{ raw_var.end }}</td>
- <td>{{ raw_var.type }}</td>
- <td>{{ raw_var.deleted }}</td>
- <td>{{ raw_var.inserted }}</td>
- <td>{{ raw_var.shift }}</td>
- <td>{{ raw_var }}</td>
- </tr>
- {% endfor %}
+ {% for raw_var in raw_vars %}
+ <tr>
+ <td>{{ raw_var.start }}</td>
+ <td>{{ raw_var.end }}</td>
+ <td>{{ raw_var.type }}</td>
+ <td><code>{{ raw_var.deleted|string|short }}</code></td>
+ <td><code>{{ raw_var.inserted|string|short }}</code></td>
+ <td>{{ raw_var.shift }}</td>
+ <td>{% if raw_var|string|length > 20 %}Too long to show{% else %}<code>{{ raw_var|string }}</code>{% endif %}</td>
+ </tr>
+ {% endfor %}
</tbody>
</table>
{% endif %}{# not errors #}
diff --git a/mutalyzer/website/templates/reference-loader.html b/mutalyzer/website/templates/reference-loader.html
index 0e8b56177618607dedc5068f177d97637375c865..d4b4c755adb244875559fc9c38591811f79d4d74 100644
--- a/mutalyzer/website/templates/reference-loader.html
+++ b/mutalyzer/website/templates/reference-loader.html
@@ -5,14 +5,6 @@
{% block content %}
-<script>
-var oldLoad = window.onload;
-window.onload=function(){
- if (oldLoad) oldLoad();
- updateVisibility();
-}
-</script>
-
<p>
The Reference File Loader allows you to use your own reference
sequence when no appropriate RefSeq, GenBank or LRG file is available.
@@ -22,138 +14,140 @@ Please select one of the options below to upload or retrieve your reference
sequence (maximum size is {{ max_file_size }} megabytes).
</p>
-<form name="invoer" enctype="multipart/form-data" action="{{ url_for('.reference_loader') }}" method="post">
+<form name="invoer" enctype="multipart/form-data" action="{{ url_for('.reference_loader') }}" method="post" id="invoer">
<div class="row">
<div class="col-md-6">
<div class="form-group" id="input-methods">
<div class="radio">
<label>
- <input type="radio" name="method" value="upload" checked >
+ <input class="input-select" type="radio" name="method" value="upload_method" data-context="select-form" data-for="upload_method" checked >
The reference sequence file is a local file.
</label>
</div>
<div class="radio">
<label>
- <input type="radio" name="method" value="url" >
+ <input class="input-select" type="radio" name="method" value="url_method" data-context="select-form" data-for="url_method" >
The reference sequence file can be found at the following URL.
</label>
</div>
<div class="radio">
<label>
- <input type="radio" name="method" value="slice_gene" >
+ <input class="input-select" type="radio" name="method" value="slice_gene_method" data-context="select-form" data-for="slice_gene_method" >
Retrieve part of the reference genome for a (HGNC) gene symbol.
</label>
</div>
<div class="radio">
<label>
- <input type="radio" name="method" value="slice_accession" >
+ <input class="input-select" type="radio" name="method" value="slice_accession_method" data-context="select-form" data-for="slice_accession_method" >
Retrieve a range of a chromosome by accession number.
</label>
</div>
<div class="radio">
<label>
- <input type="radio" name="method" value="slice_chromosome" >
+ <input class="input-select" type="radio" name="method" value="slice_chromosome_method" data-context="select-form" data-for="slice_chromosome_method" >
Retrieve a range of a chromosome by name.
</label>
</div>
</div>
</div>
- <script type="text/javascript">
- $('#input-methods input').on('change', updateVisibility);
- </script>
-
- <div class="col-md-6">
- <div class="form-group" id="upload_label">
- <label for="file">GenBank file</label>
- <input type="file" name="file" id="file">
- <p class="help-block">Please select the GenBank file in plain text format.</p>
- </div>
-
- <div class="form-group" id="url_label">
- <label for="url">GenBank file URL</label>
- <input type="text" name="url" id="url" class="form-control">
- <p class="help-block">Please enter the URL of the GenBank file in plain text (including http://).</p>
- </div>
-
- <div id="slice_gene_label">
- <div class="form-group">
- <p class="help-block">Please enter the Gene symbol and organism name without spaces
- and specify the length of the flanking sequences.</p>
- <p class="help-block"><b>Note:</b> This uses
- the <a href="http://www.ncbi.nlm.nih.gov/sites/gquery">NCBI
- Entrez</a> search engine and is therefore based on the current
- Entrez assembly for the given organism (GRCh38/hg38 for human).</p>
- <label for="genesymbol">Gene symbol</label>
- <input type="text" name="genesymbol" id="genesymbol" class="form-control">
- </div>
- <div class="form-group">
- <label for="organism">Organism name</label>
- <input type="text" name="organism" id="organism" class="form-control">
- </div>
- <div class="form-group">
- <label for="upstream">Number of 5' flanking nucleotides</label>
- <input type="text" name="upstream" id="upstream" value="5000" class="form-control">
- </div>
- <div class="form-group">
- <label for="downstream"><td>Number of 3' flanking nucleotides</label>
- <input type="text" name="downstream" id="downstream" value="2000" class="form-control">
+ <div id="select-form">
+ <div class="col-md-6">
+ <div class="subform" id="upload_method">
+ <div class="form-group">
+ <label for="file">GenBank file</label>
+ <input type="file" name="file" id="file">
+ <p class="help-block">Please select the GenBank file in plain text format.</p>
+ </div>
</div>
- </div>
- <div id="slice_accession_label">
- <div class="form-group">
- <p class="help-block">Please enter the accession number of the chromosome or contig and specify the range.</p>
- <label for="accession">Chromosome accession number</label>
- <input type="text" name="accession" id="accession" class="form-control">
- </div>
- <div class="form-group">
- <label for="accession_start">Start position</label>
- <input type="text" name="accession_start" id="accession_start" class="form-control">
- </div>
- <div class="form-group">
- <label for="accession_stop">Stop position</label>
- <input type="text" name="accession_stop" id="accession_stop" class="form-control">
+ <div class="subform" id="url_method" style="display: none">
+ <div class="form-group">
+ <label for="url">GenBank file URL</label>
+ <input type="text" name="url" id="url" class="form-control">
+ <p class="help-block">Please enter the URL of the GenBank file in plain text (including http://).</p>
+ </div>
</div>
- <div class="form-group">
- <label>Orientation</label>
- <div class="radio"><label><input type="radio" name="accession_orientation" value="1" checked> Forward</label></div>
- <div class="radio"><label><input type="radio" name="accession_orientation" value="2"> Reverse</label></div>
- </div>
- </div>
- <div id="slice_chromosome_label">
- <div class="form-group">
- <p class="help-block">Please enter the name of the chromosome and specify the range.</p>
- <label for="assembly_name_or_alias">Assembly</label>
- <select name="assembly_name_or_alias" id="assembly_name_or_alias" class="form-control">
- {% for assembly in assemblies %}
- <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{assembly.alias }}){% endif %}</option>
- {% endfor %}
- </select>
+ <div class="subform" id="slice_gene_method" style="display: none">
+ <div class="form-group">
+ <p class="help-block">Please enter the Gene symbol and organism name without spaces
+ and specify the length of the flanking sequences.</p>
+ <p class="help-block"><b>Note:</b> This uses
+ the <a href="http://www.ncbi.nlm.nih.gov/sites/gquery">NCBI
+ Entrez</a> search engine and is therefore based on the current
+ Entrez assembly for the given organism (GRCh38/hg38 for human).</p>
+ <label for="genesymbol">Gene symbol</label>
+ <input type="text" name="genesymbol" id="genesymbol" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="organism">Organism name</label>
+ <input type="text" name="organism" id="organism" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="upstream">Number of 5' flanking nucleotides</label>
+ <input type="text" name="upstream" id="upstream" value="5000" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="downstream"><td>Number of 3' flanking nucleotides</label>
+ <input type="text" name="downstream" id="downstream" value="2000" class="form-control">
+ </div>
</div>
- <div class="form-group">
- <label for="chromosome">Chromosome name</label>
- <input type="text" name="chromosome" id="chromosome" class="form-control">
- </div>
- <div class="form-group">
- <label for="chromosome_start">Start position</label>
- <input type="text" name="chromosome_start" id="chromosome_start" class="form-control">
- </div>
- <div class="form-group">
- <label for="chromosome_stop">Stop position</label>
- <input type="text" name="chromosome_stop" id="chromosome_stop" class="form-control">
+
+ <div class="subform" id="slice_accession_method" style="display: none">
+ <div class="form-group">
+ <p class="help-block">Please enter the accession number of the chromosome or contig and specify the range.</p>
+ <label for="accession">Chromosome accession number</label>
+ <input type="text" name="accession" id="accession" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="accession_start">Start position</label>
+ <input type="text" name="accession_start" id="accession_start" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="accession_stop">Stop position</label>
+ <input type="text" name="accession_stop" id="accession_stop" class="form-control">
+ </div>
+ <div class="form-group">
+ <label>Orientation</label>
+ <div class="radio"><label><input type="radio" name="accession_orientation" value="1" checked> Forward</label></div>
+ <div class="radio"><label><input type="radio" name="accession_orientation" value="2"> Reverse</label></div>
+ </div>
</div>
- <div class="form-group">
- <label for="chromosome_orientation">Orientation</label>
- <div class="radio"><label><input type="radio" name="chromosome_orientation" value="1" checked> Forward</label></div>
- <div class="radio"><label><input type="radio" name="chromosome_orientation" value="2"> Reverse</label></div>
+
+ <div class="subform" id="slice_chromosome_method" style="display: none">
+ <div class="form-group">
+ <p class="help-block">Please enter the name of the chromosome and specify the range.</p>
+ <label for="assembly_name_or_alias">Assembly</label>
+ <select name="assembly_name_or_alias" id="assembly_name_or_alias" class="form-control">
+ {% for assembly in assemblies %}
+ <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{assembly.alias }}){% endif %}</option>
+ {% endfor %}
+ </select>
+ </div>
+ <div class="form-group">
+ <label for="chromosome">Chromosome name</label>
+ <input type="text" name="chromosome" id="chromosome" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="chromosome_start">Start position</label>
+ <input type="text" name="chromosome_start" id="chromosome_start" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="chromosome_stop">Stop position</label>
+ <input type="text" name="chromosome_stop" id="chromosome_stop" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="chromosome_orientation">Orientation</label>
+ <div class="radio"><label><input type="radio" name="chromosome_orientation" value="1" checked> Forward</label></div>
+ <div class="radio"><label><input type="radio" name="chromosome_orientation" value="2"> Reverse</label></div>
+ </div>
</div>
</div>
</div>
</div>
<div class="form-group">
- <input type="submit" value="Load reference file"class="btn btn-primary">
+ <input type="submit" value="Load reference file" class="btn btn-primary">
<a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/ReferenceLoader" target="_blank" class="btn btn-default pull-right">Help</a>
</div>
</form>
diff --git a/mutalyzer/website/templates/static/css/style.css b/mutalyzer/website/templates/static/css/style.css
index 81552a68939211520f20faa61da6b8d1f6976c0c..b4b391002bc0ac4b7f048d73998c0677796b1465 100644
--- a/mutalyzer/website/templates/static/css/style.css
+++ b/mutalyzer/website/templates/static/css/style.css
@@ -136,6 +136,10 @@ input[type="text"].form-pre{
font-family: Menlo, Monaco, Consolas, "Courier New", monospace;
}
+textarea.form-pre{
+ font-family: Menlo, Monaco, Consolas, "Courier New", monospace;
+}
+
code {
/* color: #0B9B33;
background-color: #F2F9F3;*/
@@ -144,9 +148,11 @@ code {
white-space: normal;
}
-pre{
-/* margin: 15px 30px;*/
+pre.description {
+ white-space: pre-wrap;
+ max-height: 300px;
}
+
header.main-header {
height: 80px;
/* width: 649px;*/
@@ -372,12 +378,12 @@ header.main-header {
float: right;
}
-.example-input, .example-input-2 {
+.example-input {
cursor: pointer;
color: #0B9B33;
}
-.example-input:hover, .example-input-2:hover {
+.example-input:hover {
color: #F2F9F3;
background-color: #5BC779;
}
diff --git a/mutalyzer/website/templates/static/js/interface.js b/mutalyzer/website/templates/static/js/interface.js
index 44c4e8c21da49b3ac5343fcc2b96fc1805d2fa22..88897ee4a3a591251089d30ec2b5057e170d5c7f 100644
--- a/mutalyzer/website/templates/static/js/interface.js
+++ b/mutalyzer/website/templates/static/js/interface.js
@@ -1,70 +1,52 @@
-function updateVisibility() {
- document.getElementById('upload_label').style.display = "none";
- document.getElementById('url_label').style.display = "none";
- document.getElementById('slice_gene_label').style.display = "none";
- document.getElementById('slice_accession_label').style.display = "none";
- document.getElementById('slice_chromosome_label').style.display = "none";
-
- for (i = 0; i < document.invoer.method.length; i++) {
- if (document.invoer.method[i].checked) {
- if (document.invoer.method[i].value == 'upload') {
- document.getElementById('upload_label').style.display = "";
- }
- else if (document.invoer.method[i].value == 'url') {
- document.getElementById('url_label').style.display = "";
- }
- else if (document.invoer.method[i].value == 'slice_gene') {
- document.getElementById('slice_gene_label').style.display = "";
- }
- else if (document.invoer.method[i].value == 'slice_accession') {
- document.getElementById('slice_accession_label').style.display = "";
- }
- else if (document.invoer.method[i].value == 'slice_chromosome') {
- document.getElementById('slice_chromosome_label').style.display = "";
- }
- }//if
- }//for
-}//updateVisibility
-
-//Toggle the build option in the batch.html page
+// Toggle the build option in the batch.html page.
function changeBatch(sel) {
- var opt = $(sel).val();
- // var opt = sel.options[sel.selectedIndex].value;
- if(opt=='position-converter') {
- document.getElementById('assembly_name_or_alias').style.display = "";
- } else {
- document.getElementById('assembly_name_or_alias').style.display = "none";
- }
+ var opt = $(sel).val();
+
+ if(opt == 'position-converter') {
+ $('#assembly_name_or_alias').show();
+ }
+ else {
+ $('#assembly_name_or_alias').hide();
+ }
}
function toggle_visibility(id) {
- var e = document.getElementById(id);
- if (e.style.display == 'block') {
- e.style.display = 'none';
- } else {
- e.style.display = 'block';
- }
+ $(document.getElementById(id)).toggle();
}
function onloadBatch() {
- changeBatch($('input[name="job_type"]:checked'));
+ changeBatch($('input[name="job_type"]:checked'));
}
function clearField(form, fieldName) {
- for (var i = 0; i < form.elements.length; i++) {
- if (form.elements[i].name == fieldName) {
- form.elements[i].value = '';
- }
+ var i;
+
+ for (i = 0; i < form.elements.length; i++) {
+ if (form.elements[i].name == fieldName) {
+ form.elements[i].value = '';
}
+ }
}
$(document).ready(function() {
- $('.example-input').on('click', function() {
- $('.example-target').val($(this).text());
- return false;
- });
- $('.example-input-2').on('click', function() {
- $('.example-target-2').val($(this).text());
- return false;
- });
-})
+ $('.example-input').on('click', function() {
+ var target = document.getElementById($(this).data('for'));
+
+ $(target).val($(this).text());
+ return false;
+ });
+
+ $('.input-select').on('change', function() {
+ var context = document.getElementById(
+ $(this).data('context')).getElementsByClassName('subform'),
+ target = document.getElementById($(this).data('for')),
+ i;
+
+ for (i = 0; i < context.length; i++) {
+ context[i].style.display = 'none';
+ }
+ target.style.display = '';
+
+ return false;
+ });
+});
diff --git a/mutalyzer/website/views.py b/mutalyzer/website/views.py
index 0136564bf2b3311410cc1caf0d91b5f58058dfff..fffb8bb68e4c3ac1c6a2cdfc41ba61e0349c02f4 100644
--- a/mutalyzer/website/views.py
+++ b/mutalyzer/website/views.py
@@ -9,6 +9,7 @@ import bz2
import os
import pkg_resources
import re
+import StringIO
import urllib
from flask import Blueprint
@@ -68,6 +69,13 @@ def request_terms():
return terms
+@website.app_template_filter('short')
+def short_seq_filter(s, max_len=21):
+ if len(s) > max_len:
+ return s[:max_len / 2 - 1] + '...' + s[-max_len / 2 + 2:]
+ return s
+
+
@website.context_processor
def add_globals():
return global_context()
@@ -527,17 +535,17 @@ def reference_loader_submit():
corresponding to values for the `method` field, each requiring some
additional fields to be defined.:
- `method=upload`
+ `method=upload_method`
The reference sequence file is uploaded from a local file.
- `file`: Reference sequence file to upload.
- `method=url`
+ `method=url_method`
The reference sequence file can be found at the specified URL.
- `url`: URL of reference sequence file to load.
- `method=slice_gene`
+ `method=slice_gene_method`
Retrieve part of the reference genome for an HGNC gene symbol.
- `genesymbol`: Gene symbol.
@@ -545,7 +553,7 @@ def reference_loader_submit():
- `upstream`: Number of 5' flanking nucleotides.
- `downstream`: Number of 3' flanking nucleotides.
- `method=slice_accession`
+ `method=slice_accession_method`
Retrieve a range of a chromosome by accession number.
- `accession`: Chromosome Accession Number.
@@ -553,7 +561,7 @@ def reference_loader_submit():
- `accession_stop`: Stop position.
- `accession_orientation`: Orientation.
- `method=slice_chromosome`
+ `method=slice_chromosome_method`
Retrieve a range of a chromosome by name.
- `assembly_name_or_alias`: Genome assembly by name or by alias.
@@ -587,7 +595,7 @@ def reference_loader_submit():
raise InputException('Expected an integer in field: %s' % field)
try:
- if method == 'upload':
+ if method == 'upload_method':
# Todo: Non-conforming clients (read: LOVD) might send the form
# request urlencoded (and not as the requested multipart/
# form-data).
@@ -597,10 +605,10 @@ def reference_loader_submit():
ud = retriever.uploadrecord(file.read())
- elif method == 'url':
+ elif method == 'url_method':
ud = retriever.downloadrecord(request.form.get('url'))
- elif method == 'slice_gene':
+ elif method == 'slice_gene_method':
genesymbol = request.form.get('genesymbol')
organism = request.form.get('organism')
upstream = check_position(request.form.get('upstream', ''),
@@ -610,7 +618,7 @@ def reference_loader_submit():
ud = retriever.retrievegene(genesymbol, organism, upstream,
downstream)
- elif method == 'slice_accession':
+ elif method == 'slice_accession_method':
accession = request.form.get('accession')
start = check_position(request.form.get('accession_start', ''),
'Start position')
@@ -619,7 +627,7 @@ def reference_loader_submit():
orientation = int(request.form.get('accession_orientation'))
ud = retriever.retrieveslice(accession, start, stop, orientation)
- elif method == 'slice_chromosome':
+ elif method == 'slice_chromosome_method':
chromosome_name = request.form.get('chromosome')
start = check_position(request.form.get('chromosome_start', ''),
'Start position')
@@ -672,29 +680,114 @@ def reference_loader_submit():
@website.route('/description-extractor')
def description_extractor():
"""
- The Variant Description Extractor (experimental service).
+ Description extractor loader form.
+ """
+ return render_template('description-extractor.html')
+
+
+@website.route('/description-extractor', methods=['POST'])
+def description_extractor_submit():
"""
- reference_sequence = request.args.get('reference_sequence')
- variant_sequence = request.args.get('variant_sequence')
+ The Variant Description Extractor (experimental service).
+
+ There multiple ways for the user to provide two sequences, corresponding to
+ the values for the `reference_method` and `sample_method` fields, each
+ requiring some additional fields to be defined:
+
+ `raw_method`
+ The reference and sample sequences are pasted into the form fields.
+
+ - `reference_sequence`: The reference sequence.
+ - `sample_sequence`: The sample sequence.
+
+ `file_method`
+ The reference and sample sequences are uploaded.
+
+ - `reference_file`: The reference file.
+ - `sample_file`: The sample file.
- if not (reference_sequence and variant_sequence):
- return render_template('description-extractor.html')
+ `refseq_method`
+ The reference and sample sequences are given by RefSeq accession numbers.
+ - `reference_accession_number`: RefSeq accession number for the reference
+ sequence.
+ - `sample_accession_number`: RefSeq accession number for the sample
+ sequence.
+ """
output = Output(__file__)
output.addMessage(__file__, -1, 'INFO',
'Received Description Extract request from %s'
% request.remote_addr)
+ r = s = ''
+ reference_method = request.form.get('reference_method')
+ sample_method = request.form.get('sample_method')
+ reference_sequence = request.form.get('reference_sequence')
+ sample_sequence = request.form.get('sample_sequence')
+ reference_file = request.files.get('reference_file')
+ sample_file = request.files.get('sample_file')
+ reference_accession_number = request.form.get('reference_accession_number')
+ sample_accession_number = request.form.get('sample_accession_number')
+
+ if reference_method == 'refseq_method':
+ if reference_accession_number:
+ retriever = Retriever.GenBankRetriever(output)
+ genbank_record = retriever.loadrecord(reference_accession_number)
+ if genbank_record:
+ r = unicode(genbank_record.seq)
+ else:
+ output.addMessage(__file__, 3, 'EEMPTYFIELD',
+ 'Reference accession number input fields is empty.')
+ elif reference_method == 'file_method':
+ if reference_file:
+ r = util.read_dna(reference_file)
+ else:
+ output.addMessage(__file__, 3, 'EEMPTYFIELD',
+ 'No reference file provided.')
+ else: # raw_method
+ if reference_sequence:
+ r = util.read_dna(StringIO.StringIO(reference_sequence))
+ else:
+ output.addMessage(__file__, 3, 'EEMPTYFIELD',
+ 'Reference sequence number input fields is empty.')
+
+ if sample_method == 'refseq_method':
+ if sample_accession_number:
+ retriever = Retriever.GenBankRetriever(output)
+ genbank_record = retriever.loadrecord(sample_accession_number)
+ if genbank_record:
+ s = unicode(genbank_record.seq)
+ else:
+ output.addMessage(__file__, 3, 'EEMPTYFIELD',
+ 'Sample accession number input fields is empty.')
+ elif sample_method == 'file_method':
+ if sample_file:
+ s = util.read_dna(sample_file)
+ else:
+ output.addMessage(__file__, 3, 'EEMPTYFIELD',
+ 'No sample file provided.')
+ else: # raw_method
+ if sample_sequence:
+ s = util.read_dna(StringIO.StringIO(sample_sequence))
+ else:
+ output.addMessage(__file__, 3, 'EEMPTYFIELD',
+ 'Sample sequence number input fields is empty.')
+
# Todo: Move this to the describe module.
- if not util.is_dna(reference_sequence):
+ if not r or not util.is_dna(r):
output.addMessage(__file__, 3, 'ENODNA',
'Reference sequence is not DNA.')
- if not util.is_dna(variant_sequence):
+ if not s or not util.is_dna(s):
output.addMessage(__file__, 3, 'ENODNA',
- 'Variant sequence is not DNA.')
+ 'Sample sequence is not DNA.')
- raw_vars = extractor.describe_dna(reference_sequence, variant_sequence)
- description = unicode(raw_vars) #describe.allele_description(raw_vars)
+ raw_vars = None
+ if r and s:
+ if not settings.TESTING and (len(r) > 1000 or len(s) > 1000):
+ output.addMessage(__file__, 3, 'EMAXSIZE',
+ 'Input sequences are restricted to 1000bp.')
+ else:
+ raw_vars = extractor.describe_dna(r, s)
errors, warnings, summary = output.Summary()
messages = map(util.message_info, output.getMessages())
@@ -703,13 +796,12 @@ def description_extractor():
'Finished Description Extract request')
return render_template('description-extractor.html',
- reference_sequence=reference_sequence,
- variant_sequence=variant_sequence,
- raw_vars=raw_vars,
- description=description,
- errors=errors,
- summary=summary,
- messages=messages)
+ reference_sequence=reference_sequence or '',
+ sample_sequence=sample_sequence or '',
+ reference_accession_number=reference_accession_number or '',
+ sample_accession_number=sample_accession_number or '',
+ raw_vars=raw_vars, errors=errors, summary=summary, messages=messages,
+ reference_method=reference_method, sample_method=sample_method)
@website.route('/reference/<string:filename>')
diff --git a/tests/data/NM_004006.1.gb.bz2 b/tests/data/NM_004006.1.gb.bz2
new file mode 100644
index 0000000000000000000000000000000000000000..c88783f8789c7fc9b9baeab395ecfa27871e7617
Binary files /dev/null and b/tests/data/NM_004006.1.gb.bz2 differ
diff --git a/tests/data/NM_004006.2.gb.bz2 b/tests/data/NM_004006.2.gb.bz2
new file mode 100644
index 0000000000000000000000000000000000000000..d6ac307a77f8116c89336c634ac905c8c8c1abf7
Binary files /dev/null and b/tests/data/NM_004006.2.gb.bz2 differ
diff --git a/tests/data/extractor_input.fa b/tests/data/extractor_input.fa
new file mode 100644
index 0000000000000000000000000000000000000000..95135a9eaa1210c8e3f3374d29b5d5ca65ae1036
--- /dev/null
+++ b/tests/data/extractor_input.fa
@@ -0,0 +1,2 @@
+>example_input
+ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA
diff --git a/tests/data/extractor_input.fq b/tests/data/extractor_input.fq
new file mode 100644
index 0000000000000000000000000000000000000000..059ed2bdd2d5ae494ba29ebd32a92b9dbab5c4f5
--- /dev/null
+++ b/tests/data/extractor_input.fq
@@ -0,0 +1,4 @@
+@example_input
+ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA
++
+bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb
diff --git a/tests/data/extractor_input.txt b/tests/data/extractor_input.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7ea837629e790570102c936ba16fb5a3e982b71e
--- /dev/null
+++ b/tests/data/extractor_input.txt
@@ -0,0 +1,2 @@
+ATGATTTGATCAGATACATGTGATACCGGT
+AGTTAGGACAA
diff --git a/tests/fixtures.py b/tests/fixtures.py
index c867dd9774cf59b7d4ed51904471fbbc9224d451..652d2f86f4a1a593601958b756aa0c485fa98939 100644
--- a/tests/fixtures.py
+++ b/tests/fixtures.py
@@ -85,6 +85,12 @@ REFERENCES = {
'NM_000132.3': {'filename': 'NM_000132.3.gb.bz2',
'checksum': '94569bee76d7c8b1168e17df4fe1dcb4',
'geninfo_id': '192448441'},
+ 'NM_004006.1': {'filename': 'NM_004006.1.gb.bz2',
+ 'checksum': 'be8fea2905e146bfe096e25fbfda2eef',
+ 'geninfo_id': '5032282'},
+ 'NM_004006.2': {'filename': 'NM_004006.2.gb.bz2',
+ 'checksum': 'ee2090536af19a13ac1d6faa46d0b12e',
+ 'geninfo_id': '238018044'},
'LRG_1': {'filename': 'LRG_1.xml.bz2',
'checksum': '5b8f5a39fcd9e3005688eddffd482746'},
'DMD': {'accession': 'UD_139262478721',
diff --git a/tests/test_website.py b/tests/test_website.py
index b299722d1f30aa532eaa0542c792f18caba6d02e..bb3ff5afe3aee57617e41891bde28f9d8a5099b5 100644
--- a/tests/test_website.py
+++ b/tests/test_website.py
@@ -100,14 +100,83 @@ class TestWebsite(MutalyzerTest):
assert r.status == '200 OK'
assert 'nnouncement' not in r.data
- def test_description_extractor(self):
+ def test_description_extractor_raw(self):
"""
- Submit the variant description extractor.
+ Submit two sequences to the variant description extractor.
"""
- r = self.app.get('/description-extractor', query_string={
- 'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
- 'variant_sequence': 'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA'})
- assert 'g.[5_6insTT;17del;26A>C;35dup]' in r.data
+ r = self.app.post('/description-extractor', data={
+ 'reference_method': 'raw_method',
+ 'sample_method': 'raw_method',
+ 'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
+ 'sample_sequence': 'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA'})
+ assert '[5_6insTT;17del;26A>C;35dup]' in r.data
+
+ def test_description_extractor_raw_fastq(self):
+ """
+ Submit two sequences to the variant description extractor.
+ """
+ path = os.path.join(os.path.dirname(os.path.realpath(__file__)),
+ 'data', 'extractor_input.fq')
+ r = self.app.post('/description-extractor', data={
+ 'reference_method': 'raw_method',
+ 'sample_method': 'raw_method',
+ 'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
+ 'sample_sequence': open(path).read()})
+ assert '[5_6insTT;17del;26A>C;35dup]' in r.data
+
+ @fix(database, cache('NM_004006.1', 'NM_004006.2'))
+ def test_description_extractor_refseq(self):
+ """
+ Submit two accession numbers to the variant description extractor.
+ """
+ r = self.app.post('/description-extractor', data={
+ 'reference_method': 'refseq_method',
+ 'sample_method': 'refseq_method',
+ 'reference_accession_number': 'NM_004006.1',
+ 'sample_accession_number': 'NM_004006.2'})
+ assert '[12749G>A;13729G>A]' in r.data
+
+ def test_description_extractor_file_fasta(self):
+ """
+ Submit a sequence and a FASTA file to the variant description
+ extractor.
+ """
+ path = os.path.join(os.path.dirname(os.path.realpath(__file__)),
+ 'data', 'extractor_input.fa')
+ r = self.app.post('/description-extractor', data={
+ 'reference_method': 'raw_method',
+ 'sample_method': 'file_method',
+ 'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
+ 'sample_file': (open(path), 'extractor_input.fa')})
+ assert '[5_6insTT;17del;26A>C;35dup]' in r.data
+
+ def test_description_extractor_file_fastq(self):
+ """
+ Submit a sequence and a FASTQ file to the variant description
+ extractor.
+ """
+ path = os.path.join(os.path.dirname(os.path.realpath(__file__)),
+ 'data', 'extractor_input.fq')
+ r = self.app.post('/description-extractor', data={
+ 'reference_method': 'raw_method',
+ 'sample_method': 'file_method',
+ 'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
+ 'sample_file': (open(path), 'extractor_input.fq')})
+ assert '[5_6insTT;17del;26A>C;35dup]' in r.data
+
+ def test_description_extractor_file_text(self):
+ """
+ Submit a sequence and a text file to the variant description
+ extractor.
+ """
+ path = os.path.join(os.path.dirname(os.path.realpath(__file__)),
+ 'data', 'extractor_input.txt')
+ r = self.app.post('/description-extractor', data={
+ 'reference_method': 'raw_method',
+ 'sample_method': 'file_method',
+ 'reference_sequence': 'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
+ 'sample_file': (open(path), 'extractor_input.txt')})
+ assert '[5_6insTT;17del;26A>C;35dup]' in r.data
def test_checksyntax_valid(self):
"""
@@ -656,7 +725,7 @@ class TestWebsite(MutalyzerTest):
'data',
'AB026906.1.gb.bz2')
r = self.app.post('/reference-loader',
- data={'method': 'upload',
+ data={'method': 'upload_method',
'file': (bz2.BZ2File(path), 'AB026906.1.gb')})
assert 'Your reference sequence was loaded successfully.' in r.data
@@ -672,7 +741,7 @@ class TestWebsite(MutalyzerTest):
Test the genbank uploader with a non-genbank file.
"""
r = self.app.post('/reference-loader',
- data={'method': 'upload',
+ data={'method': 'upload_method',
'file': (BytesIO('this is not a genbank file'.encode('utf-8')), 'AB026906.1.gb')})
assert 'Your reference sequence was loaded successfully.' not in r.data
assert 'The file could not be parsed.' in r.data