From 9e6ca731467c1449873c85422ba6f88840326fe3 Mon Sep 17 00:00:00 2001
From: Martijn Vermaat <martijn@vermaat.name>
Date: Thu, 20 Nov 2014 16:46:44 +0100
Subject: [PATCH] Fix form buttons and general language issues
---
mutalyzer/website/templates/batch-jobs.html | 4 +-
.../templates/description-extractor.html | 2 +-
mutalyzer/website/templates/homepage.html | 196 +++++++++---------
mutalyzer/website/templates/name-checker.html | 10 +-
.../website/templates/name-generator.html | 17 +-
.../website/templates/position-converter.html | 11 +-
.../website/templates/reference-loader.html | 2 +-
.../website/templates/snp-converter.html | 7 +-
.../website/templates/static/js/generator.js | 18 +-
.../website/templates/syntax-checker.html | 11 +-
tests/test_website.py | 4 +-
11 files changed, 144 insertions(+), 138 deletions(-)
diff --git a/mutalyzer/website/templates/batch-jobs.html b/mutalyzer/website/templates/batch-jobs.html
index f428b69c..fc09635f 100644
--- a/mutalyzer/website/templates/batch-jobs.html
+++ b/mutalyzer/website/templates/batch-jobs.html
@@ -38,7 +38,7 @@
<div class="form-group">
<label for="email">Email address</label>
- <input name="email" type="email" class="form-control" placeholder="Email address" required value="{{ email }}">
+ <input name="email" type="email" class="form-control" placeholder="Email address (notification will be sent here)" required value="{{ email }}">
</div>
<div class="form-group">
@@ -48,7 +48,7 @@
</div>
<div class="form-group">
- <input type="submit" class="btn btn-primary" value="Submit">
+ <input type="submit" class="btn btn-primary" value="Submit batch job">
<a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/BatchCheckers" target="new" class="btn btn-default pull-right">Help</a>
<a href="#" onclick="toggle_visibility('help');" class="btn btn-default pull-right">File format help <span class="caret"></span></a>
</div>
diff --git a/mutalyzer/website/templates/description-extractor.html b/mutalyzer/website/templates/description-extractor.html
index 98efb347..4d965cdf 100644
--- a/mutalyzer/website/templates/description-extractor.html
+++ b/mutalyzer/website/templates/description-extractor.html
@@ -41,7 +41,7 @@ Please supply a reference sequence and an observed sequence.
<p>Example: <code class="example-input-2">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
</div>
<div class="form-group">
- <input type="submit" class="btn btn-primary" value="Submit">
+ <input type="submit" class="btn btn-primary" value="Extract variant description">
<a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/DescriptionExtractor" target="new" class="btn btn-default pull-right">Help</a>
</div>
</form>
diff --git a/mutalyzer/website/templates/homepage.html b/mutalyzer/website/templates/homepage.html
index cf3caf33..36b869e7 100644
--- a/mutalyzer/website/templates/homepage.html
+++ b/mutalyzer/website/templates/homepage.html
@@ -18,106 +18,106 @@ for the checks:
</p>
<div class="row">
- <div class="col-md-12">
- <div class="thumbnail thumb-home thumb-large">
- <div class="caption">
- <h3>Name Checker</h3>
- <p>The Name Checker takes the complete sequence variant description as input and checks whether it is correct.</p>
- <p>Example: <code class="example-input">AB026906.1:c.274G>T</code></p>
-
- <!-- <a href="{{ url_for('.name_checker') }}" class="btn btn-default btn-small btn-primary">Try
- this</a> -->
-
- <form class="form" action="{{ url_for('.name_checker') }}" method="get">
- <div class="input-group">
- <input class="form-control form-control-small form-pre example-target" type="text" name="description" value="{{ description }}" placeholder="Mutation name using HGVS format">
- <span class="input-group-btn">
- <input type="submit" class="btn btn-primary pull-right" value="Try the Name Checker">
- </span>
- </div>
- </form>
-
- </div>
- </div>
- </div>
+ <div class="col-md-12">
+ <div class="thumbnail thumb-home thumb-large">
+ <div class="caption">
+ <h3>Name Checker</h3>
+ <p>The Name Checker takes the complete sequence variant description as input and checks whether it is correct.</p>
+ <p>Example: <code class="example-input">AB026906.1:c.274G>T</code></p>
+
+ <!-- <a href="{{ url_for('.name_checker') }}" class="btn btn-default btn-small btn-primary">Try
+ this</a> -->
+
+ <form class="form" action="{{ url_for('.name_checker') }}" method="get">
+ <div class="input-group">
+ <input class="form-control form-control-small form-pre example-target" type="text" name="description" value="{{ description }}" placeholder="Variant description using HGVS format">
+ <span class="input-group-btn">
+ <input type="submit" class="btn btn-primary pull-right" value="Try the Name Checker">
+ </span>
+ </div>
+ </form>
+
+ </div>
+ </div>
+ </div>
</div>
<div class="row">
- <div class="col-md-3">
- <div class="thumbnail thumb-home clickbox color-1">
- <div class="caption">
- <h3>Syntax Checker</h3>
- <p>The Syntax Checker takes the complete sequence variant description as input and checks whether the syntax is correct.</p>
- <a href="{{ url_for('.syntax_checker') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
- </div>
- </div>
- </div>
- <div class="col-md-3">
- <div class="thumbnail thumb-home clickbox color-2">
- <div class="caption">
- <h3>Position Converter</h3>
- <p>The Position Converter can convert chromosomal positions to transcript orientated positions and vice versa.</p>
- <a href="{{ url_for('.position_converter') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
- </div>
- </div>
- </div>
- <div class="col-md-3">
- <div class="thumbnail thumb-home clickbox color-3">
- <div class="caption">
- <h3>SNP Converter</h3>
- <p>The SNP Converter allows you to convert a dbSNP rsId to HGVS notation.</p>
- <a href="{{ url_for('.snp_converter') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
- </div>
- </div>
- </div>
- <div class="col-md-3">
- <div class="thumbnail thumb-home clickbox color-4">
- <div class="caption">
- <h3>Name Generator</h3>
- <p>The Name Generator is a user friendly interface that helps to make a valid HGVS variant description.</p>
- <a href="{{ url_for('.name_generator') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
- </div>
- </div>
- </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-1">
+ <div class="caption">
+ <h3>Syntax Checker</h3>
+ <p>The Syntax Checker takes the complete sequence variant description as input and checks whether the syntax is correct.</p>
+ <a href="{{ url_for('.syntax_checker') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-2">
+ <div class="caption">
+ <h3>Position Converter</h3>
+ <p>The Position Converter can convert chromosomal positions to transcript orientated positions and vice versa.</p>
+ <a href="{{ url_for('.position_converter') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-3">
+ <div class="caption">
+ <h3>SNP Converter</h3>
+ <p>The SNP Converter allows you to convert a dbSNP rsId to HGVS notation.</p>
+ <a href="{{ url_for('.snp_converter') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-4">
+ <div class="caption">
+ <h3>Name Generator</h3>
+ <p>The Name Generator is a user friendly interface that helps to make a valid HGVS variant description.</p>
+ <a href="{{ url_for('.name_generator') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
</div>
<div class="row">
- <div class="col-md-3">
- <div class="thumbnail thumb-home clickbox color-5">
- <div class="caption">
- <h3>Description Extractor</h3>
- <p>The Description Extractor allows you to generate the HGVS variant description from a reference sequence and an observed sequence.</p>
- <a href="{{ url_for('.description_extractor') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
- </div>
- </div>
- </div>
- <div class="col-md-3">
- <div class="thumbnail thumb-home clickbox color-6">
- <div class="caption">
- <h3>Reference File Loader</h3>
- <p>The Reference File Loader allows you to load and use your own reference sequence.</p>
- <a href="{{ url_for('.reference_loader') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
- </div>
- </div>
- </div>
- <div class="col-md-3">
- <div class="thumbnail thumb-home clickbox color-7">
- <div class="caption">
- <h3>Batch Checkers</h3>
- <p>The Batch Checkers are interfaces that accept a list of inputs. These interfaces can be used for large quantities of checks is correct.</p>
- <a href="{{ url_for('.batch_jobs') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
- </div>
- </div>
- </div>
- <div class="col-md-3">
- <div class="thumbnail thumb-home clickbox color-8">
- <div class="caption">
- <h3>Web services</h3>
- <p>The Web services page provides instructions for the web services.</p>
- <a href="{{ url_for('.webservices') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
- </div>
- </div>
- </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-5">
+ <div class="caption">
+ <h3>Description Extractor</h3>
+ <p>The Description Extractor allows you to generate the HGVS variant description from a reference sequence and an observed sequence.</p>
+ <a href="{{ url_for('.description_extractor') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-6">
+ <div class="caption">
+ <h3>Reference File Loader</h3>
+ <p>The Reference File Loader allows you to load and use your own reference sequence.</p>
+ <a href="{{ url_for('.reference_loader') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-7">
+ <div class="caption">
+ <h3>Batch Checkers</h3>
+ <p>The Batch Checkers are interfaces that accept a list of inputs. These interfaces can be used for large quantities of checks is correct.</p>
+ <a href="{{ url_for('.batch_jobs') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-8">
+ <div class="caption">
+ <h3>Web Services</h3>
+ <p>The Web services page provides instructions for the web services.</p>
+ <a href="{{ url_for('.webservices') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
</div>
@@ -136,10 +136,10 @@ This project is sponsored by <a href = "http://www.sun.com">SUN Microsystems</a>
</p>
<script>
- $(".clickbox").click(function(){
- window.location=$(this).find("a").attr("href");
- return false;
- });
+ $(".clickbox").click(function(){
+ window.location=$(this).find("a").attr("href");
+ return false;
+ });
</script>
{% endblock content %}
diff --git a/mutalyzer/website/templates/name-checker.html b/mutalyzer/website/templates/name-checker.html
index a568c9f9..72ebc317 100644
--- a/mutalyzer/website/templates/name-checker.html
+++ b/mutalyzer/website/templates/name-checker.html
@@ -40,7 +40,7 @@
{% if not standalone %}
<p>
- Please insert the mutation name using
+ Please insert the variant description using
the <a href="http://www.hgvs.org/mutnomen" title="Human Genome Variation
Society standard variant nomenclature" alt="Human Genome Variation Society
standard variant nomenclature">HGVS</a> format:
@@ -50,13 +50,15 @@
<form class="form" action="{{ url_for('.name_checker') }}" method="get">
<div class="form-group">
- <label for="description">HGVS Description</label>
- <input class="form-control form-pre example-target" type="text" name="description" id="hgvs" value="{{ description }}" placeholder="Mutation name using HGVS format">
+ <label for="description">Variant description</label>
+ <input class="form-control form-pre example-target" type="text"
+ name="description" id="hgvs" value="{{ description }}"
+ placeholder="Variant description using HGVS format">
<p>Example: <code class="example-input">AB026906.1:c.274G>T</code></p>
</div>
<div class="form-group button-group">
- <input type="submit" class="btn btn-primary" value="Check name">
+ <input type="submit" class="btn btn-primary" value="Check variant description">
<a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/NameChecker" target="new" class="btn btn-default pull-right">Help</a>
</div>
</form>
diff --git a/mutalyzer/website/templates/name-generator.html b/mutalyzer/website/templates/name-generator.html
index fcf152e3..3e948b6c 100644
--- a/mutalyzer/website/templates/name-generator.html
+++ b/mutalyzer/website/templates/name-generator.html
@@ -7,7 +7,8 @@
<div class="form">
- <p>Construct the mutation from a reference by adding variants to it. The HGVS name is constructed instantly <a href="#constructed_name">below</a>.
+ <p>Construct the variant from a reference by adding variants to
+ it. The HGVS variant description is constructed instantly <a href="#constructed_name">below</a>.
<hr/>
@@ -22,7 +23,7 @@
</div>
<div class="form-group">
- <label for="seqT" class="col-sm-2 control-label">Sequence Type</label>
+ <label for="seqT" class="col-sm-2 control-label">Sequence type</label>
<div class="col-sm-10">
<select name="seqT" class="form-control">
<option value="g">Genomic</option>
@@ -84,7 +85,7 @@
<div id="varianttemplate" style="display: none">
<div class="row form-horizontal-inline">
<div class="form-group col-md-6" id="V{NMBR}mutTrow">
- <label for="V{NMBR}mutT" id="V{NMBR}mutTname">Mutation Type</label>
+ <label for="V{NMBR}mutT" id="V{NMBR}mutTname">Variant type</label>
<select name="V{NMBR}mutT" onchange="update();"class="form-control input-sm" >
<option value="1">Substitution</option>
<option value="2">Deletion</option>
@@ -97,13 +98,13 @@
</div>
<div class="form-group col-md-6" id="V{NMBR}P1row">
- <label id="V{NMBR}P1name">Start Position</label>
+ <label id="V{NMBR}P1name">Start position</label>
<input type="text" name="V{NMBR}P1" value="" class="form-control input-sm">
<div class="text-danger small" id="V{NMBR}P1error"></div>
</div>
<div class="form-group col-md-6" id="V{NMBR}P2row">
- <label id="V{NMBR}P2name">End Position</label>
+ <label id="V{NMBR}P2name">End position</label>
<input type="text" name="V{NMBR}P2" size="20" value="" class="form-control input-sm" >
<div class="text-danger small" id="V{NMBR}P2error"></div>
</div>
@@ -111,7 +112,7 @@
<div class="row form-horizontal-inline">
<div class="col-md-6" id="V{NMBR}S1row">
<div class="form-group" name="S1">
- <label id="V{NMBR}S1name">Old Sequence</label>
+ <label id="V{NMBR}S1name">Old sequence</label>
<input type="text" name="V{NMBR}S1" size="20" value=""class="form-control input-sm">
<div class="text-danger small" id="V{NMBR}S1error"></div>
</div>
@@ -119,7 +120,7 @@
<div class="col-md-6" id="V{NMBR}S2row">
<div class="form-group" name="S2">
- <label id="V{NMBR}S2name">New Sequence</label>
+ <label id="V{NMBR}S2name">New sequence</label>
<input type="text" name="V{NMBR}S2" size="20" value=""class="form-control input-sm">
<div class="text-danger small" id="V{NMBR}S2error"></div>
</div>
@@ -144,7 +145,7 @@
<hr/>
- <a id="constructed_name"></a><h4>Constructed HGVS Name</h4>
+ <a id="constructed_name"></a><h4>Constructed HGVS variant description</h4>
<p><code id="output" >
<!-- Empty PlaceHolder -->
</code></p>
diff --git a/mutalyzer/website/templates/position-converter.html b/mutalyzer/website/templates/position-converter.html
index 8099e3f1..e784e72b 100644
--- a/mutalyzer/website/templates/position-converter.html
+++ b/mutalyzer/website/templates/position-converter.html
@@ -26,12 +26,13 @@ normalize it to HGVS. Use the <a href="{{ url_for('.name_checker') }}">Name Chec
</select>
</div>
<div class="form-group">
- <label for="description">Variant</label>
- <input type="text" name="description" value="{{ description }}" class="form-control form-pre example-target" placeholder="Variant">
+ <label for="description">Variant description</label>
+ <input type="text" name="description" value="{{ description }}"
+ class="form-control form-pre example-target" placeholder="Variant description using HGVS format">
<p>Examples: <code class="example-input">NM_003002.3:c.274G>T</code>, <code class="example-input">chr11:g.111959693G>T</code> and <code class="example-input">NC_000011.9:g.111959693G>T</code></p>
</div>
<div class="form-group button-group">
- <input type="submit" class="btn btn-primary" value="Submit">
+ <input type="submit" class="btn btn-primary" value="Convert variant description">
<a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/PositionConverter" target="new" class="btn btn-default pull-right">Help</a>
</div>
</form>
@@ -57,10 +58,10 @@ normalize it to HGVS. Use the <a href="{{ url_for('.name_checker') }}">Name Chec
<p><code>{{ chromosomal_description }}</code></p>
{% if transcript_descriptions %}
- <h4>Found transcripts in mutation region</h4>
+ <h4>Found transcripts in variant region</h4>
<pre>{% for d in transcript_descriptions %}{{ d }}<br>{% endfor %}</pre>
{% else %}
- <h4>No transcripts found in mutation region</h4>
+ <h4>No transcripts found in variant region</h4>
{% endif %}
{% endif %}
{% endif %}{# description #}
diff --git a/mutalyzer/website/templates/reference-loader.html b/mutalyzer/website/templates/reference-loader.html
index 5f97e21c..1accdadd 100644
--- a/mutalyzer/website/templates/reference-loader.html
+++ b/mutalyzer/website/templates/reference-loader.html
@@ -153,7 +153,7 @@ sequence (maximum size is {{ max_file_size }} megabytes).
</div>
</div>
<div class="form-group">
- <input type="submit" value="Submit"class="btn btn-primary">
+ <input type="submit" value="Load reference file"class="btn btn-primary">
<a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/ReferenceLoader" target="_blank" class="btn btn-default pull-right">Help</a>
</div>
</form>
diff --git a/mutalyzer/website/templates/snp-converter.html b/mutalyzer/website/templates/snp-converter.html
index 69ea6c44..2b084818 100644
--- a/mutalyzer/website/templates/snp-converter.html
+++ b/mutalyzer/website/templates/snp-converter.html
@@ -14,13 +14,14 @@ the reference sequence(s) used by dbSNP.
<form role="form" class="form" action="{{ url_for('.snp_converter') }}" method="get">
<div class="form-group">
- <label for="description">dbSNP rs number</label>
- <input type="text" class="form-control form-pre example-target" name="rs_id" placeholder="" value="{{ rs_id }}" ></input>
+ <label for="description">SNP</label>
+ <input type="text" class="form-control form-pre example-target"
+ name="rs_id" placeholder="dbSNP rs number (including rs)" value="{{ rs_id }}" ></input>
<p>Example: <code class="example-input">rs9919552</code></p>
</div>
<div class="form-group">
- <input type="submit" class="btn btn-primary" value="Submit">
+ <input type="submit" class="btn btn-primary" value="Convert SNP">
<a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/SnpConverter" target="new" class="btn btn-default pull-right">Help</a>
</div>
</form>
diff --git a/mutalyzer/website/templates/static/js/generator.js b/mutalyzer/website/templates/static/js/generator.js
index 04ea449c..b330c141 100644
--- a/mutalyzer/website/templates/static/js/generator.js
+++ b/mutalyzer/website/templates/static/js/generator.js
@@ -101,18 +101,18 @@ var reference = {
'ok' : false,
'check' : isReference,
'errStr' : "should be of the format \"NM_002001.2\""},
- 'seqT': {'name' : "Sequence Type",
+ 'seqT': {'name' : "Sequence type",
'len' : "1",
'value' : "c",
'ok' : false,
'check' : isSequenceType,
- 'errStr' : "You managed to select an impossible Sequence Type. Muppet!"},
- 'gSym': {'name' : "Gene Symbol",
+ 'errStr' : "You managed to select an impossible sequence type. Muppet!"},
+ 'gSym': {'name' : "Gene symbol",
'len' : "*",
'value' : "",
'ok' : false,
'check' : isGeneSymbol,
- 'errStr' : "should only contain Letters and Numbers"},
+ 'errStr' : "should only contain letters and numbers"},
'tVar': {'name' : "Transcript",
'len' : "*",
'value' : "",
@@ -193,11 +193,11 @@ var seqTypes = {
'pr1' : { 'pCheck' : isPosition,
'sCheck' : isProteinSequence1,
- 'errorStr' : "must consist of the Single Letter AminoAcids Code"},
+ 'errorStr' : "must consist of the single letter amino acids code"},
'pr3' : { 'pCheck' : isPosition,
'sCheck' : isProteinSequence3,
- 'errorStr' : "must consist of the Three Letter AminoAcids Code"}
+ 'errorStr' : "must consist of the three letter amino acids code"}
}
/* mutTypes Object
@@ -319,9 +319,9 @@ var VariantField = {
var i = this[name].index;
return mutTypes[this["mType"]]["flags"].substring(i,i+1);},
getName : function(name){
- var S1Name = mutTypes[this["mType"]]["S1"]+" Sequence";
- var S2Name = mutTypes[this["mType"]]["S2"]+" Sequence";
- var defaultnames = ["Start Position", "End Position", S1Name, S2Name];
+ var S1Name = mutTypes[this["mType"]]["S1"]+" sequence";
+ var S2Name = mutTypes[this["mType"]]["S2"]+" sequence";
+ var defaultnames = ["Start position", "End position", S1Name, S2Name];
return defaultnames[this[name].index];},
getErr : function(name){
if(name.substring(1,0)=="P")
diff --git a/mutalyzer/website/templates/syntax-checker.html b/mutalyzer/website/templates/syntax-checker.html
index 3854c8c1..118cc85c 100644
--- a/mutalyzer/website/templates/syntax-checker.html
+++ b/mutalyzer/website/templates/syntax-checker.html
@@ -1,12 +1,12 @@
{% extends "base.html" %}
{% set active_page = "syntax-checker" %}
-{% set page_title = "Syntax checker" %}
+{% set page_title = "Syntax Checker" %}
{% block content %}
<p>
-Please insert the mutation name using
+Please insert the variant description using
the <a href="http://www.hgvs.org/mutnomen" title="Human Genome Variation
Society standard variant nomenclature" alt="Human Genome Variation Society
standard variant nomenclature">HGVS</a> format:
@@ -16,8 +16,9 @@ standard variant nomenclature">HGVS</a> format:
<form class="form" action="{{ url_for('.syntax_checker') }}" method="get">
<div class="form-group">
- <label for="description">HGVS Description</label>
- <input class="form-control form-pre example-target" type="text" name="description" value="{{ description }}" placeholder="Mutation name using HGVS format">
+ <label for="description">Variant description</label>
+ <input class="form-control form-pre example-target" type="text"
+ name="description" value="{{ description }}" placeholder="Variant description using HGVS format">
<p>Example: <code class="example-input">AB026906.1:c.274G>T</code></p>
</div>
<div class="form-group button-group">
@@ -35,7 +36,7 @@ standard variant nomenclature">HGVS</a> format:
<p>The "^" indicates the position where the error occurred.</p>
</div>
{% else %}
- <p class="alert alert-success">The syntax of this variant is OK!</p>
+ <p class="alert alert-success">The syntax of this variant description is OK!</p>
{% endif %}
{% if messages %}
diff --git a/tests/test_website.py b/tests/test_website.py
index 06b19d9d..b299722d 100644
--- a/tests/test_website.py
+++ b/tests/test_website.py
@@ -115,7 +115,7 @@ class TestWebsite(MutalyzerTest):
"""
r = self.app.get('/syntax-checker',
query_string={'description': 'AB026906.1:c.274G>T'})
- assert 'The syntax of this variant is OK!' in r.data
+ assert 'The syntax of this variant description is OK!' in r.data
def test_checksyntax_invalid(self):
"""
@@ -137,7 +137,7 @@ class TestWebsite(MutalyzerTest):
assert '0 Errors' in r.data
assert '0 Warnings' in r.data
assert 'Raw variant 1: deletion of 1' in r.data
- assert '<input class="form-control form-pre example-target" type="text" name="description" id="hgvs" value="NM_002001.2:g.1del" placeholder="Mutation name using HGVS format">' in r.data
+ assert 'value="NM_002001.2:g.1del"' in r.data
def test_check_invalid(self):
"""
--
GitLab