diff --git a/mutalyzer/website/templates/batch-job-progress.html b/mutalyzer/website/templates/batch-job-progress.html
index bed41e1265caa6c3a2b3b66479742bf37e0105ec..7f64c01fd0bcb95029c71e732da60fec3b4546a0 100644
--- a/mutalyzer/website/templates/batch-job-progress.html
+++ b/mutalyzer/website/templates/batch-job-progress.html
@@ -16,6 +16,7 @@
<a href="{{ url_for('.batch_job_result', result_id=result_id) }}">batch-job-{{ result_id }}.txt</a>
</p>
</div>
+
{% if items_left %}
<script type="text/javascript">
function check_items_left() {
@@ -38,8 +39,8 @@ function check_items_left() {
}
check_items_left();
</script>
- {% endif %}
-{% else %}
+ {% endif %}{# items_left #}
+{% else %}{# result_id #}
<p>Unknow batch job.</p>
{% endif %}
diff --git a/mutalyzer/website/templates/batch-jobs.html b/mutalyzer/website/templates/batch-jobs.html
index 36876544b07a1147fcde977260d0642562dc2df3..f428b69cfc7bf946d661a9118394bc9294270c84 100644
--- a/mutalyzer/website/templates/batch-jobs.html
+++ b/mutalyzer/website/templates/batch-jobs.html
@@ -10,101 +10,106 @@
{% block content %}
- <form action="{{ url_for('.batch_jobs_submit') }}" method="post" enctype="multipart/form-data">
- <!-- BatchType -->
- <div class="form-group">
- <label>Batch job type</label>
- <div class="radio">
- <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="name-checker"{% if job_type == "name-checker" %} checked{% endif %} />Name Checker</label>
- </div>
- <div class="radio">
- <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="syntax-checker"{% if job_type == "syntax-checker" %} checked{% endif %} />Syntax Checker</label>
- </div>
- <div class="radio">
- <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="position-converter"{% if job_type == "position-converter" %} checked{% endif %} />Position Converter</label>
- </div>
- <div class="radio">
- <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="snp-converter"{% if job_type == "snp-converter" %} checked{% endif %} />SNP Converter</label>
- </div>
-
- <div id="assembly_name_or_alias" style="display:none" class="form-group">
- <label>Assembly</label>
- <select name="assembly_name_or_alias" class="form-control">
- {% for assembly in assemblies %}
- <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{ assembly.alias }}){% endif %}</option>
- {% endfor %}
- </select>
- </div>
-
- <div class="form-group">
- <label for="email">Email address</label>
- <input name="email" type="email" class="form-control" placeholder="Email address" required value="{{ email }}">
- </div>
-
- <div class="form-group">
- <label for="file">File</label>
- <input type="file" name="file">
- </div>
- </div>
-
- <div class="form-group">
- <input type="submit" class="btn btn-primary" value="Submit">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/BatchCheckers" target="new" class="btn btn-default pull-right">Help</a>
- <a href="#" onclick="toggle_visibility('help');" class="btn btn-default pull-right">File format help <span class="caret"></span></a>
-
- </div>
- </form>
-
-<div id='help' style="display:none">
- <h3>Help</h3>
+<form class="form" action="{{ url_for('.batch_jobs_submit') }}" method="post" enctype="multipart/form-data">
+ <!-- BatchType -->
+ <div class="form-group">
+ <label>Batch job type</label>
+ <div class="radio">
+ <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="name-checker"{% if job_type == "name-checker" %} checked{% endif %} />Name Checker</label>
+ </div>
+ <div class="radio">
+ <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="syntax-checker"{% if job_type == "syntax-checker" %} checked{% endif %} />Syntax Checker</label>
+ </div>
+ <div class="radio">
+ <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="position-converter"{% if job_type == "position-converter" %} checked{% endif %} />Position Converter</label>
+ </div>
+ <div class="radio">
+ <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="snp-converter"{% if job_type == "snp-converter" %} checked{% endif %} />SNP Converter</label>
+ </div>
+
+ <div id="assembly_name_or_alias" style="display:none" class="form-group">
+ <label>Assembly</label>
+ <select name="assembly_name_or_alias" class="form-control">
+ {% for assembly in assemblies %}
+ <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{ assembly.alias }}){% endif %}</option>
+ {% endfor %}
+ </select>
+ </div>
+
+ <div class="form-group">
+ <label for="email">Email address</label>
+ <input name="email" type="email" class="form-control" placeholder="Email address" required value="{{ email }}">
+ </div>
+
+ <div class="form-group">
+ <label for="file">File</label>
+ <input type="file" name="file">
+ </div>
+ </div>
+
+ <div class="form-group">
+ <input type="submit" class="btn btn-primary" value="Submit">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/BatchCheckers" target="new" class="btn btn-default pull-right">Help</a>
+ <a href="#" onclick="toggle_visibility('help');" class="btn btn-default pull-right">File format help <span class="caret"></span></a>
+ </div>
+</form>
+
+<div id="help" style="display:none">
+ <hr>
<p>The mutalyzer batch checker accepts the following file formats:</p>
- <ul>
- <li>Tab delimited text file / CSV file</li>
- <li>Microsoft Excel file</li>
- <li>OpenOffice ODS file</li>
- </ul>
- <p>
+ <ul>
+ <li>Tab delimited text file / CSV file</li>
+ <li>Microsoft Excel file</li>
+ <li>OpenOffice ODS file</li>
+ </ul>
+ <p>
The maximum file size is {{ max_file_size }} megabytes, and the maximum
length per entry (variant description) is 200 characters.
- </p>
- We accept two types of input files, you can download examples below.
+ </p>
- <h4>New Style</h4>
- <p>This file format has no header-row. Each row consists of one or more tab delimited fields, where every field contains a single variant description (or dbSNP rs number in case of the SNP Converter). Note that all rows must have the same number of fields.</p>
- <table class="table">
- <tr><td>AB026906.1:c.274G>T</td></tr>
- <tr><td>AL449423.14(CDKN2A_v002):c.5_400del</td></tr>
- </table>
- <a href="{{ url_for('.downloads', filename='batchtestnew.txt') }}">Download new style example file</a>
+ <p>We accept two types of input files, you can download examples below.</p>
+ <h4>New Style</h4>
+ <p>This file format has no header-row. Each row consists of one or more tab delimited fields, where every field contains a single variant description (or dbSNP rs number in case of the SNP Converter). Note that all rows must have the same number of fields.</p>
+ <table class="table">
+ <tr><td>AB026906.1:c.274G>T</td></tr>
+ <tr><td>AL449423.14(CDKN2A_v002):c.5_400del</td></tr>
+ </table>
- <h4>Old Style</h4>
- <p >This file format has a header-row, which consists of
- three tab delimited fields. In each following row the
- corressponding data is also tab delimited.</p>
- <table class="table">
- <thead>
- <th>AccNo</th>
- <th>Genesymbol</th>
- <th>Mutation</th>
- </thead>
- <tr>
- <td>AB026906.1</td><td>SDHD</td><td>g.7872G>T</td>
- </tr>
- </table>
-
- <a href="{{ url_for('.downloads', filename='batchtestold.txt') }}">Download old style example file</a>
+ <p><a href="{{ url_for('.downloads', filename='batchtestnew.txt') }}">Download new style example file</a></p>
+ <h4>Old Style</h4>
+ <p>This file format has a header-row, which consists of
+ three tab delimited fields. In each following row the
+ corressponding data is also tab delimited.</p>
+ <table class="table">
+ <thead>
+ <tr>
+ <th>AccNo</th>
+ <th>Genesymbol</th>
+ <th>Mutation</th>
+ </tr>
+ </thead>
+ <tbody>
+ <tr>
+ <td>AB026906.1</td><td>SDHD</td><td>g.7872G>T</td>
+ </tr>
+ </tbody>
+ </table>
+
+ <p><a href="{{ url_for('.downloads', filename='batchtestold.txt') }}">Download old style example file</a></p>
<h4>Output Format</h4>
- <p>
- The output of a Mutalyzer Batch run is a tab delimited CSV file,
- which has a header-row to clarify the results. We recommend opening
- the file in a spreadsheet program, such as OpenOffice Calc or
- Microsoft Excel.<BR />
- Note that empty lines are removed from the batch input file.
- </p>
-</div>
+
+ <p>
+ The output of a Mutalyzer Batch run is a tab delimited CSV file,
+ which has a header-row to clarify the results. We recommend opening
+ the file in a spreadsheet program, such as OpenOffice Calc or
+ Microsoft Excel.
+ </p>
+ <p>Note that empty lines are removed from the batch input file.</p>
+</div>{# id="help" #}
+
<script language="javascript">
oldload = window.onload
initpage = function() {
@@ -115,29 +120,15 @@ initpage = function() {
window.onload = initpage;
</script>
-{% if errors %}
- <div class="alert alert-danger">
- <h4>Batch not started</h4>
- <p>The batch process was not started due to the following errors:</p>
- <ul>
- {% for m in errors %}
- <li class="{{ m.class }}" title="{{ m.level }} (origin: {{ m.origin
- }})">{{ m.description }}</li>
- {% endfor %}
- </ul>
- </div>
-{% endif %}
-
{% if messages %}
- <p>
- <b>Messages:</b>
- </p>
- <div class="messages">
- {% for m in messages %}
- <p class="{{ m.class }}" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
- {% endfor %}
- <p>{{ summary }}</p>
- </div>
+ <hr>
+ {% for m in messages %}
+ {% if m.class == "error" %}
+ <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% elif m.class == "warning" %}
+ <p class="alert alert-warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% endif %}
+ {% endfor %}
{% endif %}
{% endblock content %}
diff --git a/mutalyzer/website/templates/description-extractor.html b/mutalyzer/website/templates/description-extractor.html
index 4f41354cba2be09c532e2a9226102a75a12a2c54..98efb347370f6147a62ff6ea55c1d9b5dad63de0 100644
--- a/mutalyzer/website/templates/description-extractor.html
+++ b/mutalyzer/website/templates/description-extractor.html
@@ -5,12 +5,12 @@
{% block content %}
-<p>
-<b style="color: red">Note that this is an experimental service.</b>
-</p>
+<p class="alert alert-warning">Note that this is an experimental service.</p
<p>
-Extract the HGVS variant description from a reference sequence and an observed sequence. For now, we require the user to fill in two sequences. After the testing phase, we plan to use the underlying algorithm for:
+Extract the HGVS variant description from a reference sequence and an observed
+sequence. For now, we require the user to fill in two sequences. After the
+testing phase, we plan to use the underlying algorithm for:
</p>
<ul>
@@ -26,84 +26,76 @@ Extract the HGVS variant description from a reference sequence and an observed s
</ul>
<p>
- Please supply a reference sequence and an observed sequence.
+Please supply a reference sequence and an observed sequence.
</p>
- <form action="{{ url_for('.description_extractor') }}" method="get" class="form">
- <div class="form-group">
- <h3>Reference sequence</h3>
- <p>Example: <code class="example-input">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
- <input type="text" name="reference_sequence" value="{{ reference_sequence }}" class="form-control form-pre example-target" placeholder="Reference sequence">
- <!-- <input type="button" value="Clear field" onclick="clearField(this.form, 'reference_sequence');" class="btn"> -->
- </div>
- <div class="form-group">
- <h3>Observed sequence</h3>
-
- <p>Example: <code class="example-input-2">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
- <input type="text" name="variant_sequence" value="{{ variant_sequence }}" class="form-control form-pre example-target-2" placeholder="Observed sequence">
- <!-- <input type="button" value="Clear field" onclick="clearField(this.form, 'variant_sequence');" class="btn"> -->
- </div>
-
- <div class="form-group">
- <input type="submit" class="btn btn-primary" value="Submit">
- <input type="reset" class="btn btn-default pull-right" value="Undo">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/DescriptionExtractor" target="new" class="btn btn-default pull-right">Help</a>
- </div>
- </form>
+<form action="{{ url_for('.description_extractor') }}" method="get" class="form">
+ <div class="form-group">
+ <label for="reference_sequence">Reference sequence</label>
+ <input type="text" name="reference_sequence" value="{{ reference_sequence }}" class="form-control form-pre example-target" placeholder="Reference sequence">
+ <p>Example: <code class="example-input">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
+ </div>
+ <div class="form-group">
+ <label for="variant_sequence">Observed sequence</label>
+ <input type="text" name="variant_sequence" value="{{ variant_sequence }}" class="form-control form-pre example-target-2" placeholder="Observed sequence">
+ <p>Example: <code class="example-input-2">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
+ </div>
+ <div class="form-group">
+ <input type="submit" class="btn btn-primary" value="Submit">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/DescriptionExtractor" target="new" class="btn btn-default pull-right">Help</a>
+ </div>
+</form>
{% if description %}
- <h3>Variant Description Extractor results:</h3>
-
-<table class="table">
- {% for m in messages %}
- {% if m.class == "error" %}
- <tr><td class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</td></tr>
- {% elif m.class == "warning" %}
- <tr><td class="warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</td></tr>
- {% endif %}
- {% endfor %}
-
- {% if summary == "0 Errors, 0 Warnings."%}
- <tr><td class="success summary">{{ summary }}</td>
- {% endif %}
-</table>
+ <hr>
+ {% for m in messages %}
+ {% if m.class == "error" %}
+ <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% elif m.class == "warning" %}
+ <p class="alert warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% endif %}
+ {% endfor %}
+ {% if summary == "0 Errors, 0 Warnings." %}
+ <p class="alert alert-success summary">{{ summary }}</p>
+ {% else %}
+ <p>{{summary}}</p>
+ {% endif %}
{% if not errors %}
- <p>
- <b>Genomic description:</b>
- </p>
- <p>
- <pre>g.{{ description }}</pre>
- </p>
- <p>
- <b>Overview of the raw variants:</b>
- </p>
+ <hr>
+
+ <h4>Genomic description</h4>
+ <p><code>g.{{ description }}</code></p>
+
+ <h4>Overview of the raw variants</h4>
<table class="table">
- <thead><tr>
- <th>Start</th>
- <th>End</th>
- <th>Type</th>
- <th>Deleted</th>
- <th>Inserted</th>
- <th>Shift</th>
- <th>Description</th>
- </tr></thead>
- {% for raw_var in raw_vars %}
- <tbody>
- <tr>
- <td>{{ raw_var.start }}</td>
- <td>{{ raw_var.end }}</td>
- <td>{{ raw_var.type }}</td>
- <td>{{ raw_var.deleted }}</td>
- <td>{{ raw_var.inserted }}</td>
- <td>{{ raw_var.shift }}</td>
- <td>{{ raw_var.hgvs }}</td>
+ <thead>
+ <tr>
+ <th>Start</th>
+ <th>End</th>
+ <th>Type</th>
+ <th>Deleted</th>
+ <th>Inserted</th>
+ <th>Shift</th>
+ <th>Description</th>
</tr>
- </tbody>
- {% endfor %}
+ </thead>
+ <tbody>
+ {% for raw_var in raw_vars %}
+ <tr>
+ <td>{{ raw_var.start }}</td>
+ <td>{{ raw_var.end }}</td>
+ <td>{{ raw_var.type }}</td>
+ <td>{{ raw_var.deleted }}</td>
+ <td>{{ raw_var.inserted }}</td>
+ <td>{{ raw_var.shift }}</td>
+ <td>{{ raw_var.hgvs }}</td>
+ </tr>
+ {% endfor %}
+ </tbody>
</table>
- {% endif %}
-{% endif %}
+ {% endif %}{# not errors #}
+{% endif %}{# description #}
{% endblock content %}
diff --git a/mutalyzer/website/templates/name-checker.html b/mutalyzer/website/templates/name-checker.html
index fc697e432cbd13fb1764e799d0cafe1a882d9654..94549c1180c0a2137b8ad3dd2760edeb62f047cf 100644
--- a/mutalyzer/website/templates/name-checker.html
+++ b/mutalyzer/website/templates/name-checker.html
@@ -1,5 +1,5 @@
{% if not standalone %}
- {% extends "base.html" %}
+ {% extends "base.html" %}
{% endif -%}
<!DOCTYPE html>
@@ -29,287 +29,285 @@
<body>
- <h1>Name Checker</h1>
+<h1>Name Checker</h1>
- {% set active_page = "name-checker" %}
- {% set page_title = "Name Checker" %}
+{% set active_page = "name-checker" %}
+{% set page_title = "Name Checker" %}
- <div class="container-fluid" >
+<div class="container-fluid" >
{% block content %}
- {% if parse_error %}
- <div class="alert alert-danger">
- <h4>Parse error</h4>
- <p>The "^" indicates the position where the error occurred:</p>
- <pre>{{ parse_error[0] }}<br>{{ parse_error[1] }}</pre>
- </div><!-- alert alert-danger -->
- {% endif %} <!-- if parse_error -->
-
- {% if messages %}
- {% for m in messages %}
- {% if m.class == "error" %}
- <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
- {% elif m.class == "warning" %}
- <p class="alert alert-warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
- {% endif %}
- {% endfor %}
- {% endif %} <!-- messages -->
-
- {% if summary == "0 Errors, 0 Warnings."%}
- <p class="alert alert-success summary">{{ summary }}</p>
- {% else %}
- <p>{{summary}}</p>
- <hr />
+{% if not standalone %}
+ <p>
+ Please insert the mutation name using
+ the <a href="http://www.hgvs.org/mutnomen" title="Human Genome Variation
+ Society standard variant nomenclature" alt="Human Genome Variation Society
+ standard variant nomenclature">HGVS</a> format:
+ </p>
+
+ <pre><accession number>.<version number>(<gene symbol>):<sequence type>.<variant description></pre>
+
+ <form class="form" action="{{ url_for('.name_checker') }}" method="get">
+ <div class="form-group">
+ <label for="description">HGVS Description</label>
+ <input class="form-control form-pre example-target" type="text" name="description" id="hgvs" value="{{ description }}" placeholder="Mutation name using HGVS format">
+ <p>Example: <code class="example-input">AB026906.1:c.274G>T</code></p>
+ </div>
+
+ <div class="form-group button-group">
+ <input type="submit" class="btn btn-primary" value="Check name">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/NameChecker" target="new" class="btn btn-default pull-right">Help</a>
+ </div>
+ </form>
+
+ {% if description %}
+ <hr>
+ {% endif %}
+{% endif %}{# not standalone #}
+
+{% if description %}
+ {% if parse_error %}
+ <div class="alert alert-danger">
+ <h4>Parse error</h4>
+ <pre>{{ parse_error[0] }}<br>{{ parse_error[1] }}</pre>
+ <p>The "^" indicates the position where the error occurred.</p>
+ </div>
+ {% endif %}
+
+ {% if messages %}
+ {% for m in messages %}
+ {% if m.class == "error" %}
+ <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% elif m.class == "warning" %}
+ <p class="alert alert-warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% endif %}
+ {% endfor %}
+ {% endif %}
+
+ {% if summary == "0 Errors, 0 Warnings." %}
+ <p class="alert alert-success summary">{{ summary }}</p>
+ {% else %}
+ <p>{{summary}}</p>
+ {% endif %}
+
+ {% if not parse_error %}
+ <hr>
+
+ <div class="row">
+ <div class="col-md-8 name-checker-left-column">
+ {% if visualisation %}
+ <h4>Overview of the raw variants</h4>
+ {% for i in visualisation %}
+ <p>Raw variant {{ loop.index }}: {{ i[0] }}</p>
+ <pre>{{ i[1] }}<br>{{ i[2] }}</pre>
+ {% endfor %}
{% endif %}
- {% if not standalone %}
- <p>
- Please insert the mutation name using the <a href="http://www.hgvs.org/mutnomen" title="Human Genome Variation Society standard variant nomenclature" alt="Human Genome Variation Society standard variant nomenclature">HGVS</a> format: <br/>
+ {% if browserLink %}
+ <p><a href="{{ browserLink }}">View original variant in UCSC Genome Browser</a></p>
+ {% endif %}
- <code><accession number>.<version number>(<gene symbol>):<sequence type>.<variant description></code>
- </p>
+ {% if genomicDescription %}
+ {% if genomicDNA %}
+ <h4>Genomic description</h4>
+ {% else %}
+ <h4>Description relative to transcription start</h4>
+ <p>(Not for use in LSDBs in case of protein-coding transcripts).</p>
+ {% endif %}
+ <p><code><a href="{{ url_for('.name_checker', description=genomicDescription) }}">{{ genomicDescription }}</a></code></p>
+ {% endif %}
+
+ {% if chromDescription %}
+ <h4>Alternative chromosomal position</h4>
+ <p><code>{{ chromDescription }}</code></p>
+ {% endif %}
- <p>Example: <code class="example-input">AB026906.1:c.274G>T</code> </p>
+ {% if descriptions %}
+ <h4>Affected transcripts</h4>
+ {% for i in descriptions %}
+ {% if i.endswith('?') %}
+ <p><code>{{ i }}</code></p>
+ {% else %}
+ <p><code><a href="{{ url_for('.name_checker', description=i) }}">{{ i }}</a></code></p>
+ {% endif %}
+ {% endfor %}
+ {% endif %}
- <form class="form" action="{{ url_for('.name_checker') }}" method="get">
- <div class="form-group">
- <label for="description">HGVS Description</label>
- <input class="form-control form-pre example-target" type="text" name="description" id="hgvs" value="{{ description }}" placeholder="Mutation name using HGVS format">
- </div>
+ {% if protDescriptions %}
+ <h4>Affected proteins</h4>
+ {% for i in protDescriptions %}
+ <p><code>{{ i }}</code></p>
+ {% endfor %}
+ {% endif %}
+
+ {% if transcriptInfo %}
+ {% if oldProtein %}
+ <h4>Reference protein</h4>
+ <pre>
+ {%- for i in oldProtein -%}
+ {{-i |safe -}}<br>
+ {%- endfor -%}
+ </pre>
+
+ <h4>Protein codedicted from variant coding sequence</h4>
+ {% if newProtein %}
+ <pre>
+ {%- for i in newProtein -%}
+ {{- i|safe -}}<br>
+ {%- endfor -%}
+ </pre>
+ {% else %}
+ <p>No change: codedicted protein (not shown) equals reference protein.</p>
+ {% endif %}
+
+ {% if altStart %}
+ <h4>Alternative protein using start codon {{ altStart }}</h4>
+ {% if altProtein %}
+ <pre>
+ {%- for i in altProtein -%}
+ {{- i|safe -}}<br>
+ {%- endfor -%}
+ </pre>
+ {% else %}
+ <p>No change: codedicted protein (not shown) equals reference protein.</p>
+ {% endif %}
+ {% endif %}
+ {% endif %}
+ {% endif %}{# transcriptInfo #}
+
+ {% if restrictionSites %}
+ <h4>Effects on Restriction sites</h4>
+ <table class="table">
+ <thead>
+ <tr>
+ <th>Raw variant</th>
+ <th>Created</th>
+ <th>Deleted</th>
+ </tr>
+ </thead>
+ <tbody>
+ {% for i in restrictionSites %}
+ <tr>
+ <td>{{ loop.index }}</td>
+ <td>
+ {% for j in i[0] %}
+ {{ j }}{{ ',' if not loop.last }}
+ {% endfor %}
+ </td>
+ <td>
+ {% for j in i[1] %}
+ {{ j }}{{ ',' if not loop.last }}
+ {% endfor %}
+ </td>
+ </tr>
+ {% endfor %}
+ </tbody>
+ </table>
+ {% endif %}
- <div class="form-group button-group">
- <input type="submit" class="btn btn-primary" value="Check name">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/NameChecker" target="new" class="btn btn-default pull-right">Help</a>
- <input type="reset" class="btn btn-default pull-right" value="Undo">
- </div>
- </form>
+ {% if extractedDescription %}
+ <h4>Experimental services</h4>
+ <p>Genomic description: <code>{{ extractedDescription }}</code></p>
+ <p>Protein description: <code>{{ extractedProtein }}</code></p>
{% endif %}
+ </div>{# class="col-md-8 name-checker-left-column" #}
+
+ <div class="col-md-4">
+ {% if transcriptInfo %}
+ <h4>Exon information</h4>
+ <table class="table table2">
+ <thead>
+ <tr>
+ <th>Number</th>
+ <th>Start (g.)</th>
+ <th>Stop (g.)</th>
+ <th>Start {{ '(c.)' if transcriptCoding else '(n.)' }}</th>
+ <th>Stop {{ '(c.)' if transcriptCoding else '(n.)' }}</th>
+ </tr>
+ </thead>
+ <tbody>
+ {% for i in exonInfo %}
+ <tr>
+ <td>{{ loop.index }}</td>
+ {% for j in i %}
+ <td>{{ j }}</td>
+ {% endfor %}
+ </tr>
+ {% endfor %}
+ </tbody>
+ </table>
+
+ {% if transcriptCoding %}
+ <h4><span class="helper" title="Coding Sequence">CDS</span> information</h4>
+ <table class="table">
+ <thead>
+ <tr>
+ <th></th>
+ <th>g.</th>
+ <th>c.</th>
+ </tr>
+ </thead>
+ <tbody>
+ <tr>
+ <td>Start</td>
+ <td>{{ cdsStart_g }}</td>
+ <td>{{ cdsStart_c }}</td>
+ </tr>
+ <tr>
+ <td>Stop</td>
+ <td>{{ cdsStop_g }}</td>
+ <td>{{ cdsStop_c }}</td>
+ </tr>
+ </tbody>
+ </table>
+ {% endif %}
+ {% endif %}{# transcriptInfo #}
+
+ {% if reference_filename and not standalone %}
+ <h4>Links</h4>
+ <p>
+ Download this reference sequence file:
+ <a href="{{ url_for('.reference', filename=reference_filename) }}">{{ reference_filename }}</a>
+ </p>
+ {% endif %}
+ </div>{# class="col-md-4" #}
+ </div>{# class="row" #}
+
+ <div class="row">
+ <div class="col-md-12">
+ <hr />
+ {% if legends %}
+ <h4>Legend</h4>
+ <table class="table table3">
+ <thead>
+ <tr>
+ <th>Name</th>
+ <th>ID</th>
+ <th>Locus tag</th>
+ <th>Product</th>
+ <th>Link method</th>
+ </tr>
+ </thead>
+ <tbody>
+ {% for i in legends %}
+ <tr>
+ {% for j in i %}
+ <td>{{ j if j else '' }}</td>
+ {% endfor %}
+ </tr>
+ {% endfor %}
+ </tbody>
+ </table>
+ {% endif %}
+ </div>
+ </div>
+ {% endif %}{# not parse_error #}
+{% endif %}{# description #}
- <hr />
- <div class="row">
- <div class="col-md-8 name-checker-left-column">
- {% if visualisation %}
- <h3>Overview of the raw variants</h3>
- {% for i in visualisation %}
- <p>Raw variant {{ loop.index }}: {{ i[0] }}</p>
- <pre>{{ i[1] }}<br>{{ i[2] }}</pre>
- {% endfor %}
- {% endif %} <!-- if visualisation -->
-
- {% if browserLink %}
- <p>
- <a href="{{ browserLink }}">View original variant in UCSC Genome Browser</a>
- </p>
- {% endif %} <!-- if browserLink -->
-
- {% if not parse_error %}
- {% if description %}
- <h3>Name checker results</h3>
-
- {% if genomicDescription %}
- {% if genomicDNA %}
- <h4>Genomic description</h4>
- {% else %} <!-- if genomicDNA -->
- <h4>Description relative to transcription start</h4>
- (Not for use in LSDBs in case of protein-coding transcripts).
- {% endif %} <!-- if genomicDNA -->
- <code><a href="{{ url_for('.name_checker', description=genomicDescription) }}">{{ genomicDescription }}</a></code>
- {% endif %} <!-- if genomicDescription -->
-
- {% if chromDescription %}
- <p>Alternative chromosomal position:</p>
- <code>{{ chromDescription }}</code>
- {% endif %} <!-- if chromDescription -->
-
- {% if descriptions %}
- <h4>Affected transcripts:</h4>
- {% for i in descriptions %}
- {% if i.endswith('?') %}
- <code>{{ i }}</code>
- {% else %}
- <code><a href="{{ url_for('.name_checker', description=i) }}">{{ i }}</a></code>
- {% endif %} <!-- if endswith -->
- {% endfor %} <!-- for i in descriptions -->
- {% endif %} <!-- if descriptions -->
-
- {% if protDescriptions %}
- <h4>Affected proteins:</h4>
- <p>
- {% for i in protDescriptions %}
- <code>{{ i }}</code>
- {% endfor %} <!-- for i in protDescriptions -->
- </p>
- {% endif %} <!-- if protDescriptions -->
-
- {% if transcriptInfo %}
- {% if oldProtein %}
- <h4>Reference protein</h4>
- <pre>
- {%- for i in oldProtein -%}
- {{-i |safe -}}<br>
- {%- endfor -%}
- </pre>
-
- <h4>Protein codedicted from variant coding sequence</h4>
- {% if newProtein %}
- <pre>
- {%- for i in newProtein -%}
- {{- i|safe -}}<br>
- {%- endfor -%} <!-- for i in newProtein -->
- </pre>
- {% else %} <!-- if newProtein -->
- <p>
- No change: codedicted protein (not shown) equals reference
- protein.
- </p>
- {% endif %} <!-- if newProtein -->
-
- {% if altStart %}
- <h4>Alternative protein using start codon {{ altStart }}</h4>
- {% if altProtein %}
- <pre>
- {%- for i in altProtein -%}
- {{- i|safe -}}<br>
- {%- endfor -%} <!-- for i in altProtein -->
- </pre>
- {% else %} <!-- if altProtein -->
- <p>No change: codedicted protein (not shown) equals reference protein.</p>
- {% endif %} <!-- if altProtein -->
- {% endif %} <!-- if altStart -->
- {% endif %} <!-- if transcriptInfo -->
-
- {% if restrictionSites %}
- <h4>Effects on Restriction sites</h4>
- <div class="code">
- <table class="table table3">
- <thead>
- <th>Raw variant</th>
- <th>Created</th>
- <th>Deleted</th>
- </thead>
- {% for i in restrictionSites %}
- <tr>
- <td>{{ loop.index }}</td>
- <td>
- {% for j in i[0] %}
- {{ j }}{{ ',' if not loop.last }}
- {% endfor %}
- </td>
- <td>
- {% for j in i[1] %}
- {{ j }}{{ ',' if not loop.last }}
- {% endfor %}
- </td>
- </tr>
- {% endfor %}
- </table>
- </div>
- {% endif %} <!-- if restrictionSites -->
-
- {% if extractedDescription %}
- <h4>Experimental services</h4>
- <p>Genomic description: <code>{{ extractedDescription }}</code></p>
- <p>Protein description: <code>{{ extractedProtein }}</code></p>
- {% endif %} <!-- if extractedDescription -->
- {% endif %} <!-- description -->
- {% endif %} <!-- parse_error -->
- </div><!-- col-md-8 -->
-
- <div class="col-md-4">
- {% if description %}
- <h4>Exon information</h4>
- <div class="code">
- <table class="table table2">
- <thead>
- <th>Number</th>
- <th>Start (g.)</th>
- <th>Stop (g.)</th>
- <th>Start {{ '(c.)' if transcriptCoding else '(n.)' }}</th>
- <th>Stop {{ '(c.)' if transcriptCoding else '(n.)' }}</th>
- </thead>
-
- {% for i in exonInfo %}
- <tr>
- <td>{{ loop.index }}</td>
- {% for j in i %}
- <td>{{ j }}</td>
- {% endfor %}
- </tr>
- {% endfor %}
- </table>
- </div>
-
- {% if transcriptCoding %}
- <h4><span class = "helper" title = "Coding Sequence">CDS</span> information:</h4>
- <div class="code">
- <table class="table table3">
- <thead>
- <th></th>
- <th>g.</th>
- <th>c.</th>
- </thead>
- <tr>
- <td>Start</td>
- <td>{{ cdsStart_g }}</td>
- <td>{{ cdsStart_c }}</td>
- </tr>
- <tr>
- <td>Stop</td>
- <td>{{ cdsStop_g }}</td>
- <td>{{ cdsStop_c }}</td>
- </tr>
- <tr>
- </tr>
- </table>
- </div>
- {% endif %} <!-- if transcriptCoding -->
- <!-- {% endif %} --> <!-- ??? -->
-
-
- {% if reference_filename and not standalone %}
- <h4>Links</h4>
- <p>
- Download this reference sequence file:
- <a href="{{ url_for('.reference', filename=reference_filename) }}">{{ reference_filename }}</a>
- </p>
- {% endif %}
-
- {% endif %} <!-- description -->
- </div><!-- col-md-4 -->
- </div><!-- row -->
-
- {% if not parse_error %}
- <div class="row">
- <div class="col-md-12">
- <hr />
- {% if legends %}
- <h4>Legend</h4>
- <div class="code">
- <table class="table table3">
- <thead>
- <th>Name</th>
- <th>ID</th>
- <th>Locus tag</th>
- <th>Product</th>
- <th>Link method</th>
- </thead>
- {% for i in legends %}
- <tr>
- {% for j in i %}
- <td>{{ j if j else '' }}</td>
- {% endfor %}
- </tr>
- {% endfor %}
- </table>
- </div>
- {% endif %}
- </div><!-- col-md-12 -->
- </div><!-- row -->
- {% endif %}
{% endblock content %}
- </div>
+</div>
{% if piwik %}
<!-- Piwik -->
diff --git a/mutalyzer/website/templates/name-generator.html b/mutalyzer/website/templates/name-generator.html
index 0467603ce2466d175d2bdcbcd9abf81e1d54b576..fcf152e3fe7c96c80bce135eb20c3591288e780b 100644
--- a/mutalyzer/website/templates/name-generator.html
+++ b/mutalyzer/website/templates/name-generator.html
@@ -1,156 +1,156 @@
-
{% extends "base.html" %}
{% set active_page = "name-generator" %}
{% set page_title = "Name Generator" %}
{% block content %}
- <div class="form">
-
- <p>Construct the mutation from a reference by adding variants to it. The HGVS name is constructed instantly <a href="#constructed_name">below</a>.
-
- <hr/>
-
- <form id="mainform" onkeyup="update();" onchange="update();" style="padding: 0;" class="form-horizontal" role="form">
-
- <h4>Reference</h4>
- <div class="form-group">
- <label for="refe" class="col-sm-2 control-label">Reference sequence</label>
- <div class="col-sm-10">
- <input type="text" name="refe" value=""class="form-control" placeholder="Reference" >
- </div>
- </div>
-
- <div class="form-group">
- <label for="seqT" class="col-sm-2 control-label">Sequence Type</label>
- <div class="col-sm-10">
- <select name="seqT" class="form-control">
- <option value="g">Genomic</option>
- <option value="c" selected="1">Coding DNA</option>
- <option value="n">NonCoding DNA</option>
- <option value="r">RNAcss</option>
- <option value="m">Mitochondrial DNA</option>
- <option value="p" disabled="true">Protein</option>
- <!-- Protein Naming not yet implemented-->
- <option value="e">EST</option>
- </select>
- </div>
- </div>
-
-
- <div id="tlc" style="display: none; " class="form-group">
- <label class="label-left">TLC</label>
- <div class="radio">
- <label class="label-left"><input type="radio" name="tlc" value="0"class="form-control" > One Letter Code</label>
- </div>
- <div class="radio">
- <label class="label-left"><input type="radio" name="tlc" value="1" checked=""class="form-control" > Three Letter Code</label>
- </div>
- </div>
-
- <div id="gSym" class="form-group">
- <label for="gSym" class="col-sm-2 control-label">Gene symbol</label>
- <div class="col-sm-10">
- <input type="text" name="gSym" size="20" value=""class="form-control" placeholder="Gene symbol">
- </div>
- </div>
-
- <div id="tVar" class="form-group">
- <label for="tVar" class="col-sm-2 control-label">Transcript</label>
- <div class="col-sm-10">
- <input type="text" name="tVar" size="20" value=""class="form-control form-control-small" placeholder="Transcript">
- </div>
- </div>
-
- <div class="form-group small text-danger">
- <div class="col-sm-offset-2 col-sm-10">
- <div id="seqTerror" style="display: none;"></div>
- <div id="refeerror"></div>
- <div id="gSymerror"></div>
- <div id="tVarerror"></div>
- </div>
- </div>
-
- <div id="variants">
- <!-- This is where the mutations will be arriving -->
- </div>
-
-<!-- <div id="optional">
- <sup>*</sup> This field is optional
- </div> -->
-
+
+ <div class="form">
+
+ <p>Construct the mutation from a reference by adding variants to it. The HGVS name is constructed instantly <a href="#constructed_name">below</a>.
+
+ <hr/>
+
+ <form id="mainform" onkeyup="update();" onchange="update();" style="padding: 0;" class="form-horizontal" role="form">
+
+ <h4>Reference</h4>
+ <div class="form-group">
+ <label for="refe" class="col-sm-2 control-label">Reference sequence</label>
+ <div class="col-sm-10">
+ <input type="text" name="refe" value=""class="form-control" placeholder="Reference" >
+ </div>
+ </div>
+
+ <div class="form-group">
+ <label for="seqT" class="col-sm-2 control-label">Sequence Type</label>
+ <div class="col-sm-10">
+ <select name="seqT" class="form-control">
+ <option value="g">Genomic</option>
+ <option value="c" selected="1">Coding DNA</option>
+ <option value="n">NonCoding DNA</option>
+ <option value="r">RNAcss</option>
+ <option value="m">Mitochondrial DNA</option>
+ <option value="p" disabled="true">Protein</option>
+ <!-- Protein Naming not yet implemented-->
+ <option value="e">EST</option>
+ </select>
+ </div>
+ </div>
+
+
+ <div id="tlc" style="display: none; " class="form-group">
+ <label class="label-left">TLC</label>
+ <div class="radio">
+ <label class="label-left"><input type="radio" name="tlc" value="0"class="form-control" > One Letter Code</label>
+ </div>
+ <div class="radio">
+ <label class="label-left"><input type="radio" name="tlc" value="1" checked=""class="form-control" > Three Letter Code</label>
+ </div>
+ </div>
+
+ <div id="gSym" class="form-group">
+ <label for="gSym" class="col-sm-2 control-label">Gene symbol</label>
+ <div class="col-sm-10">
+ <input type="text" name="gSym" size="20" value=""class="form-control" placeholder="Gene symbol">
+ </div>
+ </div>
+
+ <div id="tVar" class="form-group">
+ <label for="tVar" class="col-sm-2 control-label">Transcript</label>
+ <div class="col-sm-10">
+ <input type="text" name="tVar" size="20" value="" class="form-control" placeholder="Transcript">
+ </div>
+ </div>
+
+ <div class="form-group small text-danger">
+ <div class="col-sm-offset-2 col-sm-10">
+ <div id="seqTerror" style="display: none;"></div>
+ <div id="refeerror"></div>
+ <div id="gSymerror"></div>
+ <div id="tVarerror"></div>
+ </div>
+ </div>
+
+ <div id="variants">
+ <!-- This is where the mutations will be arriving -->
+ </div>
+
+<!-- <div id="optional">
+ <sup>*</sup> This field is optional
+ </div> -->
+
<!-- Variant Template -->
- <div id="varianttemplate" style="display: none">
- <div class="row form-horizontal-inline">
- <div class="form-group col-md-6" id="V{NMBR}mutTrow">
- <label for="V{NMBR}mutT" id="V{NMBR}mutTname">Mutation Type</label>
- <select name="V{NMBR}mutT" onchange="update();"class="form-control input-sm" >
- <option value="1">Substitution</option>
- <option value="2">Deletion</option>
- <option value="3">Insertion</option>
- <option value="4">Duplication</option>
- <option value="5">Insertion/Deletion</option>
- <option value="6">Inversion</option>
- </select>
- <div class="text-danger small" id="{NMBR}mutTerror" class="errors"></div>
- </div>
-
- <div class="form-group col-md-6" id="V{NMBR}P1row">
- <label id="V{NMBR}P1name">Start Position</label>
- <input type="text" name="V{NMBR}P1" value="" class="form-control input-sm">
- <div class="text-danger small" id="V{NMBR}P1error"></div>
- </div>
-
- <div class="form-group col-md-6" id="V{NMBR}P2row">
- <label id="V{NMBR}P2name">End Position</label>
- <input type="text" name="V{NMBR}P2" size="20" value="" class="form-control input-sm" >
- <div class="text-danger small" id="V{NMBR}P2error"></div>
- </div>
- </div>
- <div class="row form-horizontal-inline">
- <div class="col-md-6" id="V{NMBR}S1row">
- <div class="form-group" name="S1">
- <label id="V{NMBR}S1name">Old Sequence</label>
- <input type="text" name="V{NMBR}S1" size="20" value=""class="form-control input-sm">
- <div class="text-danger small" id="V{NMBR}S1error"></div>
- </div>
- </div>
-
- <div class="col-md-6" id="V{NMBR}S2row">
- <div class="form-group" name="S2">
- <label id="V{NMBR}S2name">New Sequence</label>
- <input type="text" name="V{NMBR}S2" size="20" value=""class="form-control input-sm">
- <div class="text-danger small" id="V{NMBR}S2error"></div>
- </div>
- </div>
- </div>
- <hr/>
- </div><!-- varianttemplate -->
-
-
-
- <div class="form-group">
- <div class="col-sm-12">
- <input type="button" onclick="addVariant();" class="btn btn-success" value="Add variant +">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/NameGenerator" target="new" class="btn btn-default pull-right">Help</a>
- <input type="button" onclick="if(confirm('This action will clear all input fields'))javascript:location.reload(true);" value="Clear form" class="btn btn-default pull-right">
- </div>
- </div>
-
-
-
- </form>
-
- <hr/>
-
- <a id="constructed_name"><h4>Constructed HGVS Name</h4></a>
- <pre id="output" >
- <!-- Empty PlaceHolder -->
- </pre>
- <p class="text-muted">Please click the link to check with the Name Checker</p>
-
- </div><!-- form -->
+ <div id="varianttemplate" style="display: none">
+ <div class="row form-horizontal-inline">
+ <div class="form-group col-md-6" id="V{NMBR}mutTrow">
+ <label for="V{NMBR}mutT" id="V{NMBR}mutTname">Mutation Type</label>
+ <select name="V{NMBR}mutT" onchange="update();"class="form-control input-sm" >
+ <option value="1">Substitution</option>
+ <option value="2">Deletion</option>
+ <option value="3">Insertion</option>
+ <option value="4">Duplication</option>
+ <option value="5">Insertion/Deletion</option>
+ <option value="6">Inversion</option>
+ </select>
+ <div class="text-danger small" id="{NMBR}mutTerror" class="errors"></div>
+ </div>
+
+ <div class="form-group col-md-6" id="V{NMBR}P1row">
+ <label id="V{NMBR}P1name">Start Position</label>
+ <input type="text" name="V{NMBR}P1" value="" class="form-control input-sm">
+ <div class="text-danger small" id="V{NMBR}P1error"></div>
+ </div>
+
+ <div class="form-group col-md-6" id="V{NMBR}P2row">
+ <label id="V{NMBR}P2name">End Position</label>
+ <input type="text" name="V{NMBR}P2" size="20" value="" class="form-control input-sm" >
+ <div class="text-danger small" id="V{NMBR}P2error"></div>
+ </div>
+ </div>
+ <div class="row form-horizontal-inline">
+ <div class="col-md-6" id="V{NMBR}S1row">
+ <div class="form-group" name="S1">
+ <label id="V{NMBR}S1name">Old Sequence</label>
+ <input type="text" name="V{NMBR}S1" size="20" value=""class="form-control input-sm">
+ <div class="text-danger small" id="V{NMBR}S1error"></div>
+ </div>
+ </div>
+
+ <div class="col-md-6" id="V{NMBR}S2row">
+ <div class="form-group" name="S2">
+ <label id="V{NMBR}S2name">New Sequence</label>
+ <input type="text" name="V{NMBR}S2" size="20" value=""class="form-control input-sm">
+ <div class="text-danger small" id="V{NMBR}S2error"></div>
+ </div>
+ </div>
+ </div>
+ <hr/>
+ </div><!-- varianttemplate -->
+
+
+
+ <div class="form-group">
+ <div class="col-sm-12">
+ <input type="button" onclick="addVariant();" class="btn btn-success" value="Add variant +">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/NameGenerator" target="new" class="btn btn-default pull-right">Help</a>
+ <input type="button" onclick="if(confirm('This action will clear all input fields'))javascript:location.reload(true);" value="Clear form" class="btn btn-default pull-right">
+ </div>
+ </div>
+
+
+
+ </form>
+
+ <hr/>
+
+ <a id="constructed_name"></a><h4>Constructed HGVS Name</h4>
+ <p><code id="output" >
+ <!-- Empty PlaceHolder -->
+ </code></p>
+ <p class="text-muted">Please click the link to check with the Name Checker</p>
+
+ </div><!-- form -->
<!-- Inline Javascript -->
@@ -165,6 +165,4 @@
</script>
-
-
{% endblock content %}
diff --git a/mutalyzer/website/templates/position-converter.html b/mutalyzer/website/templates/position-converter.html
index d7dc142404bc690a70d5725581135fd73eec3f4d..625e4219b6f237e83e90bb5f366e0f64381e3353 100644
--- a/mutalyzer/website/templates/position-converter.html
+++ b/mutalyzer/website/templates/position-converter.html
@@ -5,80 +5,64 @@
{% block content %}
- <p>
- Please supply the genome assembly which you want to use to convert your
- position.
- </p>
- <p>
- <b>Note:</b> The Position Converter does NOT check the description or
- normalize it to HGVS. Use the <a href="{{ url_for('.name_checker') }}">Name Checker</a> for this.
- </p>
- <p>
- Examples: <code class="example-input">NM_003002.2:c.274G>T</code>, <code class="example-input">chr11:g.111959693G>T</code> and <code class="example-input">NC_000011.9:g.111959693G>T</code>
- </p>
- <form class="form-horizontal" role="form" action="{{ url_for('.position_converter') }}" method="get" enctype="multipart/form-data">
-
- <div class="form-group">
- <label for="assembly_name_or_alias" class="col-md-2 control-label">Build</label>
- <div class="col-md-10">
- <select name="assembly_name_or_alias" class="form-control">
- {% for assembly in assemblies %}
- <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{ assembly.alias }}){% endif %}</option>
- {% endfor %}
- </select>
- </div>
- </div>
-
- <div class="form-group">
- <label for="description" class="col-md-2 control-label">Variant</label>
- <div class="col-md-10">
- <input type="text" name="description" value="{{ description }}" class="form-control form-pre example-target" placeholder="Variant">
- </div>
- </div>
- <div class="form-group">
- <div class=" col-md-12">
- <input type="submit" class="btn btn-primary" value="Submit">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/PositionConverter" target="new" class="btn btn-default pull-right">Help</a>
- <input type="reset" class="btn btn-default pull-right" value="Undo">
- </div>
- </div>
- </form>
+<p>
+Please supply the genome assembly which you want to use to convert your
+position.
+</p>
-{% if description %}
- <h3>Results</h3>
+<p>
+<b>Note:</b> The Position Converter does NOT check the description or
+normalize it to HGVS. Use the <a href="{{ url_for('.name_checker') }}">Name Checker</a> for this.
+</p>
+
+
+<form class="form" role="form" action="{{ url_for('.position_converter') }}" method="get" enctype="multipart/form-data">
+ <div class="form-group">
+ <label for="assembly_name_or_alias">Build</label>
+ <select name="assembly_name_or_alias" class="form-control">
+ {% for assembly in assemblies %}
+ <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{ assembly.alias }}){% endif %}</option>
+ {% endfor %}
+ </select>
+ </div>
+ <div class="form-group">
+ <label for="description">Variant</label>
+ <input type="text" name="description" value="{{ description }}" class="form-control form-pre example-target" placeholder="Variant">
+ <p>Examples: <code class="example-input">NM_003002.2:c.274G>T</code>, <code class="example-input">chr11:g.111959693G>T</code> and <code class="example-input">NC_000011.9:g.111959693G>T</code></p>
+ </div>
+ <div class="form-group button-group">
+ <input type="submit" class="btn btn-primary" value="Submit">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/PositionConverter" target="new" class="btn btn-default pull-right">Help</a>
+ </div>
+</form>
+{% if description %}
+ <hr>
{% for m in messages %}
- {% if m.class == "error" %}
- <div class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</div>
- {% elif m.class == "warning" %}
- <div class="alert warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</div>
- {% endif %}
+ {% if m.class == "error" %}
+ <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% elif m.class == "warning" %}
+ <p class="alert warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% endif %}
{% endfor %}
-
- {% if summary == "0 Errors, 0 Warnings."%}
- <div class="alert success summary">{{ summary }}</div>
+
+ {% if summary == "0 Errors, 0 Warnings." %}
+ <p class="alert alert-success summary">{{ summary }}</p>
{% else %}
- <div>{{summary}}</div>
+ <p>{{summary}}</p>
{% endif %}
{% if chromosomal_description %}
- <p>
- <h4>Chromosomal Variant:</h4>
- </p>
- <pre>{{ chromosomal_description }}</pre>
- {% if not transcript_descriptions %}
- <p>
- <b>No transcripts found in mutation region</b>
- </p>
- {% endif %}
- {% endif %}
+ <h4>Chromosomal variant</h4>
+ <p><code>{{ chromosomal_description }}</code></p>
- {% if transcript_descriptions %}
- <p>
- <b>Found transcripts in mutation region:</b>
- </p>
- <pre>{% for d in transcript_descriptions %}{{ d }}<br>{% endfor %}</pre>
+ {% if transcript_descriptions %}
+ <h4>Found transcripts in mutation region</h4>
+ <pre>{% for d in transcript_descriptions %}{{ d }}<br>{% endfor %}</pre>
+ {% else %}
+ <h4>No transcripts found in mutation region</h4>
+ {% endif %}
{% endif %}
-{% endif %}
+{% endif %}{# description #}
{% endblock content %}
diff --git a/mutalyzer/website/templates/reference-loader.html b/mutalyzer/website/templates/reference-loader.html
index decbc6b89913b6b15dc76bb611f40bae4b10e075..a4e2e1ba3534738a0559f4a3c32f8aeccd565e01 100644
--- a/mutalyzer/website/templates/reference-loader.html
+++ b/mutalyzer/website/templates/reference-loader.html
@@ -13,174 +13,172 @@ window.onload=function(){
}
</script>
-{% if errors %}
-<div class="alert alert-danger" role="alert">
- <h4>Reference File not loaded!</h4>
- The following errors occured:
- <ul>
- {% for i in errors %}
- <li>{{ i }}</li>
- {% endfor %}
- </ul>
-</div>
-{% endif %}
-
-{% if ud %}
-<div class="alert alert-success">
- <h4>Reference Sequence successfully loaded</h4>
- <p>Your reference sequence was loaded successfully. You can now use Mutalyzer with the following accession number as reference:</p>
- <p class="text-center" style="font-size: 20px"><strong>{{ ud }}</strong></p>
- <p class="text-center"><a href="{{ url_for('.reference', filename=ud + '.gb') }}" id="reference_download" class="">Download this reference sequence.</a></p>
-</div>
-{% endif %}
-
-
<p>
The Reference File Loader allows you to use your own reference
sequence when no appropriate RefSeq, GenBank or LRG file is available.
</p>
<p>
Please select one of the options below to upload or retrieve your reference
-sequence (maximum size is {{ max_file_size }} megabytes):
+sequence (maximum size is {{ max_file_size }} megabytes).
</p>
<form name="invoer" enctype="multipart/form-data" action="{{ url_for('.reference_loader') }}" method="post">
- <div class="row">
- <div class="col-md-6">
- <div class="form-group" id="input-methods">
- <div class="radio">
- <label>
- <input type="radio" name="method" value="upload" checked >
- The reference sequence file is a local file
- </label>
- </div>
- <div class="radio">
- <label>
- <input type="radio" name="method" value="url" >
- The reference sequence file can be found at the following URL
- </label>
- </div>
- <div class="radio">
- <label>
- <input type="radio" name="method" value="slice_gene" >
- Retrieve part of the reference genome for a (HGNC) gene symbol
- </label>
- </div>
- <div class="radio">
- <label>
- <input type="radio" name="method" value="slice_accession" >
- Retrieve a range of a chromosome by accession number
- </label>
- </div>
- <div class="radio">
- <label>
- <input type="radio" name="method" value="slice_chromosome" >
- Retrieve a range of a chromosome by name
- </label>
- </div>
- </div>
- </div>
- <script type="text/javascript">
- $('#input-methods input').on('change', updateVisibility);
- </script>
- <div class="col-md-6">
-
-
- <div class="form-group" id="upload_label">
- <label for="file">GenBank file</label>
- <input type="file" name="file">
- <p class="help-block">Please select the GenBank file in plain text format</p>
- </div>
-
-
- <div class="form-group" id="url_label">
- <label for="url">GenBank file URL</label>
- <input type="text" name="url" class="form-control">
- <p class="help-block">Please enter the URL of the GenBank file in plain text (including http://)</p>
- </div>
-
-
- <div id="slice_gene_label">
- <div class="form-group">
- <p class="help-block">Please enter the Gene symbol and organism name without spaces
- and specify the length of the flanking sequences</p>
- <p class="help-block"><b>Note:</b> This uses
- the <a href="http://www.ncbi.nlm.nih.gov/sites/gquery">NCBI
- Entrez</a> search engine and is therefore based on the current
- Entrez assembly for the given organism (GRCh38/hg38 for human).</p>
-
- <label for="genesymbol">Gene symbol</label>
- <input type="text" name="genesymbol" class="form-control">
- </div>
- <div class="form-group">
- <label for="organism">Organism name</label>
- <input type="text" name="organism" class="form-control">
- </div>
- <div class="form-group">
- <label for="upstream">Number of 5' flanking nucleotides</label>
- <input type="text" name="upstream" value="5000" class="form-control">
- </div>
- <div class="form-group">
- <label for="downstream"><td>Number of 3' flanking nucleotides</label>
- <input type="text" name="downstream" value="2000" class="form-control">
- </div>
- </div>
-
-
- <div id="slice_accession_label">
- <div class="form-group">
- <p class="help-block">Please enter the accession number of the chromosome or contig and specify the range</p>
- <label>Chromosome accession number</label>
- <input type="text" name="accession" class="form-control">
- </div>
- <div class="form-group">
- <label>Start position</label>
- <input type="text" name="accession_start" class="form-control">
- </div>
- <div class="form-group">
- <label>Stop position</label>
- <input type="text" name="accession_stop" class="form-control">
- </div>
- <div class="form-group">
- <label>Orientation</label>
- <div class="radio"><label><input type="radio" name="accession_orientation" value="1" checked> Forward</label></div>
- <div class="radio"><label><input type="radio" name="accession_orientation" value="2"> Reverse</label></div>
- </div>
- </div>
-
- <div id="slice_chromosome_label">
- <div class="form-group">
- <p class="help-block">Please enter the name of the chromosome and specify the range</p>
- <label for="assembly_name_or_alias">Assembly</label>
- <select name="assembly_name_or_alias">
- {% for assembly in assemblies %}
- <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{assembly.alias }}){% endif %}</option>
- {% endfor %}
- </select>
- </div>
- <div class="form-group">
- <label for="chromosome">Chromosome name</label>
- <input type="text" name="chromosome" class="form-control">
- </div>
- <div class="form-group">
- <label for="chromosome_start">Start position</label>
- <input type="text" name="chromosome_start" class="form-control">
- </div>
- <div class="form-group">
- <label for="chromosome_stop">Stop position</label>
- <input type="text" name="chromosome_stop" class="form-control">
- </div>
- <div class="form-group">
- <label for="chromosome_orientation">Orientation</label>
- <div class="radio"><label><input type="radio" name="chromosome_orientation" value="1" checked> Forward</label></div>
- <div class="radio"><label><input type="radio" name="chromosome_orientation" value="2"> Reverse</label></div>
- </div>
- </div>
- </div>
- </div>
- <input type="submit" value="Submit"class="btn btn-primary btn-submit" >
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/SyntaxChecker" target="_blank" class="btn btn-default pull-right">Help</a>
-
+ <div class="row">
+ <div class="col-md-6">
+ <div class="form-group" id="input-methods">
+ <div class="radio">
+ <label>
+ <input type="radio" name="method" value="upload" checked >
+ The reference sequence file is a local file.
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="method" value="url" >
+ The reference sequence file can be found at the following URL.
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="method" value="slice_gene" >
+ Retrieve part of the reference genome for a (HGNC) gene symbol.
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="method" value="slice_accession" >
+ Retrieve a range of a chromosome by accession number.
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="method" value="slice_chromosome" >
+ Retrieve a range of a chromosome by name.
+ </label>
+ </div>
+ </div>
+ </div>
+
+ <script type="text/javascript">
+ $('#input-methods input').on('change', updateVisibility);
+ </script>
+
+ <div class="col-md-6">
+ <div class="form-group" id="upload_label">
+ <label for="file">GenBank file</label>
+ <input type="file" name="file">
+ <p class="help-block">Please select the GenBank file in plain text format.</p>
+ </div>
+
+ <div class="form-group" id="url_label">
+ <label for="url">GenBank file URL</label>
+ <input type="text" name="url" class="form-control">
+ <p class="help-block">Please enter the URL of the GenBank file in plain text (including http://).</p>
+ </div>
+
+ <div id="slice_gene_label">
+ <div class="form-group">
+ <p class="help-block">Please enter the Gene symbol and organism name without spaces
+ and specify the length of the flanking sequences.</p>
+ <p class="help-block"><b>Note:</b> This uses
+ the <a href="http://www.ncbi.nlm.nih.gov/sites/gquery">NCBI
+ Entrez</a> search engine and is therefore based on the current
+ Entrez assembly for the given organism (GRCh38/hg38 for human).</p>
+ <label for="genesymbol">Gene symbol</label>
+ <input type="text" name="genesymbol" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="organism">Organism name</label>
+ <input type="text" name="organism" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="upstream">Number of 5' flanking nucleotides</label>
+ <input type="text" name="upstream" value="5000" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="downstream"><td>Number of 3' flanking nucleotides</label>
+ <input type="text" name="downstream" value="2000" class="form-control">
+ </div>
+ </div>
+
+ <div id="slice_accession_label">
+ <div class="form-group">
+ <p class="help-block">Please enter the accession number of the chromosome or contig and specify the range.</p>
+ <label>Chromosome accession number</label>
+ <input type="text" name="accession" class="form-control">
+ </div>
+ <div class="form-group">
+ <label>Start position</label>
+ <input type="text" name="accession_start" class="form-control">
+ </div>
+ <div class="form-group">
+ <label>Stop position</label>
+ <input type="text" name="accession_stop" class="form-control">
+ </div>
+ <div class="form-group">
+ <label>Orientation</label>
+ <div class="radio"><label><input type="radio" name="accession_orientation" value="1" checked> Forward</label></div>
+ <div class="radio"><label><input type="radio" name="accession_orientation" value="2"> Reverse</label></div>
+ </div>
+ </div>
+
+ <div id="slice_chromosome_label">
+ <div class="form-group">
+ <p class="help-block">Please enter the name of the chromosome and specify the range.</p>
+ <label for="assembly_name_or_alias">Assembly</label>
+ <select name="assembly_name_or_alias" class="form-control">
+ {% for assembly in assemblies %}
+ <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{assembly.alias }}){% endif %}</option>
+ {% endfor %}
+ </select>
+ </div>
+ <div class="form-group">
+ <label for="chromosome">Chromosome name</label>
+ <input type="text" name="chromosome" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="chromosome_start">Start position</label>
+ <input type="text" name="chromosome_start" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="chromosome_stop">Stop position</label>
+ <input type="text" name="chromosome_stop" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="chromosome_orientation">Orientation</label>
+ <div class="radio"><label><input type="radio" name="chromosome_orientation" value="1" checked> Forward</label></div>
+ <div class="radio"><label><input type="radio" name="chromosome_orientation" value="2"> Reverse</label></div>
+ </div>
+ </div>
+ </div>
+ </div>
+ <div class="form-group">
+ <input type="submit" value="Submit"class="btn btn-primary">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/SyntaxChecker" target="_blank" class="btn btn-default pull-right">Help</a>
+ </div>
</form>
+{% if errors %}
+ <hr>
+ <div class="alert alert-danger" role="alert">
+ <h4>Reference File not loaded!</h4>
+ The following errors occured:
+ <ul>
+ {% for i in errors %}
+ <li>{{ i }}</li>
+ {% endfor %}
+ </ul>
+ </div>
+{% endif %}
+
+{% if ud %}
+ <hr>
+ <div class="alert alert-success">
+ <h4>Reference Sequence successfully loaded</h4>
+ <p>Your reference sequence was loaded successfully. You can now use Mutalyzer with the following accession number as reference:</p>
+ <p class="text-center" style="font-size: 20px"><code>{{ ud }}</code></p>
+ <p><a href="{{ url_for('.reference', filename=ud + '.gb') }}" id="reference_download" class="">Download this reference sequence</a>.</p>
+ </div>
+{% endif %}
+
{% endblock content %}
diff --git a/mutalyzer/website/templates/snp-converter.html b/mutalyzer/website/templates/snp-converter.html
index 837ce97c27218ec863c1889572126d7a7b080128..b24064ff9b0b3cbdfedca2ee3abd75c076e91630 100644
--- a/mutalyzer/website/templates/snp-converter.html
+++ b/mutalyzer/website/templates/snp-converter.html
@@ -5,68 +5,53 @@
{% block content %}
- {% if messages %}
- {% for m in messages %}
- {% if m.class == "error" %}
- <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
- {% elif m.class == "warning" %}
- <p class="alert alert-warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
- {% endif %}
- {% endfor %}
- {% endif %} <!-- messages -->
-
- {% if summary == "0 Errors, 0 Warnings."%}
- <p class="alert alert-success summary">{{ summary }}</p>
- {% else %}
- <p>{{summary}}</p>
- <hr />
- {% endif %}
-
- <p>
- Please insert the
- <a href="http://www.ncbi.nlm.nih.gov/projects/SNP/">dbSNP</a> rs
- number below. Mutalyzer will retrieve the HGVS description of the SNP specified on the reference sequence(s) used by dbSNP.
- </p>
-
- <p>
- Example: <code class="example-input">rs9919552</code>
- </p>
-
- <form role="form" class="form" action="{{ url_for('.snp_converter') }}" method="get">
- <div class="form-group">
- <label for="description">dbSNP rs number</label>
- <input type="text" class="form-control form-pre example-target" name="rs_id" placeholder="" value="{{ rs_id }}" ></input>
- </div>
-
- <div class="form-group">
- <input type="submit" class="btn btn-primary" value="Submit">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/PositionConverter" target="new" class="btn btn-default pull-right">Help</a>
- <input type="reset" class="btn btn-default pull-right" value="Undo">
- </div>
- </form>
+<p>
+Please insert
+the <a href="http://www.ncbi.nlm.nih.gov/projects/SNP/">dbSNP</a> rs number
+below. Mutalyzer will retrieve the HGVS description of the SNP specified on
+the reference sequence(s) used by dbSNP.
+</p>
+
+<form role="form" class="form" action="{{ url_for('.snp_converter') }}" method="get">
+ <div class="form-group">
+ <label for="description">dbSNP rs number</label>
+ <input type="text" class="form-control form-pre example-target" name="rs_id" placeholder="" value="{{ rs_id }}" ></input>
+ <p>Example: <code class="example-input">rs9919552</code></p>
+ </div>
+
+ <div class="form-group">
+ <input type="submit" class="btn btn-primary" value="Submit">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/PositionConverter" target="new" class="btn btn-default pull-right">Help</a>
+ </div>
+</form>
{% if rs_id %}
- <h3>SNP converter results</h3>
+ <hr>
+ {% if messages %}
+ {% for m in messages %}
+ {% if m.class == "error" %}
+ <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% elif m.class == "warning" %}
+ <p class="alert alert-warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% endif %}
+ {% endfor %}
+ {% endif %}
-<!-- {% for m in messages %}
- {% if m.class == "error" %}
- <div class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</div>
- {% elif m.class == "warning" %}
- <div class="alert warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</div>
- {% endif %}
- {% endfor %}
-
{% if summary == "0 Errors, 0 Warnings."%}
- <div class="alert success summary">{{ summary }}</div>
+ <p class="alert alert-success summary">{{ summary }}</p>
{% else %}
- <div>{{summary}}</div>
- {% endif %} -->
-
+ <p>{{summary}}</p>
+ {% endif %}
+
+ <hr>
<h4>dbSNP rs ID</h4>
- <pre>{{ rs_id }}</pre>
+ <p><code>{{ rs_id }}</code></p>
+
<h4>HGVS descriptions</h4>
- <pre>{% for d in descriptions %}{{ d }}</br>{% endfor %}</pre>
-{% endif %}
+ {% for d in descriptions %}
+ <p><code>{{ d }}</code></p>
+ {% endfor %}
+{% endif %}{# rs_id #}
{% endblock content %}
diff --git a/mutalyzer/website/templates/static/css/style.css b/mutalyzer/website/templates/static/css/style.css
index 99241013150cf74b41c36768882682140c958f87..08f868e646cb034afe19beb5ab63474230a0f6d9 100644
--- a/mutalyzer/website/templates/static/css/style.css
+++ b/mutalyzer/website/templates/static/css/style.css
@@ -3,7 +3,7 @@ body{
/* margin: 0 10px;*/
padding-top: 70px;
/* padding-top: 110px;*/
-
+
font-family: Roboto;
-webkit-font-smoothing: antialiased;
}
@@ -15,17 +15,17 @@ body{
margin-right: auto;
padding: 40px;
margin-bottom: 25px;
-
+
border-radius: 2px;
-
- font-size: 14px;
+
+ font-size: 14px;
font-weight: 400;
}
.block-shadow {
/* box-shadow: 0 -1px 2.5px rgba(0,0,0,0.12), 0 1px 2px rgba(0, 0,0,0.24);*/
box-shadow: 1px 2px 2px rgba(50,50,50,.16), -1px -1px 3px rgba(50, 50, 50,.23);
-
+
}
@@ -49,11 +49,11 @@ body{
.block {
padding: 15px;
}
-
+
.block-shadow {
box-shadow: none;
}
-
+
.block h1 {
font-size: 32px;
line-height: 1em;
@@ -75,7 +75,7 @@ footer.row {
/* padding-top:20px;
padding-bottom: 20px;*/
}
-.navbar-header {
+.navbar-header {
z-index: 3;
position: relative;
}
@@ -120,7 +120,7 @@ h2,h3,h4,h5{
}
input[type="text"].form-pre{
- font-family: Menlo, Monaco, Consolas, "Courier New", monospace;
+ font-family: Menlo, Monaco, Consolas, "Courier New", monospace;
}
code {
@@ -146,11 +146,11 @@ header.main-header {
.table2 > td {
padding: 3px;
}
-
+
.table2{
margin-bottom: 0px;
}
-
+
.pre {
padding: 0 9.5px;
margin: 0 30px 10px 30px;
@@ -167,15 +167,6 @@ header.main-header {
cursor: default;
}
-.btn-right{
- width: 177px;
- margin-left: 375px;
-}
-
-.btn-submit{
- margin-top: 15px;
-}
-
.summary{
text-align: left;
}
@@ -195,7 +186,7 @@ header.main-header {
font-size: 11px;
cursor: pointer;
}
-
+
#variants{
/* border: 1px solid green; */
}
diff --git a/mutalyzer/website/templates/syntax-checker.html b/mutalyzer/website/templates/syntax-checker.html
index 75c353ce544e5fd345569a38255139d8d83db96c..3854c8c1269be83038824a09f26562df7dad08e5 100644
--- a/mutalyzer/website/templates/syntax-checker.html
+++ b/mutalyzer/website/templates/syntax-checker.html
@@ -2,49 +2,51 @@
{% set active_page = "syntax-checker" %}
{% set page_title = "Syntax checker" %}
-<!-- {% set page_titles = "Syntax Checker" %} -->
{% block content %}
- {% if description %}
- <h3>Variant syntax checker results</h3>
- {% if parse_error %}
- <div class="alert alert-danger">
- <h4>There were errors</h4>
- <ul>
- {% for m in messages %}
- <li title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</li>
- {% endfor %}
- </ul>
- <h5>Details of the parse error</h5>
- <pre>{{- parse_error[0] }}<br>{{- parse_error[1] }}</pre>
- <p>The "^" indicates the position where the error occurred.</p>
- </div>
- {% else %}
- <div class="alert alert-success">
- The syntax of this variant is OK!
- </div>
- {% endif %}
- <br>
- {% endif %}
- <p>
- Please insert the mutation name using the <a href="http://www.hgvs.org/mutnomen" title="Human Genome Variation Society standard variant nomenclature" alt="Human Genome Variation Society standard variant nomenclature">HGVS</a> format:<br>
- <code><accession number>.<version number>(<gene symbol>):<sequence type>.<variant description></code>
- </p>
-
- <p>
- Example: <code class="example-input">AB026906.1:c.274G>T</code>
- </p>
-
- <form class="form" action="{{ url_for('.syntax_checker') }}" method="get">
- <div class="form-group">
- <label for="description">HGVS Description</label>
- <input class="form-control form-pre example-target" type="text" name="description" value="{{ description }}" placeholder="Mutation name using HGVS format">
- </div>
- <div class="form-group button-group">
- <input type="submit" class="btn btn-primary" value="Check syntax">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/SyntaxChecker" target="new" class="btn btn-default pull-right">Help</a>
- <input type="reset" class="btn btn-default pull-right" value="Undo">
- </div>
- </form>
-
+
+<p>
+Please insert the mutation name using
+the <a href="http://www.hgvs.org/mutnomen" title="Human Genome Variation
+Society standard variant nomenclature" alt="Human Genome Variation Society
+standard variant nomenclature">HGVS</a> format:
+</p>
+
+<pre><accession number>.<version number>(<gene symbol>):<sequence type>.<variant description></pre>
+
+<form class="form" action="{{ url_for('.syntax_checker') }}" method="get">
+ <div class="form-group">
+ <label for="description">HGVS Description</label>
+ <input class="form-control form-pre example-target" type="text" name="description" value="{{ description }}" placeholder="Mutation name using HGVS format">
+ <p>Example: <code class="example-input">AB026906.1:c.274G>T</code></p>
+ </div>
+ <div class="form-group button-group">
+ <input type="submit" class="btn btn-primary" value="Check syntax">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/SyntaxChecker" target="new" class="btn btn-default pull-right">Help</a>
+ </div>
+</form>
+
+{% if description %}
+ <hr>
+ {% if parse_error %}
+ <div class="alert alert-danger">
+ <h4>Parse error</h4>
+ <pre>{{ parse_error[0] }}<br>{{ parse_error[1] }}</pre>
+ <p>The "^" indicates the position where the error occurred.</p>
+ </div>
+ {% else %}
+ <p class="alert alert-success">The syntax of this variant is OK!</p>
+ {% endif %}
+
+ {% if messages %}
+ {% for m in messages %}
+ {% if m.class == "error" %}
+ <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% elif m.class == "warning" %}
+ <p class="alert alert-warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% endif %}
+ {% endfor %}
+ {% endif %}
+{% endif %}{# description #}
+
{% endblock content %}
diff --git a/mutalyzer/website/views.py b/mutalyzer/website/views.py
index 9f47146c07b22a1a74b00b8efe7c83d9c0ed7410..992e84a502ba6d46c310f65f0e50b9611b6ac412 100644
--- a/mutalyzer/website/views.py
+++ b/mutalyzer/website/views.py
@@ -829,14 +829,14 @@ def batch_jobs_submit():
for error in errors:
output.addMessage(__file__, 3, 'EBATCHJOB', error)
- errors = map(util.message_info, output.getMessages())
+ messages = map(util.message_info, output.getMessages())
return render_template('batch-jobs.html',
assemblies=assemblies,
assembly_name_or_alias=assembly_name_or_alias,
job_type=job_type,
max_file_size=settings.MAX_FILE_SIZE // 1048576,
- errors=errors)
+ messages=messages)
@website.route('/batch-job-progress')
diff --git a/tests/test_website.py b/tests/test_website.py
index a7fa1b1dc6a5cce119897309930522e32d40c2c8..06b19d9d7bf24ceab3a4ec7ae7d7a0a23149538b 100644
--- a/tests/test_website.py
+++ b/tests/test_website.py
@@ -124,7 +124,7 @@ class TestWebsite(MutalyzerTest):
r = self.app.get('/syntax-checker',
query_string={'description': 'AB026906.1:c.27'})
assert 'Fatal' in r.data
- assert 'Details of the parse error' in r.data
+ assert 'The "^" indicates the position where the error occurred' in r.data
@fix(database, cache('NM_002001.2'))
def test_check_valid(self):
@@ -742,7 +742,7 @@ class TestWebsite(MutalyzerTest):
query_string={'description': 'La Pe\xf1a'})
body = r.get_data(as_text=True)
assert 'Fatal' in body
- assert 'Details of the parse error' in body
+ assert 'The "^" indicates the position where the error occurred' in body
assert 'Expected W:(0123...) (at char 2), (line:1, col:3)' in body
@fix(database)