diff --git a/mutalyzer/website/templates/about.html b/mutalyzer/website/templates/about.html
index eb96e1511a5d6371715469b8d17311f71a8bb5a4..944f433d01e4323e387e67806501534505680592 100644
--- a/mutalyzer/website/templates/about.html
+++ b/mutalyzer/website/templates/about.html
@@ -51,40 +51,91 @@ please mention
</p>
<p>
-Project development is sponsored by
-<a href="http://www.gen2phen.org" target="_blank">
- <img src="{{ url_for('static', filename='images/gen_2_phen_logo_print.png') }}"
- width="110"
- height="50"
- align="middle"
- border="0"
- alt="Eurogentest"></a>
-and
-<a href="http://www.nbic.nl" target="_blank">
- <img src="{{ url_for('static', filename='images/nbic_logo.png') }}"
- width="229"
- height="50"
- align="middle"
- border="0"
- alt="NBIC"></a>
-and has been supported by
-<a href="http://www.eurogentest.org" target="_blank">
- <img src="{{ url_for('static', filename='images/Eurogentest.png') }}"
- width="110"
- height="50"
- align="middle"
- border="0"
- alt="Eurogentest"></a>
-and
-<a href="http://www.commit-nl.nl/" target="_blank">
- <img src="{{ url_for('static', filename='images/commit_logo.png') }}"
- width="122"
- height="50"
- align="middle"
- border="0"
- alt="Dutch national program COMMIT"></a>
+Sponsors:
</p>
+<p>
+We would like to thank the following organisations for their contribution to
+the development of Mutalyzer.
+</p>
+
+<table cellspacing="10" class="table">
+ <tr>
+ <td>
+ <a href="http://www.gen2phen.org" target="_blank">
+ <img src="{{ url_for('static', filename='images/gen_2_phen_logo_print.png') }}"
+ width="110"
+ height="50"
+ align="middle"
+ border="0"
+ alt="Gen2Phen"
+ title="Gen2Phen"></a>
+ </td>
+ <td>
+ <a href="http://www.gen2phen.org">Gen2Phen project</a>
+ </td>
+ </tr>
+ <tr>
+ <td>
+ <a href="http://www.nbic.nl" target="_blank">
+ <img src="{{ url_for('static', filename='images/nbic_logo.png') }}"
+ width="229"
+ height="50"
+ align="middle"
+ border="0"
+ alt="NBIC"
+ title="NBIC"></a>
+ </td>
+ <td>
+ <a href="http://www.nbic.nl">Netherlands Bioinformatics Centre</a>
+ </td>
+ </tr>
+ <tr>
+ <td>
+ <a href="http://www.eurogentest.org" target="_blank">
+ <img src="{{ url_for('static', filename='images/Eurogentest.png') }}"
+ width="110"
+ height="50"
+ align="middle"
+ border="0"
+ alt="Eurogentest"
+ title="Eurogentest"></a>
+ </td>
+ <td>
+ <a href="http://www.eurogentest.org">EuroGentest</a>
+ </td>
+ </tr>
+ <tr>
+ <td>
+ <a href="http://www.commit-nl.nl" target="_blank">
+ <img src="{{ url_for('static', filename='images/commit_logo.png') }}"
+ width="122"
+ height="50"
+ align="middle"
+ border="0"
+ alt="Dutch national program COMMIT"
+ title="Dutch national program COMMIT"></a>
+ </td>
+ <td>
+ <a href="http://www.commit-nl.nl">Dutch national program COMMIT</a>
+ </td>
+ </tr>
+ <tr>
+ <td>
+ <a href="http://wearelandscape.nl" target="_blank">
+ <img src="{{ url_for('static', filename='images/landscape_logo.png') }}"
+ height="50"
+ align="middle"
+ border="0"
+ alt="Landscape - Increasing Data Impact"
+ title="Landscape - Increasing Data Impact"></a>
+ </td>
+ <td>
+ <a href="http://wearelandscape.nl">Landscape - Increasing Data Impact</a>
+ </td>
+ </tr>
+</table>
+
<p>
Some icons are copyright ©
<a href="http://p.yusukekamiyamane.com/">Yusuke Kamiyamane</a>.
diff --git a/mutalyzer/website/templates/base.html b/mutalyzer/website/templates/base.html
index 001e809be7d5b6a5db317e4662c580c32d9f0602..6037fb8aaf19ed06d5ef830dfb6885892c22ab87 100644
--- a/mutalyzer/website/templates/base.html
+++ b/mutalyzer/website/templates/base.html
@@ -1,382 +1,212 @@
-<html>
+<!DOCTYPE html>
+<html lang="en">
<head>
- <link rel="shortcut icon"
- href="{{ url_for('static', filename='images/favicon.ico') }}"
- type="image/x-icon">
- <link rel="stylesheet"
- type="text/css"
- href="{{ url_for('static', filename='css/style.css') }}">
- <script
- type="text/javascript"
- language="javascript"
- src="{{ url_for('static', filename='js/jquery-1.10.2.min.js') }}">
- </script>
- <script
- type="text/javascript"
- language="javascript"
- src="{{ url_for('static', filename='js/interface.js') }}">
- </script>
- <script
- type="text/javascript"
- language="javascript"
- src="{{ url_for('static', filename='js/generator.js') }}">
- </script>
- <meta http-equiv="Content-Type"
- content="text/html; charset=utf-8">
+ <meta charset="utf-8">
+ <meta http-equiv="X-UA-Compatible" content="IE=edge">
+ <meta name="viewport" content="width=device-width, initial-scale=1">
+
+ <script src="{{ url_for('static', filename='js/jquery.min.js') }}"></script>
+ <script src="{{ url_for('static', filename='js/bootstrap.min.js') }}"></script>
+ <script src="{{ url_for('static', filename='js/interface.js') }}"></script>
+ <script src="{{ url_for('static', filename='js/generator.js') }}"></script>
+
+ <link href="http://fonts.googleapis.com/css?family=Roboto:400,300,300italic,400italic,500,500italic,700,700italic"
+ rel="stylesheet" type="text/css">
+
+ <link rel="stylesheet" type="text/css" href="{{ url_for('static', filename='css/bootstrap.min.css') }}" >
+ <link rel="stylesheet" type="text/css" href="{{ url_for('static', filename='css/style.css') }}">
+
+ <!--[if lt IE 9]>
+ <script src="{{ url_for('static', filename='js/html5shiv.min.js') }}"></script>
+ <script src="{{ url_for('static', filename='js/respond.min.js') }}"></script>
+ <![endif]-->
+
+ <link rel="shortcut icon" href="{{ url_for('static', filename='images/favicon.ico') }}" type="image/x-icon">
+
<title>Mutalyzer {{ mutalyzer_version }} — {{ page_title }}</title>
</head>
- <body
- style="background-image: url('{{ url_for('static', filename='images/background.gif') }}');
- background-repeat: repeat-y;"
- leftmargin="0"
- topmargin="0"
- marginwidth="0"
- marginheight="0">
- <!-- Header -->
- <a id = "top" name = "top"></a>
-
- <table width="98%"
- border="0"
- cellspacing="0"
- cellpadding="0">
- <tr>
- <!-- Corner logo -->
- <td rowspan="2"
- valign="bottom"
- width="180">
- <a href="{{ url_for('website.homepage') }}"
- target="_top"><img
- src="{{ url_for('static', filename='images/mutalyzer_logo_bw.png') }}" width="180" height="112"
- alt="Rauzy fractal" border="0" hspace="0" vspace="0"></a></td>
- <td valign="top"
- bgcolor="#FFFFFF"
- width="20"><img
- src="{{ url_for('static', filename='images/1x1b.gif') }}" height="1" width="20" border="0">
- </td>
- <td align="left"
- valign="bottom"
- bgcolor="White"
- width="98%">
- <!-- Banner -->
- <center>
- <a href="{{ url_for('website.homepage') }}"><img
- src="{{ url_for('static', filename='images/mutalyzer_logo.png') }}"
- width="90%"
- height="90"
- alt="Rauzy color fractal"
- border="0"></a>
- </center>
- </td>
- </tr>
-
- <tr>
- <td>
- </td>
- <td>
- <table width = "100%" style = "padding:0; border:0; margin:0">
- <tr>
- <td align="left">
- <a href="javascript:history.back(-1);"
- class="hornav">previous page</a>
- </td>
- <td align="right">
- <a href="{{ url_for('website.homepage') }}"
- class="hornav">home</a>
- <a href="{{ url_for('website.about') }}"
- class="hornav">about</a>
- <a href="mailto:{{ contact_email }}"
- class="hornav">contact</a>
- <a href="#bottom" class="hornav">go to bottom</a>
- </td>
- </tr>
- </table>
- </td>
- </tr>
-
- <tr>
- <td colspan="3"
- bgcolor="#000000"><img
- src="{{ url_for('static', filename='images/1x1b.gif') }}"
- height="1"
- border="0"></td>
- </tr>
- </table>
-
- <table width="98%"
- border="0"
- cellspacing="0"
- cellpadding="0">
- <tr>
- <td width="180" valign="top">
-
- <table id="menu" width="180" border="0" cellspacing="0" cellpadding="0">
- <tr>
- <td valign="top" width="20">
- <img src="{{ url_for('static', filename='images/1x1b.gif') }}" height="19" border="0">
- </td>
- </tr>
-
-{# Fields are: view, view_args, id, caption, subnav #}
-{% set navigation_menu = [
- ('website.homepage', {}, 'homepage', 'Home', False),
- ('website.name_checker', {}, 'name-checker', 'Name Checker', False),
- ('website.syntax_checker', {}, 'syntax-checker', 'Syntax Checker', False),
- ('website.position_converter', {}, 'position-converter', 'Position Converter', False),
- ('website.snp_converter', {}, 'snp-converter', 'SNP Converter', False),
- ('website.name_generator', {}, 'name-generator', 'Name Generator', False),
- ('website.description_extractor', {}, 'description-extractor', 'Description Extractor', False),
- ('website.reference_loader', {}, 'reference-loader', 'Reference File Loader', False),
- ('website.batch_jobs', {}, 'batch-jobs', 'Batch Jobs', False),
- ('website.batch_jobs', {'job_type': 'name-checker'}, 'batch-name-checker', 'Name Checker', True),
- ('website.batch_jobs', {'job_type': 'syntax-checker'}, 'batch-syntax-checker', 'Syntax Checker', True),
- ('website.batch_jobs', {'job_type': 'position-converter'}, 'batch-position-converter', 'Position Converter', True),
- ('website.batch_jobs', {'job_type': 'snp-converter'}, 'batch-snp-converter', 'SNP Converter', True),
- ('website.webservices', {}, 'webservices', 'Web Services', False)
-] -%}
-{% set active_page = active_page|default('home') -%}
-
-{% for view, view_args, id, caption, subnav in navigation_menu %}
- <tr class="menu{% if id == active_page %} active{% endif %}">
- {% if subnav %}
- <td></td>
- <td valign="baseline" width="10" class="bullet sub"></td>
- <td colspan="2">
- <a href="{{ url_for(view, **view_args) }}">{{ caption }}</a>
- </td>
- {% else %}
- <td valign="top" width="20" class="bullet"></td>
- <td colspan="3">
- <a href="{{ url_for(view, **view_args) }}">{{ caption }}</a>
- </td>
- {% endif %}
- </tr>
-{% endfor %}
-
- <tr><td> </td></tr>
-
- <tr class="menu">
- <td valign="top" width="20" class="bullet"></td>
- <td colspan="3">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/MutalyzerDocumentation">Documentation</a>
- </td>
- </tr>
-
- <tr class="menu">
- <td valign="top" width="20" class="bullet"></td>
- <td colspan="3">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/MutalyzerFaq">FAQ</a>
- </td>
- </tr>
-
- <tr class="menu">
- <td valign="top" width="20" class="bullet"></td>
- <td colspan="3">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/MutalyzerExercise">Exercise</a>
- </td>
- </tr>
-
- <tr class="menu">
- <td valign="top" width="20" class="bullet"></td>
- <td colspan="3">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/MutalyzerDisclaimer">Disclaimer</a>
- </td>
- </tr>
-
- <tr class="menu">
- <td valign="top" width="20" class="bullet"></td>
- <td colspan="3">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer">Feedback</a>
- </td>
- </tr>
-
- <tr class="menu">
- <td valign="top" width="20" class="bullet"></td>
- <td colspan="3">
- <a href="https://git.lumc.nl/mutalyzer/mutalyzer">Source code</a>
- </td>
- </tr>
-
- <tr><td> </td></tr>
-
- <tr class="menu inactive">
- <td valign="top" width="20" class="bullet"></td>
- <td colspan="3">
- External Links
- </td>
- </tr>
-
- <tr class="menu">
- <td></td>
- <td valign="baseline" width="10" class="bullet sub"></td>
- <td colspan="2">
- <a href="http://www.genenames.org/guidelines.html"
- >Human Gene Nomenclature</a>
- </td>
- </tr>
-
- <tr class="menu">
- <td></td>
- <td valign="baseline" width="10" class="bullet sub"></td>
- <td colspan="2">
- <a href="http://www.hgvs.org/mutnomen/"
- >HGVS Variation Nomenclature</a>
- </td>
- </tr>
-
- <tr class="menu">
- <td></td>
- <td valign="baseline" width="10" class="bullet sub"></td>
- <td colspan="2">
- <a href="http://dx.doi.org/10.1002/humu.21427"
- >HGVS Nomenclature Extension Proposal</a>
- </td>
- </tr>
-
- <tr class="menu">
- <td></td>
- <td valign="baseline" width="10" class="bullet sub"></td>
- <td colspan="2">
- <a href="http://www.lovd.nl/">LOVD</a>
- </td>
- </tr>
-
- <tr>
- <td width="20"><img
- src="{{ url_for('static', filename='images/1x1b.gif') }}"
- height="10"
- width="20"
- border="0">
- </td>
- <td width="12"><img
- src="{{ url_for('static', filename='images/1x1b.gif') }}"
- height="10"
- width="10"
- border="0">
- </td>
- <td valign="top" width="12"><img
- src="{{ url_for('static', filename='images/1x1b.gif') }}"
- height="10"
- width="10"
- border="0">
- </td>
- <td valign="top" width="136"><img
- src="{{ url_for('static', filename='images/1x1b.gif') }}"
- height="10"
- width="136"
- border="0">
- </td>
- </tr>
- </table>
-
- </td>
- <td width="20"><img
- src="{{ url_for('static', filename='images/1x1b.gif') }}"
- height="1"
- width="20"
- border="0">
- </td>
- <td width="98%" valign="top"><br>
-
- <!-- Content -->
-
- <table cellpadding="0" cellspacing="0" width="100%" border="0">
- <tbody><tr>
- <td width="0"></td>
- <td width="0">
-
- {% if announcement %}
- <p><b>Announcement:</b> {% if announcement.url %}<a href="{{ announcement.url }}">{% endif %}{{ announcement.body }}{% if announcement.url %}</a>{% endif %}</p>
- {% endif %}
-
- <center>
- <h2>Mutalyzer {{ mutalyzer_version }}<br>
- <small><small><small><small>
- {% if release %}
- released on {{ release_date }}
- {% else %}
- development version
- {% endif %}
- </small></small></small></small>
- </h2>
- HGVS nomenclature version
- <span>{{ nomenclature_version }}</span>
- </center>
- <p>
-
- <h3><center>{{ page_title }}</center></h3>
-
- {% block content %}{% endblock %}
-
- <!-- Navigation bar -->
- <table border="0"
- cellspacing="0"
- cellpadding="0"
- width="100%"
- align="center">
- <tr>
- <td colspan="2"><img
- src="{{ url_for('static', filename='images/1x1b.gif') }}"
- width="1"
- height="20"
- border="0">
- </td>
- </tr>
- <tr>
- <td bgcolor="#000000" colspan="3"><img
- src="{{ url_for('static', filename='images/1x1b.gif') }}"
- width="100%"
- height="1"
- border="0"></td>
- </tr>
- <tr>
- <td align="left">
- <a href="javascript:history.back(-1);"
- class="hornav">previous page</a>
- </td>
- <td align="middle">
- <img src = "{{ url_for('static', filename='images/LUMC_24x24.png') }}" align = "middle">
- © {{ copyright_years[0] }}-{{ copyright_years[1] }}
- <a href = "http://www.lumc.nl">LUMC</a>
-
-
- </td>
- <td align="right">
- <a href="#top" class="hornav">go to top</a>
- </td>
- </tr>
- <tr>
- <!--
- <td colspan="2"
- align="center">Last edited by: with /usr/bin/vim
- </td>
- -->
- </tr>
- <tr>
- <td colspan="2"><img
- src="{{ url_for('static', filename='images/1x1b.gif') }}"
- width="1"
- height="10"
- border="0">
- </td>
- </tr>
- </table>
- </td>
- </tr>
- </table>
- <a id = "bottom" name = "bottom"></a>
+
+<body>
+{# Fields are: view, view_args, id, caption, beginsubnav, endsubnav #}
+ {% set navigation_menu = [
+
+ ('website.name_checker', {}, 'dna-tools', 'DNA tools', True, False),
+
+ ('website.name_checker', {}, 'name-checker', 'Name Checker', False, False),
+ ('website.syntax_checker', {}, 'syntax-checker', 'Syntax Checker', False, False),
+ ('website.position_converter', {}, 'position-converter', 'Position Converter', False, False),
+ ('website.snp_converter', {}, 'snp-converter', 'SNP Converter', False, False),
+ ('website.name_generator', {}, 'name-generator', 'Name Generator', False, False),
+ ('website.description_extractor', {}, 'description-extractor', 'Description Extractor', False, False),
+ ('website.reference_loader', {}, 'reference-loader', 'Reference File Loader', False, True),
+
+ ('website.batch_jobs', {}, 'batch-jobs', 'Batch Jobs', True, False),
+ ('website.batch_jobs', {'job_type': 'name-checker'}, 'batch-name-checker', 'Name Checker', False, False),
+ ('website.batch_jobs', {'job_type': 'syntax-checker'}, 'batch-syntax-checker', 'Syntax Checker', False, False),
+ ('website.batch_jobs', {'job_type': 'position-converter'}, 'batch-position-converter', 'Position Converter', False, False),
+ ('website.batch_jobs', {'job_type': 'snp-converter'}, 'batch-snp-converter', 'SNP Converter', False, True),
+
+ ('website.webservices', {}, 'webservices', 'Web Services', False, False),
+
+ ] -%}
+ {% set active_page = active_page|default('home') -%}
+
+
+
+ <nav class="navbar navbar-default navbar-fixed-top" role="navigation">
+ <div class="background"></div>
+ <div class="container-fluid">
+
+ <!-- Brand and toggle get grouped for better mobile display -->
+ <div class="navbar-header">
+ <button type="button" class="navbar-toggle" data-toggle="collapse" data-target="#mutalyzer-navbar-collapse-1">
+ <span class="sr-only">Toggle navigation</span>
+ <span class="icon-bar"></span>
+ <span class="icon-bar"></span>
+ <span class="icon-bar"></span>
+ </button>
+ <a class="navbar-brand" href="/">LUMC Mutalyzer</a>
+ </div>
+
+ <!-- Collect the nav links, forms, and other content for toggling -->
+ <div class="collapse navbar-collapse" id="mutalyzer-navbar-collapse-1">
+ <ul class="nav navbar-nav">
+
+ {% for view, view_args, id, caption, beginsubnav, endsubnav in navigation_menu %}
+ {% if beginsubnav %}
+ <li class="dropdown">
+ <a href="{{ url_for(view, **view_args) }}" class="dropdown-toggle{% if id == active_page %} active{% endif %}" data-toggle="dropdown">{{ caption }} <span class="caret"></span></a>
+ <ul class="dropdown-menu">
+ {% elif endsubnav %}
+ <li {% if id == active_page %} class="active"{% endif %}>
+ <a href="{{ url_for(view, **view_args) }}">{{ caption }}</a></ul></li>
+ {% else %}
+ <li {% if id == active_page %} class="active"{% endif %}>
+ <a href="{{ url_for(view, **view_args) }}">{{ caption }}</a>
+ </li>
+ {% endif %}
+
+ {% endfor %}
+
+ <li class="dropdown {% if id == active_page %} active{% endif %}">
+ <a href="#" class="dropdown-toggle" data-toggle="dropdown">External links <span class="caret"></span></a>
+ <ul class="dropdown-menu">
+ <li class="menu{% if id == active_page %} active{% endif %}"><a href="http://www.genenames.org/guidelines.html"
+ target="new">Human Gene Nomenclature</a></li>
+ <li class="menu{% if id == active_page %} active{% endif %}"><a href="http://www.hgvs.org/mutnomen/"
+ target="new">HGVS Variation Nomenclature</a></li>
+ <li class="menu{% if id == active_page %} active{% endif %}"><a href="http://dx.doi.org/10.1002/humu.21427"
+ target="new">HGVS Nomenclature Extension Proposal</a></li>
+ <li class="menu{% if id == active_page %} active{% endif %}"><a href="http://www.lovd.nl/"target="new">LOVD</a></li>
+ </ul>
+ </li>
+
+ <li class="{% if active_page == 'about' %} active{% endif %}">
+ <a href="/about" >About</a>
+ </li>
+ <li class="dropdown {% if id == active_page %} active{% endif %}">
+ <a href="#" class="dropdown-toggle" data-toggle="dropdown">Help <span class="caret"></span></a>
+ <ul class="dropdown-menu">
+
+ <li>
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/MutalyzerDocumentation" target="new">Documentation</a>
+ </li>
+ <li>
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/MutalyzerFaq" target="new">FAQ</a>
+ </li>
+ <li>
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/MutalyzerExercise" target="new">Exercise</a>
+ </li>
+ <li>
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer" target="new">Feedback</a>
+ </li>
+ <li>
+ <a href="https://git.lumc.nl/mutalyzer/mutalyzer" target="new">Source code</a>
+ </li>
+ </ul>
+ </li>
+
+ <li>
+ <a href="mailto:mutalyzer@humgen.nl" target="new">Contact</a>
+ </li>
+
+ </ul>
+ </div><!-- /.navbar-collapse -->
+ </div><!-- /.container-fluid -->
+ </nav>
+
+
+
+
+
+
+<div class="container-fluid" >
+
+ <div class="row">
+ <div class="col-md-12">
+ {% if announcement%}
+ <div id="announcement" class="alert alert-info">
+ <p><strong>Announcement:</strong> {% if announcement.url %}<a href="{{ announcement.url }}">{% endif %}{{ announcement.body }}{% if announcement.url %}</a>{% endif %}</p>
+ </div>
+ {% endif %}
+
+ <!-- Main content -->
+ <div class="block block-shadow">
+ {% if page_title %}<h1>{{ page_title }}</h1>{% endif %}
+ {% block content %}{% endblock %}
+ </div>
+ </div>
+ </div>
+
+
+
+ <footer class="row">
+ <div class="col-md-4">
+ <strong>Mutalyzer {{ mutalyzer_version }}</strong>
+ <br>
+ <span class="text-muted">
+ {% if release %}
+ released on {{ release_date }}
+ {% else %}
+ development version
+ {% endif %}
+
+ <br>
+ HGVS nomenclature version {{ nomenclature_version }}
+ </span>
+ </div>
+ <div class="col-md-4">
+ <p>Interface by <a target="_blank" href="http://www.wearelandscape.nl/"><strong>Landscape</strong></a><br/><span class="text-muted"><i>Increasing data impact</i></span></p>
+ </div>
+ <div class="col-md-4">
+ <img src="{{ url_for('static', filename='images/LUMC_24x24.png') }}" align="middle">
+ © 2009-2014
+ <a href="http://www.lumc.nl" target="new">LUMC</a>
+
+
+ </div>
+ </footer>
+
+</div>
{% if piwik %}
<!-- Piwik -->
<script type="text/javascript">
-var pkBaseURL = "{{ piwik_base_url }}/";
-document.write(unescape("%3Cscript src='" + pkBaseURL + "piwik.js' type='text/javascript'%3E%3C/script%3E"));
-</script><script type="text/javascript">
-try {
-var piwikTracker = Piwik.getTracker(pkBaseURL + "piwik.php", {{ piwik_site_id }});
-piwikTracker.trackPageView();
-piwikTracker.enableLinkTracking();
-} catch( err ) {}
-</script><noscript><p><img src="{{ piwik_base_url }}/piwik.php?idsite={{ piwik_site_id }}" style="border:0" alt="" /></p></noscript>
-<!-- End Piwik Tracking Code -->
+ var _paq = _paq || [];
+ _paq.push(['trackPageView']);
+ _paq.push(['enableLinkTracking']);
+ (function() {
+ var u="{{ piwik_base_url }}/";
+ _paq.push(['setTrackerUrl', u+'piwik.php']);
+ _paq.push(['setSiteId', {{ piwik_site_id }}]);
+ var d=document, g=d.createElement('script'),
+ s=d.getElementsByTagName('script')[0];
+ g.type='text/javascript'; g.async=true; g.defer=true; g.src=u+'piwik.js';
+ s.parentNode.insertBefore(g,s);
+ })();
+</script>
+<noscript><p><img src="{{ piwik_base_url }}/piwik.php?idsite={{ piwik_site_id }}"
+ style="border:0;" alt="" /></p></noscript>
+<!-- End Piwik Code -->
{% endif %}
- </body>
+</body>
</html>
diff --git a/mutalyzer/website/templates/batch-jobs.html b/mutalyzer/website/templates/batch-jobs.html
index 2029a82880ac7d32bf298b90a6a6f90aeda6a1b0..36876544b07a1147fcde977260d0642562dc2df3 100644
--- a/mutalyzer/website/templates/batch-jobs.html
+++ b/mutalyzer/website/templates/batch-jobs.html
@@ -10,98 +10,101 @@
{% block content %}
-<p>
-<a href="#" onclick="toggle_visibility('help');">Toggle File Format Help</a>
-</p>
+ <form action="{{ url_for('.batch_jobs_submit') }}" method="post" enctype="multipart/form-data">
+ <!-- BatchType -->
+ <div class="form-group">
+ <label>Batch job type</label>
+ <div class="radio">
+ <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="name-checker"{% if job_type == "name-checker" %} checked{% endif %} />Name Checker</label>
+ </div>
+ <div class="radio">
+ <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="syntax-checker"{% if job_type == "syntax-checker" %} checked{% endif %} />Syntax Checker</label>
+ </div>
+ <div class="radio">
+ <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="position-converter"{% if job_type == "position-converter" %} checked{% endif %} />Position Converter</label>
+ </div>
+ <div class="radio">
+ <label><input onchange="return changeBatch(this);" type="radio" name="job_type" value="snp-converter"{% if job_type == "snp-converter" %} checked{% endif %} />SNP Converter</label>
+ </div>
+
+ <div id="assembly_name_or_alias" style="display:none" class="form-group">
+ <label>Assembly</label>
+ <select name="assembly_name_or_alias" class="form-control">
+ {% for assembly in assemblies %}
+ <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{ assembly.alias }}){% endif %}</option>
+ {% endfor %}
+ </select>
+ </div>
+
+ <div class="form-group">
+ <label for="email">Email address</label>
+ <input name="email" type="email" class="form-control" placeholder="Email address" required value="{{ email }}">
+ </div>
+
+ <div class="form-group">
+ <label for="file">File</label>
+ <input type="file" name="file">
+ </div>
+ </div>
+
+ <div class="form-group">
+ <input type="submit" class="btn btn-primary" value="Submit">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/BatchCheckers" target="new" class="btn btn-default pull-right">Help</a>
+ <a href="#" onclick="toggle_visibility('help');" class="btn btn-default pull-right">File format help <span class="caret"></span></a>
+
+ </div>
+ </form>
<div id='help' style="display:none">
- <p>The mutalyzer batch checker accepts the following file formats:
+ <h3>Help</h3>
+ <p>The mutalyzer batch checker accepts the following file formats:</p>
<ul>
<li>Tab delimited text file / CSV file</li>
<li>Microsoft Excel file</li>
<li>OpenOffice ODS file</li>
</ul>
+ <p>
The maximum file size is {{ max_file_size }} megabytes, and the maximum
length per entry (variant description) is 200 characters.
</p>
- <h5>We accept two types of input files, you can download examples below</h5>
- <h5>New Style <a href="{{ url_for('.downloads', filename='batchtestnew.txt') }}">Download Example File</a></h5>
- <div style="padding-left:20px; width:400px">
- <p>This file format has no header-row. Each row consists of one or
- more tab delimited fields, where every field contains a single
- variant description (or dbSNP rs number in case of the SNP Converter).
- Note that all rows must have the same number of fields.</p>
- <table>
- <tr><td>AB026906.1:c.274G>T</td></tr>
- <tr><td>AL449423.14(CDKN2A_v002):c.5_400del</td></tr>
- </table>
- </div>
- <h5>Old Style:
- <a href="{{ url_for('.downloads', filename='batchtestold.txt') }}">Download Example File</a></h5>
- <div style="padding-left:20px; width:400px">
+ We accept two types of input files, you can download examples below.
+
+ <h4>New Style</h4>
+ <p>This file format has no header-row. Each row consists of one or more tab delimited fields, where every field contains a single variant description (or dbSNP rs number in case of the SNP Converter). Note that all rows must have the same number of fields.</p>
+ <table class="table">
+ <tr><td>AB026906.1:c.274G>T</td></tr>
+ <tr><td>AL449423.14(CDKN2A_v002):c.5_400del</td></tr>
+ </table>
+ <a href="{{ url_for('.downloads', filename='batchtestnew.txt') }}">Download new style example file</a>
+
+
+ <h4>Old Style</h4>
<p >This file format has a header-row, which consists of
three tab delimited fields. In each following row the
corressponding data is also tab delimited.</p>
- <table>
- <tr>
- <td>AccNo</td><td>Genesymbol</td><td>Mutation</td>
- </tr>
+ <table class="table">
+ <thead>
+ <th>AccNo</th>
+ <th>Genesymbol</th>
+ <th>Mutation</th>
+ </thead>
<tr>
<td>AB026906.1</td><td>SDHD</td><td>g.7872G>T</td>
</tr>
</table>
- </div>
- <h5>Output Format</h5>
- <div style="padding-left:20px; width:400px">
- <p>The output of a Mutalyzer Batch run is a tab delimited CSV file,
+
+ <a href="{{ url_for('.downloads', filename='batchtestold.txt') }}">Download old style example file</a>
+
+
+ <h4>Output Format</h4>
+ <p>
+ The output of a Mutalyzer Batch run is a tab delimited CSV file,
which has a header-row to clarify the results. We recommend opening
the file in a spreadsheet program, such as OpenOffice Calc or
Microsoft Excel.<BR />
- Note that empty lines are removed from the batch input file.</p>
- </div>
+ Note that empty lines are removed from the batch input file.
+ </p>
</div>
-
-<table id="inputform">
- <form action="{{ url_for('.batch_jobs_submit') }}" method="post" enctype="multipart/form-data">
- <tr id="batchRow">
- <td><b>BatchType</b></td>
- <td>
- <select id="job_type" name="job_type" onchange="return changeBatch(this)">
- <option value="name-checker"{% if job_type == "name-checker" %} selected="selected"{% endif %}>Name Checker</option>
- <option value="syntax-checker"{% if job_type == "syntax-checker" %} selected="selected"{% endif %}>Syntax Checker</option>
- <option value="position-converter"{% if job_type == "position-converter" %} selected="selected"{% endif %}>Position Converter</option>
- <option value="snp-converter"{% if job_type == "snp-converter" %} selected="selected"{% endif %}>SNP Converter</option>
- </select>
- </td>
- </tr>
- <tr>
- <tr id="assembly_name_or_alias" style="display:none">
- <td><b>Assembly</b></td>
- <td>
- <select name="assembly_name_or_alias">
- {% for assembly in assemblies %}
-<option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{ assembly.alias }}){% endif %}</option>
- {% endfor %}
- </select>
- </td>
- </tr>
- <tr>
- <td><b>Email</b></td>
- <td><input type="text" name="email" value="{{ email }}" style="width:200px"></td>
- </tr>
- <tr>
- <td><b>File</b></td>
- <td><input type="file" name="file" style="width:200px"></td>
- </tr>
- <tr>
- <td colspan="2">
- <input type="submit" value="Submit">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/BatchCheckers">Help</a>
- </td>
- </tr>
- </form>
-</table>
-
<script language="javascript">
oldload = window.onload
initpage = function() {
@@ -113,15 +116,16 @@ window.onload = initpage;
</script>
{% if errors %}
- <p>
- <b>Errors:</b>
- </p>
- <div class="messages">
+ <div class="alert alert-danger">
+ <h4>Batch not started</h4>
+ <p>The batch process was not started due to the following errors:</p>
+ <ul>
{% for m in errors %}
- <p class="{{ m.class }}" title="{{ m.level }} (origin: {{ m.origin
- }})">{{ m.description }}</p>
+ <li class="{{ m.class }}" title="{{ m.level }} (origin: {{ m.origin
+ }})">{{ m.description }}</li>
{% endfor %}
- </div>
+ </ul>
+ </div>
{% endif %}
{% if messages %}
diff --git a/mutalyzer/website/templates/description-extractor.html b/mutalyzer/website/templates/description-extractor.html
index 2a20e528e80de4d6a69af7f41871666e37c4772a..4f41354cba2be09c532e2a9226102a75a12a2c54 100644
--- a/mutalyzer/website/templates/description-extractor.html
+++ b/mutalyzer/website/templates/description-extractor.html
@@ -10,85 +10,88 @@
</p>
<p>
-Extract the HGVS variant description from a reference sequence and an
-observed sequence. For now, we require the user to fill in two
-sequences. After the testing phase, we plan to use the underlying
-algorithm for:
+Extract the HGVS variant description from a reference sequence and an observed sequence. For now, we require the user to fill in two sequences. After the testing phase, we plan to use the underlying algorithm for:
</p>
<ul>
<li>
- Disambiguation in the name checker. This will enable full support
- for complex variants.
+ Disambiguation in the name checker. This will enable full support for complex variants.
</li>
<li>
- Comparison of two reference sequences. Useful for migrating a
- variant description to an other reference sequence.
+ Comparison of two reference sequences. Useful for migrating a variant description to an other reference sequence.
</li>
<li>
Implementation of a Reference Sequence Editor.
</li>
</ul>
-<div style="border: 1px solid grey; background-color: aliceblue; padding: 20px;">
- <form action="{{ url_for('.description_extractor') }}" method="get">
- Please supply a reference sequence and an observed sequence.<br>
- <br>
- <div style="border: 1px solid grey; padding: 20px">
- <b>Reference sequence:</b><br>
- <br>
- Example: <tt>ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA</tt><br>
- <br>
- <input type="text" name="reference_sequence" value="{{ reference_sequence }}" style="width:100%"><br>
- <input type="button" value="Clear field" onclick="clearField(this.form, 'reference_sequence');">
- </div>
- <br>
- <div style="border: 1px solid grey; padding: 20px">
- <b>Observed sequence:</b><br>
- <br>
- Example: <tt>ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</tt><br>
- <br>
- <input type="text" name="variant_sequence" value="{{ variant_sequence }}" style="width:100%"><br>
- <input type="button" value="Clear field" onclick="clearField(this.form, 'variant_sequence');">
- </div>
- <br>
- <input type="submit" value="Submit">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/DescriptionExtractor">Help</a>
- </form>
-</div>
+<p>
+ Please supply a reference sequence and an observed sequence.
+</p>
+
+ <form action="{{ url_for('.description_extractor') }}" method="get" class="form">
+ <div class="form-group">
+ <h3>Reference sequence</h3>
+ <p>Example: <code class="example-input">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
+ <input type="text" name="reference_sequence" value="{{ reference_sequence }}" class="form-control form-pre example-target" placeholder="Reference sequence">
+ <!-- <input type="button" value="Clear field" onclick="clearField(this.form, 'reference_sequence');" class="btn"> -->
+ </div>
+ <div class="form-group">
+ <h3>Observed sequence</h3>
+
+ <p>Example: <code class="example-input-2">ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</code></p>
+ <input type="text" name="variant_sequence" value="{{ variant_sequence }}" class="form-control form-pre example-target-2" placeholder="Observed sequence">
+ <!-- <input type="button" value="Clear field" onclick="clearField(this.form, 'variant_sequence');" class="btn"> -->
+ </div>
+
+ <div class="form-group">
+ <input type="submit" class="btn btn-primary" value="Submit">
+ <input type="reset" class="btn btn-default pull-right" value="Undo">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/DescriptionExtractor" target="new" class="btn btn-default pull-right">Help</a>
+ </div>
+ </form>
{% if description %}
<h3>Variant Description Extractor results:</h3>
- <div class="messages">
- {% for m in messages %}
- <p class="{{ m.class }}" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
- {% endfor %}
- <p>{{ summary }}</p>
- </div>
+<table class="table">
+ {% for m in messages %}
+ {% if m.class == "error" %}
+ <tr><td class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</td></tr>
+ {% elif m.class == "warning" %}
+ <tr><td class="warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</td></tr>
+ {% endif %}
+ {% endfor %}
+
+ {% if summary == "0 Errors, 0 Warnings."%}
+ <tr><td class="success summary">{{ summary }}</td>
+ {% endif %}
+</table>
+
{% if not errors %}
<p>
<b>Genomic description:</b>
</p>
<p>
- <tt>g.{{ description }}</tt>
+ <pre>g.{{ description }}</pre>
</p>
<p>
<b>Overview of the raw variants:</b>
</p>
- <table class="laTable">
- <tr>
- <td>Start</td>
- <td>End</td>
- <td>Type</td>
- <td>Deleted</td>
- <td>Inserted</td>
- <td>Shift</td>
- <td>Description</td>
- </tr>
+ <table class="table">
+ <thead><tr>
+ <th>Start</th>
+ <th>End</th>
+ <th>Type</th>
+ <th>Deleted</th>
+ <th>Inserted</th>
+ <th>Shift</th>
+ <th>Description</th>
+ </tr></thead>
{% for raw_var in raw_vars %}
- <tr>
+ <tbody>
+ <tr>
<td>{{ raw_var.start }}</td>
<td>{{ raw_var.end }}</td>
<td>{{ raw_var.type }}</td>
@@ -97,6 +100,7 @@ algorithm for:
<td>{{ raw_var.shift }}</td>
<td>{{ raw_var.hgvs }}</td>
</tr>
+ </tbody>
{% endfor %}
</table>
{% endif %}
diff --git a/mutalyzer/website/templates/homepage.html b/mutalyzer/website/templates/homepage.html
index 8b2fd03dce9c36f99258c909fd54612cbc1f5ca7..cf3caf33fde3aefce638837bed6e1c50935c3ef2 100644
--- a/mutalyzer/website/templates/homepage.html
+++ b/mutalyzer/website/templates/homepage.html
@@ -16,61 +16,130 @@ nomenclature according to the
Different interfaces are provided to collect the information necessary
for the checks:
</p>
+
+<div class="row">
+ <div class="col-md-12">
+ <div class="thumbnail thumb-home thumb-large">
+ <div class="caption">
+ <h3>Name Checker</h3>
+ <p>The Name Checker takes the complete sequence variant description as input and checks whether it is correct.</p>
+ <p>Example: <code class="example-input">AB026906.1:c.274G>T</code></p>
+
+ <!-- <a href="{{ url_for('.name_checker') }}" class="btn btn-default btn-small btn-primary">Try
+ this</a> -->
+
+ <form class="form" action="{{ url_for('.name_checker') }}" method="get">
+ <div class="input-group">
+ <input class="form-control form-control-small form-pre example-target" type="text" name="description" value="{{ description }}" placeholder="Mutation name using HGVS format">
+ <span class="input-group-btn">
+ <input type="submit" class="btn btn-primary pull-right" value="Try the Name Checker">
+ </span>
+ </div>
+ </form>
+
+ </div>
+ </div>
+ </div>
+</div>
+
+<div class="row">
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-1">
+ <div class="caption">
+ <h3>Syntax Checker</h3>
+ <p>The Syntax Checker takes the complete sequence variant description as input and checks whether the syntax is correct.</p>
+ <a href="{{ url_for('.syntax_checker') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-2">
+ <div class="caption">
+ <h3>Position Converter</h3>
+ <p>The Position Converter can convert chromosomal positions to transcript orientated positions and vice versa.</p>
+ <a href="{{ url_for('.position_converter') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-3">
+ <div class="caption">
+ <h3>SNP Converter</h3>
+ <p>The SNP Converter allows you to convert a dbSNP rsId to HGVS notation.</p>
+ <a href="{{ url_for('.snp_converter') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-4">
+ <div class="caption">
+ <h3>Name Generator</h3>
+ <p>The Name Generator is a user friendly interface that helps to make a valid HGVS variant description.</p>
+ <a href="{{ url_for('.name_generator') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+</div>
+
+<div class="row">
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-5">
+ <div class="caption">
+ <h3>Description Extractor</h3>
+ <p>The Description Extractor allows you to generate the HGVS variant description from a reference sequence and an observed sequence.</p>
+ <a href="{{ url_for('.description_extractor') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-6">
+ <div class="caption">
+ <h3>Reference File Loader</h3>
+ <p>The Reference File Loader allows you to load and use your own reference sequence.</p>
+ <a href="{{ url_for('.reference_loader') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-7">
+ <div class="caption">
+ <h3>Batch Checkers</h3>
+ <p>The Batch Checkers are interfaces that accept a list of inputs. These interfaces can be used for large quantities of checks is correct.</p>
+ <a href="{{ url_for('.batch_jobs') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+ <div class="col-md-3">
+ <div class="thumbnail thumb-home clickbox color-8">
+ <div class="caption">
+ <h3>Web services</h3>
+ <p>The Web services page provides instructions for the web services.</p>
+ <a href="{{ url_for('.webservices') }}" class="btn btn-default btn-small btn-home-down">Try this</a>
+ </div>
+ </div>
+ </div>
+</div>
+
+
+<!--
<ul>
- <li>
- The <a href="{{ url_for('.name_checker') }}">Name Checker</a> takes the complete sequence
- variant description as input and checks whether it is correct.
- </li>
- <li>
- The <a href="{{ url_for('.syntax_checker') }}">Syntax Checker</a> takes the complete
- sequence variant description as input and checks whether the syntax
- is correct.
- </li>
- <li>
- The <a href="{{ url_for('.position_converter') }}">Position Converter</a> can convert
- chromosomal positions to transcript orientated positions and vice
- versa.
- </li>
- <li>
- The <a href="{{ url_for('.snp_converter') }}">SNP converter</a> allows you to convert a
- dbSNP rsId to HGVS notation.
- </li>
- <li>
- The <a href="{{ url_for('.name_generator') }}">Name Generator</a> is a user friendly
- interface that helps to make a valid HGVS variant description.
- </li>
- <li>
- The <a href="{{ url_for('.description_extractor') }}">Description Extractor</a> allows
- you to generate the HGVS variant description from a reference
- sequence and an observed sequence.
- </li>
- <li>
- The <a href="{{ url_for('.reference_loader') }}">Reference File Loader</a> allows you to load and
- use your own reference sequence.
- </li>
- <li>
- The <a href="{{ url_for('.batch_jobs') }}">Batch Checkers</a> are interfaces that accept a
- list of inputs. These interfaces can be used for large quantities of
- checks.
- </li>
- <li>
- The <a href="{{ url_for('.webservices') }}">Web services</a> page provides instructions
- for the web services.
- </li>
-</ul>
+
+
+</ul> -->
<p>
-GenBank sequences are retrieved from the
-<a href="http://www.ncbi.nlm.nih.gov/">NCBI</a>
-(<a href="http://eutils.ncbi.nlm.nih.gov/About/disclaimer.html"
->Copyright and Disclaimers</a>).
+GenBank sequences are retrieved from the <a href="http://www.ncbi.nlm.nih.gov/">NCBI</a> (<a href="http://eutils.ncbi.nlm.nih.gov/About/disclaimer.html" >Copyright and Disclaimers</a>).
</p>
<p>
-This project is sponsored by
-<a href = "http://www.sun.com">SUN Microsystems</a> with server
-hardware within the scope of the Academic Excellence Grant (AEG)
-program (award EDUD-7832-080223-CNE).
+This project is sponsored by <a href = "http://www.sun.com">SUN Microsystems</a> with server hardware within the scope of the Academic Excellence Grant (AEG) program (award EDUD-7832-080223-CNE).
</p>
+<script>
+ $(".clickbox").click(function(){
+ window.location=$(this).find("a").attr("href");
+ return false;
+ });
+</script>
+
{% endblock content %}
diff --git a/mutalyzer/website/templates/name-checker.html b/mutalyzer/website/templates/name-checker.html
index 903d33d8a753dab58aeaf402a845a86bdf34bfaf..fc697e432cbd13fb1764e799d0cafe1a882d9654 100644
--- a/mutalyzer/website/templates/name-checker.html
+++ b/mutalyzer/website/templates/name-checker.html
@@ -1,271 +1,335 @@
-{% if not standalone %}{% extends "base.html" %}{% endif -%}
-<html>
+{% if not standalone %}
+ {% extends "base.html" %}
+{% endif -%}
+
+<!DOCTYPE html>
+<html lang="en">
<head>
+ <meta charset="utf-8">
+ <meta http-equiv="X-UA-Compatible" content="IE=edge">
+ <meta name="viewport" content="width=device-width, initial-scale=1">
+
+ <link href="http://fonts.googleapis.com/css?family=Roboto:400,300,300italic,400italic,500,500italic,700,700italic"
+ rel="stylesheet" type="text/css">
+
+ <link rel="stylesheet" type="text/css" href="{{ url_for('static', filename='css/bootstrap.min.css') }}" >
<link rel="stylesheet" type="text/css" href="{{ url_for('static', filename='css/style.css') }}">
- <title></title>
+
+ <!--[if lt IE 9]>
+ <script src="{{ url_for('static', filename='js/html5shiv.min.js')
+ }}"></script>
+ <script src="{{ url_for('static', filename='js/respond.min.js')
+ }}"></script>
+ <![endif]-->
+
+ <link rel="shortcut icon" href="{{ url_for('static', filename='images/favicon.ico') }}" type="image/x-icon">
+
+ <title>Mutalyzer {{ mutalyzer_version }} — {{ page_title }}</title>
</head>
- <body>
- <div>
- <center>
- <h3>Name Checker</h3>
- </center>
-{% set active_page = "name-checker" %}
-{% set page_title = "Name Checker" %}
+<body>
+
+ <h1>Name Checker</h1>
+
+ {% set active_page = "name-checker" %}
+ {% set page_title = "Name Checker" %}
+
+ <div class="container-fluid" >
{% block content %}
-<div style="border: 1px solid grey; background-color: aliceblue; padding: 20px;">
- {% if not standalone %}
- <div id="output">
- <div>
- Please insert the mutation name using the
- <span class="helper"
- title="Human Genome Variation Society standard variant nomenclature">
- <a href="http://www.hgvs.org/mutnomen">HGVS</a> format</span>:<br>
- <accession number>.<version
- number>(<gene symbol>):<sequence
- type>.<variant description>
- </div><br>
- Example: AB026906.1:c.274G>T<br>
- <br>
- <form action="{{ url_for('.name_checker') }}" method="get">
- <input type="text" name="description" value="{{ description }}" style="width:100%"><br>
- <input type="submit" value="Submit">
- <input type="button" value="Clear field" onclick="clearField(this.form, 'description');">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/NameChecker">Help</a>
- </form>
- </div>
- {% endif %}
-
- {% if visualisation %}
- <p>
- <b>Overview of the raw variants:</b>
- </p>
- {% for i in visualisation %}
- <p>Raw variant {{ loop.index }}: {{ i[0] }}</p>
- <pre>{{ i[1] }}<br>{{ i[2] }}</pre>
- {% endfor %}
- {% endif %}
-
- {% if browserLink %}
- <p>
- <a href="{{ browserLink }}">View original variant in UCSC Genome Browser</a>
- </p>
- {% endif %}
-</div>
-
-{% if description %}
- <h3>Name checker results:</h3>
-
- <div class="messages">
- {% for m in messages %}
- <p class="{{ m.class }}" title="{{ m.level }} (origin: {{ m.origin
- }})">{{ m.description }}</p>
- {% endfor %}
- <p>{{ summary }}</p>
- </div>
-
- {% if parse_error %}
- <h4>Details of the parse error:</h4>
- <pre>{{ parse_error[0] }}<br>{{ parse_error[1] }}</pre>
- <p>
- The "^" indicates the position where the error occurred.
- </p>
- {% endif %}
-
- {% if genomicDescription %}
- {% if genomicDNA %}
- <p><b>Genomic description:</b></p>
- {% else %}
- <p><b>Description relative to transcription start:</b><br>
- (Not for use in LSDBs in case of protein-coding transcripts).</p>
- {% endif %}
- <p>
- <tt><a href="{{ url_for('.name_checker', description=genomicDescription) }}">{{ genomicDescription }}</a></tt>
- </p>
- {% endif %}
-
- {% if chromDescription %}
- <p>Alternative chromosomal position:</p>
- <p>
- <tt>{{ chromDescription }}</tt>
- </p>
- {% endif %}
-
- {% if descriptions %}
- <p><b>Affected transcripts:</b></p>
- <p>
- {% for i in descriptions %}
- {% if i.endswith('?') %}
- <tt>{{ i }}</tt>
- {% else %}
- <tt><a href="{{ url_for('.name_checker', description=i) }}">{{ i }}</a></tt>
- {% endif %}
- <br>
- {% endfor %}
- </p>
- {% endif %}
-
- {% if protDescriptions %}
- <p>
- <b>Affected proteins:</b>
- </p>
- <p>
- {% for i in protDescriptions %}
- <tt>{{ i }}</tt><br>
- {% endfor %}
- </p>
- {% endif %}
-
- {% if transcriptInfo %}
- <p><b>Detailed information about the selected transcript:</b></p>
- <div style = "background-color : aliceblue; padding : 20px; border: 1px solid grey">
-
- {% if oldProtein %}
- <p><b>Reference protein:</b></p>
- <pre>
- {%- for i in oldProtein -%}
- {{- i|safe -}}<br>
- {%- endfor -%}
- </pre>
-
- <p><b>Protein predicted from variant coding sequence:</b></p>
-
- {% if newProtein %}
- <pre>
- {%- for i in newProtein -%}
- {{- i|safe -}}<br>
- {%- endfor -%}
- </pre>
+ {% if parse_error %}
+ <div class="alert alert-danger">
+ <h4>Parse error</h4>
+ <p>The "^" indicates the position where the error occurred:</p>
+ <pre>{{ parse_error[0] }}<br>{{ parse_error[1] }}</pre>
+ </div><!-- alert alert-danger -->
+ {% endif %} <!-- if parse_error -->
+
+ {% if messages %}
+ {% for m in messages %}
+ {% if m.class == "error" %}
+ <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% elif m.class == "warning" %}
+ <p class="alert alert-warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% endif %}
+ {% endfor %}
+ {% endif %} <!-- messages -->
+
+ {% if summary == "0 Errors, 0 Warnings."%}
+ <p class="alert alert-success summary">{{ summary }}</p>
{% else %}
- <p>
- No change: Predicted protein (not shown) equals reference
- protein.
- </p>
+ <p>{{summary}}</p>
+ <hr />
{% endif %}
- {% if altStart %}
- <p><b>Alternative protein using start codon {{ altStart }}</b></p>
- {% if altProtein %}
- <pre>
- {%- for i in altProtein -%}
- {{- i|safe -}}<br>
- {%- endfor -%}
- </pre>
- {% else %}
- <p>No change: Predicted protein (not shown) equals reference protein.</p>
- {% endif %}
+ {% if not standalone %}
+ <p>
+ Please insert the mutation name using the <a href="http://www.hgvs.org/mutnomen" title="Human Genome Variation Society standard variant nomenclature" alt="Human Genome Variation Society standard variant nomenclature">HGVS</a> format: <br/>
+
+ <code><accession number>.<version number>(<gene symbol>):<sequence type>.<variant description></code>
+ </p>
+
+ <p>Example: <code class="example-input">AB026906.1:c.274G>T</code> </p>
+
+ <form class="form" action="{{ url_for('.name_checker') }}" method="get">
+ <div class="form-group">
+ <label for="description">HGVS Description</label>
+ <input class="form-control form-pre example-target" type="text" name="description" id="hgvs" value="{{ description }}" placeholder="Mutation name using HGVS format">
+ </div>
+
+ <div class="form-group button-group">
+ <input type="submit" class="btn btn-primary" value="Check name">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/NameChecker" target="new" class="btn btn-default pull-right">Help</a>
+ <input type="reset" class="btn btn-default pull-right" value="Undo">
+ </div>
+ </form>
{% endif %}
- {% endif %}
-
- <p><b>Exon information:</b></p>
- <table class = "raTable">
- <tr>
- <td>Number</td>
- <td>Start (g.)</td>
- <td>Stop (g.)</td>
- <td>Start {{ '(c.)' if transcriptCoding else '(n.)' }}</td>
- <td>Stop {{ '(c.)' if transcriptCoding else '(n.)' }}</td>
- </tr>
- {% for i in exonInfo %}
- <tr>
- <td>{{ loop.index }}</td>
- {% for j in i %}
- <td>{{ j }}</td>
- {% endfor %}
- </tr>
- {% endfor %}
- </table>
- {% if transcriptCoding %}
- <p><b><span class = "helper" title = "Coding Sequence">CDS</span>
- information:</b></p>
- <table class = "raTable">
- <tr>
- <td></td>
- <td>g.</td>
- <td>c.</td>
- </tr>
- <tr>
- <td>Start</td>
- <td>{{ cdsStart_g }}</td>
- <td>{{ cdsStart_c }}</td>
- </tr>
- <tr>
- <td>Stop</td>
- <td>{{ cdsStop_g }}</td>
- <td>{{ cdsStop_c }}</td>
- </tr>
- <tr>
- </tr>
- </table>
- {% endif %}
- </div>
- {% endif %}
-
- {% if restrictionSites %}
- <p><b>Effects on Restriction sites:</b></p>
- <table class = "laTable">
- <tr>
- <td>Raw variant</td>
- <td>Created</td>
- <td>Deleted</td>
- </tr>
- {% for i in restrictionSites %}
- <tr>
- <td>{{ loop.index }}</td>
- <td>
- {% for j in i[0] %}
- {{ j }}{{ ',' if not loop.last }}
- {% endfor %}
- </td>
- <td>
- {% for j in i[1] %}
- {{ j }}{{ ',' if not loop.last }}
- {% endfor %}
- </td>
- </tr>
- {% endfor %}
- </table>
- {% endif %}
-
- {% if legends %}
- <p><b>Legend:</b></p>
- <table class = "laTable">
- <tr>
- <td>Name</td>
- <td>ID</td>
- <td>Locus tag</td>
- <td>Product</td>
- <td>Link method</td>
- </tr>
- {% for i in legends %}
- <tr>
- {% for j in i %}
- <td>{{ j if j else '' }}</td>
- {% endfor %}
- </tr>
- {% endfor %}
- </table>
- {% endif %}
-
- {% if reference_filename and not standalone %}
- <p><b>Links:</b></p>
- <p>
- Download this reference sequence file:
- <a href="{{ url_for('.reference', filename=reference_filename) }}">{{ reference_filename }}</a>
- </p>
- {% endif %}
-
- {% if extractedDescription %}
- <p><b>Experimental services:</b></p>
- <p>Genomic description: <tt>{{ extractedDescription }}</tt></p>
- <p>Protein description: <tt>{{ extractedProtein }}</tt></p>
- {% endif %}
-{% endif %}
+ <hr />
+ <div class="row">
+ <div class="col-md-8 name-checker-left-column">
+ {% if visualisation %}
+ <h3>Overview of the raw variants</h3>
+ {% for i in visualisation %}
+ <p>Raw variant {{ loop.index }}: {{ i[0] }}</p>
+ <pre>{{ i[1] }}<br>{{ i[2] }}</pre>
+ {% endfor %}
+ {% endif %} <!-- if visualisation -->
+
+ {% if browserLink %}
+ <p>
+ <a href="{{ browserLink }}">View original variant in UCSC Genome Browser</a>
+ </p>
+ {% endif %} <!-- if browserLink -->
+
+ {% if not parse_error %}
+ {% if description %}
+ <h3>Name checker results</h3>
+
+ {% if genomicDescription %}
+ {% if genomicDNA %}
+ <h4>Genomic description</h4>
+ {% else %} <!-- if genomicDNA -->
+ <h4>Description relative to transcription start</h4>
+ (Not for use in LSDBs in case of protein-coding transcripts).
+ {% endif %} <!-- if genomicDNA -->
+ <code><a href="{{ url_for('.name_checker', description=genomicDescription) }}">{{ genomicDescription }}</a></code>
+ {% endif %} <!-- if genomicDescription -->
+
+ {% if chromDescription %}
+ <p>Alternative chromosomal position:</p>
+ <code>{{ chromDescription }}</code>
+ {% endif %} <!-- if chromDescription -->
+
+ {% if descriptions %}
+ <h4>Affected transcripts:</h4>
+ {% for i in descriptions %}
+ {% if i.endswith('?') %}
+ <code>{{ i }}</code>
+ {% else %}
+ <code><a href="{{ url_for('.name_checker', description=i) }}">{{ i }}</a></code>
+ {% endif %} <!-- if endswith -->
+ {% endfor %} <!-- for i in descriptions -->
+ {% endif %} <!-- if descriptions -->
+
+ {% if protDescriptions %}
+ <h4>Affected proteins:</h4>
+ <p>
+ {% for i in protDescriptions %}
+ <code>{{ i }}</code>
+ {% endfor %} <!-- for i in protDescriptions -->
+ </p>
+ {% endif %} <!-- if protDescriptions -->
+
+ {% if transcriptInfo %}
+ {% if oldProtein %}
+ <h4>Reference protein</h4>
+ <pre>
+ {%- for i in oldProtein -%}
+ {{-i |safe -}}<br>
+ {%- endfor -%}
+ </pre>
+
+ <h4>Protein codedicted from variant coding sequence</h4>
+ {% if newProtein %}
+ <pre>
+ {%- for i in newProtein -%}
+ {{- i|safe -}}<br>
+ {%- endfor -%} <!-- for i in newProtein -->
+ </pre>
+ {% else %} <!-- if newProtein -->
+ <p>
+ No change: codedicted protein (not shown) equals reference
+ protein.
+ </p>
+ {% endif %} <!-- if newProtein -->
+
+ {% if altStart %}
+ <h4>Alternative protein using start codon {{ altStart }}</h4>
+ {% if altProtein %}
+ <pre>
+ {%- for i in altProtein -%}
+ {{- i|safe -}}<br>
+ {%- endfor -%} <!-- for i in altProtein -->
+ </pre>
+ {% else %} <!-- if altProtein -->
+ <p>No change: codedicted protein (not shown) equals reference protein.</p>
+ {% endif %} <!-- if altProtein -->
+ {% endif %} <!-- if altStart -->
+ {% endif %} <!-- if transcriptInfo -->
+
+ {% if restrictionSites %}
+ <h4>Effects on Restriction sites</h4>
+ <div class="code">
+ <table class="table table3">
+ <thead>
+ <th>Raw variant</th>
+ <th>Created</th>
+ <th>Deleted</th>
+ </thead>
+ {% for i in restrictionSites %}
+ <tr>
+ <td>{{ loop.index }}</td>
+ <td>
+ {% for j in i[0] %}
+ {{ j }}{{ ',' if not loop.last }}
+ {% endfor %}
+ </td>
+ <td>
+ {% for j in i[1] %}
+ {{ j }}{{ ',' if not loop.last }}
+ {% endfor %}
+ </td>
+ </tr>
+ {% endfor %}
+ </table>
+ </div>
+ {% endif %} <!-- if restrictionSites -->
+
+ {% if extractedDescription %}
+ <h4>Experimental services</h4>
+ <p>Genomic description: <code>{{ extractedDescription }}</code></p>
+ <p>Protein description: <code>{{ extractedProtein }}</code></p>
+ {% endif %} <!-- if extractedDescription -->
+ {% endif %} <!-- description -->
+ {% endif %} <!-- parse_error -->
+ </div><!-- col-md-8 -->
+
+ <div class="col-md-4">
+ {% if description %}
+ <h4>Exon information</h4>
+ <div class="code">
+ <table class="table table2">
+ <thead>
+ <th>Number</th>
+ <th>Start (g.)</th>
+ <th>Stop (g.)</th>
+ <th>Start {{ '(c.)' if transcriptCoding else '(n.)' }}</th>
+ <th>Stop {{ '(c.)' if transcriptCoding else '(n.)' }}</th>
+ </thead>
+
+ {% for i in exonInfo %}
+ <tr>
+ <td>{{ loop.index }}</td>
+ {% for j in i %}
+ <td>{{ j }}</td>
+ {% endfor %}
+ </tr>
+ {% endfor %}
+ </table>
+ </div>
+
+ {% if transcriptCoding %}
+ <h4><span class = "helper" title = "Coding Sequence">CDS</span> information:</h4>
+ <div class="code">
+ <table class="table table3">
+ <thead>
+ <th></th>
+ <th>g.</th>
+ <th>c.</th>
+ </thead>
+ <tr>
+ <td>Start</td>
+ <td>{{ cdsStart_g }}</td>
+ <td>{{ cdsStart_c }}</td>
+ </tr>
+ <tr>
+ <td>Stop</td>
+ <td>{{ cdsStop_g }}</td>
+ <td>{{ cdsStop_c }}</td>
+ </tr>
+ <tr>
+ </tr>
+ </table>
+ </div>
+ {% endif %} <!-- if transcriptCoding -->
+ <!-- {% endif %} --> <!-- ??? -->
+
+
+ {% if reference_filename and not standalone %}
+ <h4>Links</h4>
+ <p>
+ Download this reference sequence file:
+ <a href="{{ url_for('.reference', filename=reference_filename) }}">{{ reference_filename }}</a>
+ </p>
+ {% endif %}
+
+ {% endif %} <!-- description -->
+ </div><!-- col-md-4 -->
+ </div><!-- row -->
+
+ {% if not parse_error %}
+ <div class="row">
+ <div class="col-md-12">
+ <hr />
+ {% if legends %}
+ <h4>Legend</h4>
+ <div class="code">
+ <table class="table table3">
+ <thead>
+ <th>Name</th>
+ <th>ID</th>
+ <th>Locus tag</th>
+ <th>Product</th>
+ <th>Link method</th>
+ </thead>
+ {% for i in legends %}
+ <tr>
+ {% for j in i %}
+ <td>{{ j if j else '' }}</td>
+ {% endfor %}
+ </tr>
+ {% endfor %}
+ </table>
+ </div>
+ {% endif %}
+ </div><!-- col-md-12 -->
+ </div><!-- row -->
+ {% endif %}
{% endblock content %}
</div>
- </body>
+
+{% if piwik %}
+<!-- Piwik -->
+<script type="text/javascript">
+ var _paq = _paq || [];
+ _paq.push(['trackPageView']);
+ _paq.push(['enableLinkTracking']);
+ (function() {
+ var u="{{ piwik_base_url }}/";
+ _paq.push(['setTrackerUrl', u+'piwik.php']);
+ _paq.push(['setSiteId', {{ piwik_site_id }}]);
+ var d=document, g=d.createElement('script'),
+ s=d.getElementsByTagName('script')[0];
+ g.type='text/javascript'; g.async=true; g.defer=true; g.src=u+'piwik.js';
+ s.parentNode.insertBefore(g,s);
+ })();
+</script>
+<noscript><p><img src="{{ piwik_base_url }}/piwik.php?idsite={{ piwik_site_id }}"
+ style="border:0;" alt="" /></p></noscript>
+<!-- End Piwik Code -->
+{% endif %}
+</body>
</html>
diff --git a/mutalyzer/website/templates/name-generator.html b/mutalyzer/website/templates/name-generator.html
index 90716289fb909c4a439faf314758784b8d232461..0467603ce2466d175d2bdcbcd9abf81e1d54b576 100644
--- a/mutalyzer/website/templates/name-generator.html
+++ b/mutalyzer/website/templates/name-generator.html
@@ -1,90 +1,157 @@
+
{% extends "base.html" %}
{% set active_page = "name-generator" %}
{% set page_title = "Name Generator" %}
{% block content %}
+ <div class="form">
+
+ <p>Construct the mutation from a reference by adding variants to it. The HGVS name is constructed instantly <a href="#constructed_name">below</a>.
+
+ <hr/>
+
+ <form id="mainform" onkeyup="update();" onchange="update();" style="padding: 0;" class="form-horizontal" role="form">
+
+ <h4>Reference</h4>
+ <div class="form-group">
+ <label for="refe" class="col-sm-2 control-label">Reference sequence</label>
+ <div class="col-sm-10">
+ <input type="text" name="refe" value=""class="form-control" placeholder="Reference" >
+ </div>
+ </div>
+
+ <div class="form-group">
+ <label for="seqT" class="col-sm-2 control-label">Sequence Type</label>
+ <div class="col-sm-10">
+ <select name="seqT" class="form-control">
+ <option value="g">Genomic</option>
+ <option value="c" selected="1">Coding DNA</option>
+ <option value="n">NonCoding DNA</option>
+ <option value="r">RNAcss</option>
+ <option value="m">Mitochondrial DNA</option>
+ <option value="p" disabled="true">Protein</option>
+ <!-- Protein Naming not yet implemented-->
+ <option value="e">EST</option>
+ </select>
+ </div>
+ </div>
+
+
+ <div id="tlc" style="display: none; " class="form-group">
+ <label class="label-left">TLC</label>
+ <div class="radio">
+ <label class="label-left"><input type="radio" name="tlc" value="0"class="form-control" > One Letter Code</label>
+ </div>
+ <div class="radio">
+ <label class="label-left"><input type="radio" name="tlc" value="1" checked=""class="form-control" > Three Letter Code</label>
+ </div>
+ </div>
+
+ <div id="gSym" class="form-group">
+ <label for="gSym" class="col-sm-2 control-label">Gene symbol</label>
+ <div class="col-sm-10">
+ <input type="text" name="gSym" size="20" value=""class="form-control" placeholder="Gene symbol">
+ </div>
+ </div>
+
+ <div id="tVar" class="form-group">
+ <label for="tVar" class="col-sm-2 control-label">Transcript</label>
+ <div class="col-sm-10">
+ <input type="text" name="tVar" size="20" value=""class="form-control form-control-small" placeholder="Transcript">
+ </div>
+ </div>
+
+ <div class="form-group small text-danger">
+ <div class="col-sm-offset-2 col-sm-10">
+ <div id="seqTerror" style="display: none;"></div>
+ <div id="refeerror"></div>
+ <div id="gSymerror"></div>
+ <div id="tVarerror"></div>
+ </div>
+ </div>
+
+ <div id="variants">
+ <!-- This is where the mutations will be arriving -->
+ </div>
+
+<!-- <div id="optional">
+ <sup>*</sup> This field is optional
+ </div> -->
+
+
+<!-- Variant Template -->
+ <div id="varianttemplate" style="display: none">
+ <div class="row form-horizontal-inline">
+ <div class="form-group col-md-6" id="V{NMBR}mutTrow">
+ <label for="V{NMBR}mutT" id="V{NMBR}mutTname">Mutation Type</label>
+ <select name="V{NMBR}mutT" onchange="update();"class="form-control input-sm" >
+ <option value="1">Substitution</option>
+ <option value="2">Deletion</option>
+ <option value="3">Insertion</option>
+ <option value="4">Duplication</option>
+ <option value="5">Insertion/Deletion</option>
+ <option value="6">Inversion</option>
+ </select>
+ <div class="text-danger small" id="{NMBR}mutTerror" class="errors"></div>
+ </div>
+
+ <div class="form-group col-md-6" id="V{NMBR}P1row">
+ <label id="V{NMBR}P1name">Start Position</label>
+ <input type="text" name="V{NMBR}P1" value="" class="form-control input-sm">
+ <div class="text-danger small" id="V{NMBR}P1error"></div>
+ </div>
+
+ <div class="form-group col-md-6" id="V{NMBR}P2row">
+ <label id="V{NMBR}P2name">End Position</label>
+ <input type="text" name="V{NMBR}P2" size="20" value="" class="form-control input-sm" >
+ <div class="text-danger small" id="V{NMBR}P2error"></div>
+ </div>
+ </div>
+ <div class="row form-horizontal-inline">
+ <div class="col-md-6" id="V{NMBR}S1row">
+ <div class="form-group" name="S1">
+ <label id="V{NMBR}S1name">Old Sequence</label>
+ <input type="text" name="V{NMBR}S1" size="20" value=""class="form-control input-sm">
+ <div class="text-danger small" id="V{NMBR}S1error"></div>
+ </div>
+ </div>
+
+ <div class="col-md-6" id="V{NMBR}S2row">
+ <div class="form-group" name="S2">
+ <label id="V{NMBR}S2name">New Sequence</label>
+ <input type="text" name="V{NMBR}S2" size="20" value=""class="form-control input-sm">
+ <div class="text-danger small" id="V{NMBR}S2error"></div>
+ </div>
+ </div>
+ </div>
+ <hr/>
+ </div><!-- varianttemplate -->
+
+
+
+ <div class="form-group">
+ <div class="col-sm-12">
+ <input type="button" onclick="addVariant();" class="btn btn-success" value="Add variant +">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/NameGenerator" target="new" class="btn btn-default pull-right">Help</a>
+ <input type="button" onclick="if(confirm('This action will clear all input fields'))javascript:location.reload(true);" value="Clear form" class="btn btn-default pull-right">
+ </div>
+ </div>
+
+
+
+ </form>
+
+ <hr/>
+
+ <a id="constructed_name"><h4>Constructed HGVS Name</h4></a>
+ <pre id="output" >
+ <!-- Empty PlaceHolder -->
+ </pre>
+ <p class="text-muted">Please click the link to check with the Name Checker</p>
+
+ </div><!-- form -->
- <div id="main">
- <form id="mainform" onkeyup="update();" onchange="update();">
- <fieldset>
- <legend>Reference</legend>
- <table id="refTable">
- <tbody>
- <tr id="refe">
- <td>Reference</td>
- <td><input type="text" name="refe" size="20" value=""></td>
- <td id="refeerror" class="errors"></td>
- </tr>
-
- <tr id="seqT">
- <td>Sequence Type</td>
- <td>
- <select name="seqT" size="1">
- <option value="g">Genomic</option>
- <option value="c" selected="1">Coding DNA</option>
- <option value="n">NonCoding DNA</option>
- <option value="r">RNA</option>
- <option value="m">Mitochondrial DNA</option>
- <option value="p" disabled="true">Protein</option>
- <!-- Protein Naming not yet implemented-->
- <option value="e">EST</option>
- </select>
- </td>
- <td id="seqTerror" class="errors"></td>
- </tr>
-
- <tr id="tlc" style="display: none; ">
- <td></td>
- <td>
- <input type="radio" name="tlc" value="0"> One Letter Code
- <input type="radio" name="tlc" value="1" checked=""> Three Letter Code
- </td>
- <td></td>
- </tr>
-
- <tr id="gSym">
- <td>Gene Symbol</td>
- <td>
- <input type="text" name="gSym" size="20" value="">
- </td>
- <td id="gSymerror" class="errors"></td>
- </tr>
-
- <tr id="tVar">
- <td>Transcript</td>
- <td>
- <input type="text" name="tVar" size="20" value="">
- </td>
- <td id="tVarerror" class="errors"></td>
- </tr>
- </tbody>
- </table>
- </fieldset>
-
- <div id="variants">
- <!-- This is where the mutations will be arriving -->
- </div>
- <div id="optional">
- <p><sup>*</sup> This field is optional</p>
- </div>
- <div id="addButton">
- <input type="button" onclick="addVariant();" value="Add Variant">
- <input type="button" onclick="if(confirm('This action will clear all
- input
- fields'))javascript:location.reload(true);"
- value="Clear Form">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/NameGenerator">Help</a>
- </div>
- </form>
-
-
- <fieldset id="outputfield">
- <legend>Constructed HGVS Name - Please click the link to check with the Name Checker</legend>
- <div id="output" >
- <!-- Empty PlaceHolder -->
- </div>
- </fieldset>
<!-- Inline Javascript -->
@@ -98,109 +165,6 @@
</script>
-<!-- Inline CSS -->
-
-<style type="text/css">
-
- .errors{
- color: #FF0000;
- font-size: 10px;
- }
-
- #optional{
- color: #888;
- font-size: 10px;
- line-height: 20px;
- }
-
- #outputfield{
- background-color: #EFF;
- }
-
- #output{
- width: 100%;
- /*background-color: green;*/
- }
-
- #outputhelp{
- color: #444;
- font-size: 12px;
- }
- .remove{
- color: #FF0000;
- font-size: 11px;
- cursor: pointer;
- }
-
-</style>
-
-<!-- Variant Template -->
-<div id="varianttemplate" style="display: none">
-<table>
-
- <tbody id="V{NMBR}mutTrow">
- <tr name="mutT">
- <td>Mutation Type</td>
- <td>
- <select name="V{NMBR}mutT" onchange="update();">
- <option value="1">Substitution</option>
- <option value="2">Deletion</option>
- <option value="3">Insertion</option>
- <option value="4">Duplication</option>
- <option value="5">Insertion/Deletion</option>
- <option value="6">Inversion</option>
- </select>
- </td>
- <td id="{NMBR}mutTerror" class="errors"></td>
- </tr>
- </tbody>
-
- <tbody id = "V{NMBR}P1row">
- <tr name="P1">
- <td id = "V{NMBR}P1name">Start Position</td>
- <td>
- <input type="text" name="V{NMBR}P1" size="20" value="">
- </td>
- <td id="V{NMBR}P1error" class="errors"></td>
- </tr>
- </tbody>
-
- <tbody id = "V{NMBR}P2row">
- <tr name="P2">
- <td id="V{NMBR}P2name">End Position</td>
- <td>
- <input type="text" name="V{NMBR}P2" size="20" value="">
- </td>
- <td id="V{NMBR}P2error" class="errors"></td>
- </tr>
- </tbody>
-
-
- <tbody id="V{NMBR}S1row">
- <tr name="S1">
- <td id="V{NMBR}S1name">Old Sequence</td>
- <td>
- <input type="text" name="V{NMBR}S1" size="20" value="">
- </td>
- <td id="V{NMBR}S1error" class="errors"></td>
- </tr>
- </tbody>
-
- <tbody id="V{NMBR}S2row">
- <tr name="S2">
- <td id="V{NMBR}S2name">New Sequence</td>
- <td>
- <input type="text" name="V{NMBR}S2" size="20" value="">
- </td>
- <td id="V{NMBR}S2error" class="errors"></td>
- </tr>
- </tbody>
-
-</table>
-
-</div><!-- varianttemplate -->
-
-</div>
{% endblock content %}
diff --git a/mutalyzer/website/templates/position-converter.html b/mutalyzer/website/templates/position-converter.html
index 12f498b1dfc2bc15dd1a18c46b8e5d9a2c3198c8..d7dc142404bc690a70d5725581135fd73eec3f4d 100644
--- a/mutalyzer/website/templates/position-converter.html
+++ b/mutalyzer/website/templates/position-converter.html
@@ -5,7 +5,6 @@
{% block content %}
-<div style="border: 1px solid grey; background-color: aliceblue; padding: 20px;">
<p>
Please supply the genome assembly which you want to use to convert your
position.
@@ -15,52 +14,56 @@
normalize it to HGVS. Use the <a href="{{ url_for('.name_checker') }}">Name Checker</a> for this.
</p>
<p>
- Example: NM_003002.2:c.274G>T<br>
- or: chr11:g.111959693G>T<br>
- or: NC_000011.9:g.111959693G>T<br>
+ Examples: <code class="example-input">NM_003002.2:c.274G>T</code>, <code class="example-input">chr11:g.111959693G>T</code> and <code class="example-input">NC_000011.9:g.111959693G>T</code>
</p>
- <table id="inputform">
- <form action="{{ url_for('.position_converter') }}" method="get" enctype="multipart/form-data">
- <tr>
- <td><b>Assembly</b></td>
- <td>
- <select name="assembly_name_or_alias">
- {% for assembly in assemblies %}
-<option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{ assembly.alias }}){% endif %}</option>
- {% endfor %}
- </select>
- </td>
- </tr>
- <tr>
- <td><b>Variant</b></td>
- <td><input type="text" name="description" value="{{ description }}" style="width:500px"></td>
- </tr>
- <tr>
- <td colspan="2">
- <input type="submit" value="Submit">
- <input type="button" value="Clear field" onclick="clearField(this.form, 'description');">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/PositionConverter">Help</a>
- </td>
-
- </tr>
- </form>
- </table> <!-- inputform -->
-</div>
+ <form class="form-horizontal" role="form" action="{{ url_for('.position_converter') }}" method="get" enctype="multipart/form-data">
+
+ <div class="form-group">
+ <label for="assembly_name_or_alias" class="col-md-2 control-label">Build</label>
+ <div class="col-md-10">
+ <select name="assembly_name_or_alias" class="form-control">
+ {% for assembly in assemblies %}
+ <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{ assembly.alias }}){% endif %}</option>
+ {% endfor %}
+ </select>
+ </div>
+ </div>
+
+ <div class="form-group">
+ <label for="description" class="col-md-2 control-label">Variant</label>
+ <div class="col-md-10">
+ <input type="text" name="description" value="{{ description }}" class="form-control form-pre example-target" placeholder="Variant">
+ </div>
+ </div>
+ <div class="form-group">
+ <div class=" col-md-12">
+ <input type="submit" class="btn btn-primary" value="Submit">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/PositionConverter" target="new" class="btn btn-default pull-right">Help</a>
+ <input type="reset" class="btn btn-default pull-right" value="Undo">
+ </div>
+ </div>
+ </form>
{% if description %}
- <h3>Results:</h3>
+ <h3>Results</h3>
- <div class="messages">
- {% for m in messages %}
- <p class="{{ m.class }}" title="{{ m.level }} (origin: {{ m.origin
- }})">{{ m.description }}</p>
- {% endfor %}
- <p>{{ summary }}</p>
- </div>
+ {% for m in messages %}
+ {% if m.class == "error" %}
+ <div class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</div>
+ {% elif m.class == "warning" %}
+ <div class="alert warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</div>
+ {% endif %}
+ {% endfor %}
+
+ {% if summary == "0 Errors, 0 Warnings."%}
+ <div class="alert success summary">{{ summary }}</div>
+ {% else %}
+ <div>{{summary}}</div>
+ {% endif %}
{% if chromosomal_description %}
<p>
- <b>Chromosomal Variant:</b>
+ <h4>Chromosomal Variant:</h4>
</p>
<pre>{{ chromosomal_description }}</pre>
{% if not transcript_descriptions %}
diff --git a/mutalyzer/website/templates/reference-loader.html b/mutalyzer/website/templates/reference-loader.html
index 09a2cbf3511211ea8cb562fe02a9ad2636378b67..decbc6b89913b6b15dc76bb611f40bae4b10e075 100644
--- a/mutalyzer/website/templates/reference-loader.html
+++ b/mutalyzer/website/templates/reference-loader.html
@@ -13,6 +13,28 @@ window.onload=function(){
}
</script>
+{% if errors %}
+<div class="alert alert-danger" role="alert">
+ <h4>Reference File not loaded!</h4>
+ The following errors occured:
+ <ul>
+ {% for i in errors %}
+ <li>{{ i }}</li>
+ {% endfor %}
+ </ul>
+</div>
+{% endif %}
+
+{% if ud %}
+<div class="alert alert-success">
+ <h4>Reference Sequence successfully loaded</h4>
+ <p>Your reference sequence was loaded successfully. You can now use Mutalyzer with the following accession number as reference:</p>
+ <p class="text-center" style="font-size: 20px"><strong>{{ ud }}</strong></p>
+ <p class="text-center"><a href="{{ url_for('.reference', filename=ud + '.gb') }}" id="reference_download" class="">Download this reference sequence.</a></p>
+</div>
+{% endif %}
+
+
<p>
The Reference File Loader allows you to use your own reference
sequence when no appropriate RefSeq, GenBank or LRG file is available.
@@ -23,164 +45,142 @@ sequence (maximum size is {{ max_file_size }} megabytes):
</p>
<form name="invoer" enctype="multipart/form-data" action="{{ url_for('.reference_loader') }}" method="post">
- <table border="0" cellpadding="0" cellspacing="0">
- <tr valign="top">
- <th width="100" style="text-align: left; padding-left : 70px">Options</th>
- <td>
- <input type="radio" name="method" value="upload" checked onClick="updateVisibility();">
- The reference sequence file is a local file<br>
- <input type="radio" name="method" value="url" onClick="updateVisibility();">
- The reference sequence file can be found at the following URL<br>
- <input type="radio" name="method" value="slice_gene" onClick="updateVisibility();">
- Retrieve part of the reference genome for a (HGNC) gene symbol<br>
- <input type="radio" name="method" value="slice_accession" onClick="updateVisibility();">
- Retrieve a range of a chromosome by accession number<br>
- <input type="radio" name="method" value="slice_chromosome" onClick="updateVisibility();">
- Retrieve a range of a chromosome by name<br>
- </td>
- </tr>
- <tr height="20px"></tr>
- <tr valign="top">
- <th width="100" style="text-align : left; padding-left : 70px">Input
- </th>
- <td>
- <span id="upload_label">
- <i>Please select the GenBank file in plain text format</i><br>
- <input type="file" name="file"><br>
- </span>
- <span id="url_label">
- <i>Please enter the URL of the GenBank file in plain text
- (including http://)</i>
- <br>
- <input type="text" name="url"><br>
- </span>
- <span id="slice_gene_label">
- <i>Please enter the Gene symbol and organism name without spaces
- and specify the length of the flanking sequences</i>
- <br>
- <b>Note:</b> This uses
- the <a href="http://www.ncbi.nlm.nih.gov/sites/gquery">NCBI
- Entrez</a> search engine and is therefore based on the current
- Entrez assembly for the given organism (GRCh38/hg38 for human).
- <table>
- <tr>
- <td>Gene symbol</td>
- <td><input type="text" name="genesymbol"></td>
- </tr>
- <tr>
- <td>Organism name</td>
- <td><input type="text" name="organism"></td>
- </tr>
- <tr>
- <td>Number of 5' flanking nucleotides</td>
- <td><input type="text" name="upstream" value="5000"></td>
- </tr>
- <tr><td>Number of 3' flanking nucleotides</td>
- <td><input type="text" name="downstream" value="2000"></td>
- </tr>
- </table>
- </span>
- <span id="slice_accession_label">
- <i>Please enter the accession number of the chromosome or contig
- and specify the range</i><br>
- <table>
- <tr>
- <td>Chromosome accession number</td>
- <td><input type="text" name="accession"></td>
- </tr>
- <tr>
- <td>Start position</td>
- <td><input type="text" name="accession_start"></td>
- </tr>
- <tr>
- <td>Stop position</td>
- <td><input type="text" name="accession_stop"></td>
- </tr>
- <tr>
- <td>Orientation</td>
- <td>
- <select name="accession_orientation">
- <option value="1">Forward</option>
- <option value="2">Reverse</option>
- </select>
- </td>
- </tr>
- </table>
- </span>
- <span id="slice_chromosome_label">
- <i>Please enter the name of the chromosome
- and specify the range</i><br>
- <table>
- <tr>
- <td>Assembly</td>
- <td>
- <select name="assembly_name_or_alias">
- {% for assembly in assemblies %}
-<option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{assembly.alias }}){% endif %}</option>
- {% endfor %}
- </select>
- </td>
- </tr>
- <tr>
- <td>Chromosome name</td>
- <td><input type="text" name="chromosome"></td>
- </tr>
- <tr>
- <td>Start position</td>
- <td><input type="text" name="chromosome_start"></td>
- </tr>
- <tr>
- <td>Stop position</td>
- <td><input type="text" name="chromosome_stop"></td>
- </tr>
- <tr>
- <td>Orientation</td>
- <td>
- <select name="chromosome_orientation">
- <option value="1">Forward</option>
- <option value="2">Reverse</option>
- </select>
- </td>
- </tr>
- </table>
- </span>
- </td>
- </tr>
- <tr height="20px"></tr>
- <tr>
- <td></td>
- <td>
- <input type="submit" value="Submit">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/ReferenceLoader">Help</a>
- </td>
- </tr>
- </table>
+ <div class="row">
+ <div class="col-md-6">
+ <div class="form-group" id="input-methods">
+ <div class="radio">
+ <label>
+ <input type="radio" name="method" value="upload" checked >
+ The reference sequence file is a local file
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="method" value="url" >
+ The reference sequence file can be found at the following URL
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="method" value="slice_gene" >
+ Retrieve part of the reference genome for a (HGNC) gene symbol
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="method" value="slice_accession" >
+ Retrieve a range of a chromosome by accession number
+ </label>
+ </div>
+ <div class="radio">
+ <label>
+ <input type="radio" name="method" value="slice_chromosome" >
+ Retrieve a range of a chromosome by name
+ </label>
+ </div>
+ </div>
+ </div>
+ <script type="text/javascript">
+ $('#input-methods input').on('change', updateVisibility);
+ </script>
+ <div class="col-md-6">
+
+
+ <div class="form-group" id="upload_label">
+ <label for="file">GenBank file</label>
+ <input type="file" name="file">
+ <p class="help-block">Please select the GenBank file in plain text format</p>
+ </div>
+
+
+ <div class="form-group" id="url_label">
+ <label for="url">GenBank file URL</label>
+ <input type="text" name="url" class="form-control">
+ <p class="help-block">Please enter the URL of the GenBank file in plain text (including http://)</p>
+ </div>
+
+
+ <div id="slice_gene_label">
+ <div class="form-group">
+ <p class="help-block">Please enter the Gene symbol and organism name without spaces
+ and specify the length of the flanking sequences</p>
+ <p class="help-block"><b>Note:</b> This uses
+ the <a href="http://www.ncbi.nlm.nih.gov/sites/gquery">NCBI
+ Entrez</a> search engine and is therefore based on the current
+ Entrez assembly for the given organism (GRCh38/hg38 for human).</p>
+
+ <label for="genesymbol">Gene symbol</label>
+ <input type="text" name="genesymbol" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="organism">Organism name</label>
+ <input type="text" name="organism" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="upstream">Number of 5' flanking nucleotides</label>
+ <input type="text" name="upstream" value="5000" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="downstream"><td>Number of 3' flanking nucleotides</label>
+ <input type="text" name="downstream" value="2000" class="form-control">
+ </div>
+ </div>
+
+
+ <div id="slice_accession_label">
+ <div class="form-group">
+ <p class="help-block">Please enter the accession number of the chromosome or contig and specify the range</p>
+ <label>Chromosome accession number</label>
+ <input type="text" name="accession" class="form-control">
+ </div>
+ <div class="form-group">
+ <label>Start position</label>
+ <input type="text" name="accession_start" class="form-control">
+ </div>
+ <div class="form-group">
+ <label>Stop position</label>
+ <input type="text" name="accession_stop" class="form-control">
+ </div>
+ <div class="form-group">
+ <label>Orientation</label>
+ <div class="radio"><label><input type="radio" name="accession_orientation" value="1" checked> Forward</label></div>
+ <div class="radio"><label><input type="radio" name="accession_orientation" value="2"> Reverse</label></div>
+ </div>
+ </div>
+
+ <div id="slice_chromosome_label">
+ <div class="form-group">
+ <p class="help-block">Please enter the name of the chromosome and specify the range</p>
+ <label for="assembly_name_or_alias">Assembly</label>
+ <select name="assembly_name_or_alias">
+ {% for assembly in assemblies %}
+ <option value="{{ assembly.name }}"{% if assembly_name_or_alias in (assembly.name, assembly.alias) %} selected="selected"{% endif %}>{{ assembly.taxonomy_common_name }} — {{ assembly.name }}{% if assembly.alias %} ({{assembly.alias }}){% endif %}</option>
+ {% endfor %}
+ </select>
+ </div>
+ <div class="form-group">
+ <label for="chromosome">Chromosome name</label>
+ <input type="text" name="chromosome" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="chromosome_start">Start position</label>
+ <input type="text" name="chromosome_start" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="chromosome_stop">Stop position</label>
+ <input type="text" name="chromosome_stop" class="form-control">
+ </div>
+ <div class="form-group">
+ <label for="chromosome_orientation">Orientation</label>
+ <div class="radio"><label><input type="radio" name="chromosome_orientation" value="1" checked> Forward</label></div>
+ <div class="radio"><label><input type="radio" name="chromosome_orientation" value="2"> Reverse</label></div>
+ </div>
+ </div>
+ </div>
+ </div>
+ <input type="submit" value="Submit"class="btn btn-primary btn-submit" >
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/SyntaxChecker" target="_blank" class="btn btn-default pull-right">Help</a>
+
</form>
-{% if errors %}
- <p>
- <b>Error output:</b>
- </p>
-
- <pre>
- {% for i in errors %}
- {{ i }}<br>
- {% endfor %}
- </pre>
-{% endif %}
-
-{% if ud %}
- <p>
- <b>Output:</b>
- </p>
- <p>
- Your reference sequence was loaded successfully.<br>
- You now can use mutalyzer with the following accession number as
- reference: <b>{{ ud }}</b>
- </p>
- <p>
- <a href="{{ url_for('.reference', filename=ud + '.gb') }}" id="reference_download">Download this reference sequence.</a>
- </p>
-{% endif %}
-
{% endblock content %}
diff --git a/mutalyzer/website/templates/snp-converter.html b/mutalyzer/website/templates/snp-converter.html
index 5c0af32dba00b40347b79e26d07385ce6ce24c12..837ce97c27218ec863c1889572126d7a7b080128 100644
--- a/mutalyzer/website/templates/snp-converter.html
+++ b/mutalyzer/website/templates/snp-converter.html
@@ -5,45 +5,68 @@
{% block content %}
-<div style="border: 1px solid grey; background-color: aliceblue; padding: 20px;">
- <p>
- Please insert the
- <a href="http://www.ncbi.nlm.nih.gov/projects/SNP/">dbSNP</a> rs
- number below. Mutalyzer will retrieve the HGVS description of the SNP
- specified on the reference sequence(s) used by dbSNP.
- </p>
- <p>
- Example: rs9919552
- </p>
- <form action="{{ url_for('.snp_converter') }}" method="get">
- <input type="text" name="rs_id" value="{{ rs_id }}" style="width:25%"><br>
- <input type="submit" value="Submit">
- <input type="button" value="Clear field" onclick="clearField(this.form, 'rs_id');">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/SnpConverter">Help</a>
- </form>
-</div>
+ {% if messages %}
+ {% for m in messages %}
+ {% if m.class == "error" %}
+ <p class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% elif m.class == "warning" %}
+ <p class="alert alert-warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
+ {% endif %}
+ {% endfor %}
+ {% endif %} <!-- messages -->
+
+ {% if summary == "0 Errors, 0 Warnings."%}
+ <p class="alert alert-success summary">{{ summary }}</p>
+ {% else %}
+ <p>{{summary}}</p>
+ <hr />
+ {% endif %}
+
+ <p>
+ Please insert the
+ <a href="http://www.ncbi.nlm.nih.gov/projects/SNP/">dbSNP</a> rs
+ number below. Mutalyzer will retrieve the HGVS description of the SNP specified on the reference sequence(s) used by dbSNP.
+ </p>
+
+ <p>
+ Example: <code class="example-input">rs9919552</code>
+ </p>
+
+ <form role="form" class="form" action="{{ url_for('.snp_converter') }}" method="get">
+ <div class="form-group">
+ <label for="description">dbSNP rs number</label>
+ <input type="text" class="form-control form-pre example-target" name="rs_id" placeholder="" value="{{ rs_id }}" ></input>
+ </div>
+
+ <div class="form-group">
+ <input type="submit" class="btn btn-primary" value="Submit">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/PositionConverter" target="new" class="btn btn-default pull-right">Help</a>
+ <input type="reset" class="btn btn-default pull-right" value="Undo">
+ </div>
+ </form>
{% if rs_id %}
- <h3>SNP converter results:</h3>
-
- <div class="messages">
- {% for m in messages %}
- <p class="{{ m.class }}" title="{{ m.level }} (origin: {{ m.origin
- }})">{{ m.description }}</p>
- {% endfor %}
- <p>{{ summary }}</p>
- </div>
-
- <h4>dbSNP rs ID:</h4>
- <p>
- <tt>{{ rs_id }}</tt>
- </p>
- <h4>HGVS descriptions:</h4>
- <p>
- {% for d in descriptions %}
- <tt>{{ d }}</tt><br>
+ <h3>SNP converter results</h3>
+
+<!-- {% for m in messages %}
+ {% if m.class == "error" %}
+ <div class="alert alert-danger" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</div>
+ {% elif m.class == "warning" %}
+ <div class="alert warning" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</div>
+ {% endif %}
{% endfor %}
- </p>
+
+ {% if summary == "0 Errors, 0 Warnings."%}
+ <div class="alert success summary">{{ summary }}</div>
+ {% else %}
+ <div>{{summary}}</div>
+ {% endif %} -->
+
+
+ <h4>dbSNP rs ID</h4>
+ <pre>{{ rs_id }}</pre>
+ <h4>HGVS descriptions</h4>
+ <pre>{% for d in descriptions %}{{ d }}</br>{% endfor %}</pre>
{% endif %}
{% endblock content %}
diff --git a/mutalyzer/website/templates/static/css/bootstrap.css b/mutalyzer/website/templates/static/css/bootstrap.css
new file mode 100644
index 0000000000000000000000000000000000000000..ec3eb4d0a772df35782b9c7c6eebbf9e91180a63
--- /dev/null
+++ b/mutalyzer/website/templates/static/css/bootstrap.css
@@ -0,0 +1,6203 @@
+/*!
+ * Bootstrap v3.2.0 (http://getbootstrap.com)
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ */
+
+/*! normalize.css v3.0.1 | MIT License | git.io/normalize */
+html {
+ font-family: sans-serif;
+ -webkit-text-size-adjust: 100%;
+ -ms-text-size-adjust: 100%;
+}
+body {
+ margin: 0;
+}
+article,
+aside,
+details,
+figcaption,
+figure,
+footer,
+header,
+hgroup,
+main,
+nav,
+section,
+summary {
+ display: block;
+}
+audio,
+canvas,
+progress,
+video {
+ display: inline-block;
+ vertical-align: baseline;
+}
+audio:not([controls]) {
+ display: none;
+ height: 0;
+}
+[hidden],
+template {
+ display: none;
+}
+a {
+ background: transparent;
+}
+a:active,
+a:hover {
+ outline: 0;
+}
+abbr[title] {
+ border-bottom: 1px dotted;
+}
+b,
+strong {
+ font-weight: bold;
+}
+dfn {
+ font-style: italic;
+}
+h1 {
+ margin: .67em 0;
+ font-size: 2em;
+}
+mark {
+ color: #000;
+ background: #ff0;
+}
+small {
+ font-size: 80%;
+}
+sub,
+sup {
+ position: relative;
+ font-size: 75%;
+ line-height: 0;
+ vertical-align: baseline;
+}
+sup {
+ top: -.5em;
+}
+sub {
+ bottom: -.25em;
+}
+img {
+ border: 0;
+}
+svg:not(:root) {
+ overflow: hidden;
+}
+figure {
+ margin: 1em 40px;
+}
+hr {
+ height: 0;
+ -webkit-box-sizing: content-box;
+ -moz-box-sizing: content-box;
+ box-sizing: content-box;
+}
+pre {
+ overflow: auto;
+}
+code,
+kbd,
+pre,
+samp {
+ font-family: monospace, monospace;
+ font-size: 1em;
+}
+button,
+input,
+optgroup,
+select,
+textarea {
+ margin: 0;
+ font: inherit;
+ color: inherit;
+}
+button {
+ overflow: visible;
+}
+button,
+select {
+ text-transform: none;
+}
+button,
+html input[type="button"],
+input[type="reset"],
+input[type="submit"] {
+ -webkit-appearance: button;
+ cursor: pointer;
+}
+button[disabled],
+html input[disabled] {
+ cursor: default;
+}
+button::-moz-focus-inner,
+input::-moz-focus-inner {
+ padding: 0;
+ border: 0;
+}
+input {
+ line-height: normal;
+}
+input[type="checkbox"],
+input[type="radio"] {
+ -webkit-box-sizing: border-box;
+ -moz-box-sizing: border-box;
+ box-sizing: border-box;
+ padding: 0;
+}
+input[type="number"]::-webkit-inner-spin-button,
+input[type="number"]::-webkit-outer-spin-button {
+ height: auto;
+}
+input[type="search"] {
+ -webkit-box-sizing: content-box;
+ -moz-box-sizing: content-box;
+ box-sizing: content-box;
+ -webkit-appearance: textfield;
+}
+input[type="search"]::-webkit-search-cancel-button,
+input[type="search"]::-webkit-search-decoration {
+ -webkit-appearance: none;
+}
+fieldset {
+ padding: .35em .625em .75em;
+ margin: 0 2px;
+ border: 1px solid #c0c0c0;
+}
+legend {
+ padding: 0;
+ border: 0;
+}
+textarea {
+ overflow: auto;
+}
+optgroup {
+ font-weight: bold;
+}
+table {
+ border-spacing: 0;
+ border-collapse: collapse;
+}
+td,
+th {
+ padding: 0;
+}
+@media print {
+ * {
+ color: #000 !important;
+ text-shadow: none !important;
+ background: transparent !important;
+ -webkit-box-shadow: none !important;
+ box-shadow: none !important;
+ }
+ a,
+ a:visited {
+ text-decoration: underline;
+ }
+ a[href]:after {
+ content: " (" attr(href) ")";
+ }
+ abbr[title]:after {
+ content: " (" attr(title) ")";
+ }
+ a[href^="javascript:"]:after,
+ a[href^="#"]:after {
+ content: "";
+ }
+ pre,
+ blockquote {
+ border: 1px solid #999;
+
+ page-break-inside: avoid;
+ }
+ thead {
+ display: table-header-group;
+ }
+ tr,
+ img {
+ page-break-inside: avoid;
+ }
+ img {
+ max-width: 100% !important;
+ }
+ p,
+ h2,
+ h3 {
+ orphans: 3;
+ widows: 3;
+ }
+ h2,
+ h3 {
+ page-break-after: avoid;
+ }
+ select {
+ background: #fff !important;
+ }
+ .navbar {
+ display: none;
+ }
+ .table td,
+ .table th {
+ background-color: #fff !important;
+ }
+ .btn > .caret,
+ .dropup > .btn > .caret {
+ border-top-color: #000 !important;
+ }
+ .label {
+ border: 1px solid #000;
+ }
+ .table {
+ border-collapse: collapse !important;
+ }
+ .table-bordered th,
+ .table-bordered td {
+ border: 1px solid #ddd !important;
+ }
+}
+@font-face {
+ font-family: 'Glyphicons Halflings';
+
+ src: url('../fonts/glyphicons-halflings-regular.eot');
+ src: url('../fonts/glyphicons-halflings-regular.eot?#iefix') format('embedded-opentype'), url('../fonts/glyphicons-halflings-regular.woff') format('woff'), url('../fonts/glyphicons-halflings-regular.ttf') format('truetype'), url('../fonts/glyphicons-halflings-regular.svg#glyphicons_halflingsregular') format('svg');
+}
+.glyphicon {
+ position: relative;
+ top: 1px;
+ display: inline-block;
+ font-family: 'Glyphicons Halflings';
+ font-style: normal;
+ font-weight: normal;
+ line-height: 1;
+
+ -webkit-font-smoothing: antialiased;
+ -moz-osx-font-smoothing: grayscale;
+}
+.glyphicon-asterisk:before {
+ content: "\2a";
+}
+.glyphicon-plus:before {
+ content: "\2b";
+}
+.glyphicon-euro:before {
+ content: "\20ac";
+}
+.glyphicon-minus:before {
+ content: "\2212";
+}
+.glyphicon-cloud:before {
+ content: "\2601";
+}
+.glyphicon-envelope:before {
+ content: "\2709";
+}
+.glyphicon-pencil:before {
+ content: "\270f";
+}
+.glyphicon-glass:before {
+ content: "\e001";
+}
+.glyphicon-music:before {
+ content: "\e002";
+}
+.glyphicon-search:before {
+ content: "\e003";
+}
+.glyphicon-heart:before {
+ content: "\e005";
+}
+.glyphicon-star:before {
+ content: "\e006";
+}
+.glyphicon-star-empty:before {
+ content: "\e007";
+}
+.glyphicon-user:before {
+ content: "\e008";
+}
+.glyphicon-film:before {
+ content: "\e009";
+}
+.glyphicon-th-large:before {
+ content: "\e010";
+}
+.glyphicon-th:before {
+ content: "\e011";
+}
+.glyphicon-th-list:before {
+ content: "\e012";
+}
+.glyphicon-ok:before {
+ content: "\e013";
+}
+.glyphicon-remove:before {
+ content: "\e014";
+}
+.glyphicon-zoom-in:before {
+ content: "\e015";
+}
+.glyphicon-zoom-out:before {
+ content: "\e016";
+}
+.glyphicon-off:before {
+ content: "\e017";
+}
+.glyphicon-signal:before {
+ content: "\e018";
+}
+.glyphicon-cog:before {
+ content: "\e019";
+}
+.glyphicon-trash:before {
+ content: "\e020";
+}
+.glyphicon-home:before {
+ content: "\e021";
+}
+.glyphicon-file:before {
+ content: "\e022";
+}
+.glyphicon-time:before {
+ content: "\e023";
+}
+.glyphicon-road:before {
+ content: "\e024";
+}
+.glyphicon-download-alt:before {
+ content: "\e025";
+}
+.glyphicon-download:before {
+ content: "\e026";
+}
+.glyphicon-upload:before {
+ content: "\e027";
+}
+.glyphicon-inbox:before {
+ content: "\e028";
+}
+.glyphicon-play-circle:before {
+ content: "\e029";
+}
+.glyphicon-repeat:before {
+ content: "\e030";
+}
+.glyphicon-refresh:before {
+ content: "\e031";
+}
+.glyphicon-list-alt:before {
+ content: "\e032";
+}
+.glyphicon-lock:before {
+ content: "\e033";
+}
+.glyphicon-flag:before {
+ content: "\e034";
+}
+.glyphicon-headphones:before {
+ content: "\e035";
+}
+.glyphicon-volume-off:before {
+ content: "\e036";
+}
+.glyphicon-volume-down:before {
+ content: "\e037";
+}
+.glyphicon-volume-up:before {
+ content: "\e038";
+}
+.glyphicon-qrcode:before {
+ content: "\e039";
+}
+.glyphicon-barcode:before {
+ content: "\e040";
+}
+.glyphicon-tag:before {
+ content: "\e041";
+}
+.glyphicon-tags:before {
+ content: "\e042";
+}
+.glyphicon-book:before {
+ content: "\e043";
+}
+.glyphicon-bookmark:before {
+ content: "\e044";
+}
+.glyphicon-print:before {
+ content: "\e045";
+}
+.glyphicon-camera:before {
+ content: "\e046";
+}
+.glyphicon-font:before {
+ content: "\e047";
+}
+.glyphicon-bold:before {
+ content: "\e048";
+}
+.glyphicon-italic:before {
+ content: "\e049";
+}
+.glyphicon-text-height:before {
+ content: "\e050";
+}
+.glyphicon-text-width:before {
+ content: "\e051";
+}
+.glyphicon-align-left:before {
+ content: "\e052";
+}
+.glyphicon-align-center:before {
+ content: "\e053";
+}
+.glyphicon-align-right:before {
+ content: "\e054";
+}
+.glyphicon-align-justify:before {
+ content: "\e055";
+}
+.glyphicon-list:before {
+ content: "\e056";
+}
+.glyphicon-indent-left:before {
+ content: "\e057";
+}
+.glyphicon-indent-right:before {
+ content: "\e058";
+}
+.glyphicon-facetime-video:before {
+ content: "\e059";
+}
+.glyphicon-picture:before {
+ content: "\e060";
+}
+.glyphicon-map-marker:before {
+ content: "\e062";
+}
+.glyphicon-adjust:before {
+ content: "\e063";
+}
+.glyphicon-tint:before {
+ content: "\e064";
+}
+.glyphicon-edit:before {
+ content: "\e065";
+}
+.glyphicon-share:before {
+ content: "\e066";
+}
+.glyphicon-check:before {
+ content: "\e067";
+}
+.glyphicon-move:before {
+ content: "\e068";
+}
+.glyphicon-step-backward:before {
+ content: "\e069";
+}
+.glyphicon-fast-backward:before {
+ content: "\e070";
+}
+.glyphicon-backward:before {
+ content: "\e071";
+}
+.glyphicon-play:before {
+ content: "\e072";
+}
+.glyphicon-pause:before {
+ content: "\e073";
+}
+.glyphicon-stop:before {
+ content: "\e074";
+}
+.glyphicon-forward:before {
+ content: "\e075";
+}
+.glyphicon-fast-forward:before {
+ content: "\e076";
+}
+.glyphicon-step-forward:before {
+ content: "\e077";
+}
+.glyphicon-eject:before {
+ content: "\e078";
+}
+.glyphicon-chevron-left:before {
+ content: "\e079";
+}
+.glyphicon-chevron-right:before {
+ content: "\e080";
+}
+.glyphicon-plus-sign:before {
+ content: "\e081";
+}
+.glyphicon-minus-sign:before {
+ content: "\e082";
+}
+.glyphicon-remove-sign:before {
+ content: "\e083";
+}
+.glyphicon-ok-sign:before {
+ content: "\e084";
+}
+.glyphicon-question-sign:before {
+ content: "\e085";
+}
+.glyphicon-info-sign:before {
+ content: "\e086";
+}
+.glyphicon-screenshot:before {
+ content: "\e087";
+}
+.glyphicon-remove-circle:before {
+ content: "\e088";
+}
+.glyphicon-ok-circle:before {
+ content: "\e089";
+}
+.glyphicon-ban-circle:before {
+ content: "\e090";
+}
+.glyphicon-arrow-left:before {
+ content: "\e091";
+}
+.glyphicon-arrow-right:before {
+ content: "\e092";
+}
+.glyphicon-arrow-up:before {
+ content: "\e093";
+}
+.glyphicon-arrow-down:before {
+ content: "\e094";
+}
+.glyphicon-share-alt:before {
+ content: "\e095";
+}
+.glyphicon-resize-full:before {
+ content: "\e096";
+}
+.glyphicon-resize-small:before {
+ content: "\e097";
+}
+.glyphicon-exclamation-sign:before {
+ content: "\e101";
+}
+.glyphicon-gift:before {
+ content: "\e102";
+}
+.glyphicon-leaf:before {
+ content: "\e103";
+}
+.glyphicon-fire:before {
+ content: "\e104";
+}
+.glyphicon-eye-open:before {
+ content: "\e105";
+}
+.glyphicon-eye-close:before {
+ content: "\e106";
+}
+.glyphicon-warning-sign:before {
+ content: "\e107";
+}
+.glyphicon-plane:before {
+ content: "\e108";
+}
+.glyphicon-calendar:before {
+ content: "\e109";
+}
+.glyphicon-random:before {
+ content: "\e110";
+}
+.glyphicon-comment:before {
+ content: "\e111";
+}
+.glyphicon-magnet:before {
+ content: "\e112";
+}
+.glyphicon-chevron-up:before {
+ content: "\e113";
+}
+.glyphicon-chevron-down:before {
+ content: "\e114";
+}
+.glyphicon-retweet:before {
+ content: "\e115";
+}
+.glyphicon-shopping-cart:before {
+ content: "\e116";
+}
+.glyphicon-folder-close:before {
+ content: "\e117";
+}
+.glyphicon-folder-open:before {
+ content: "\e118";
+}
+.glyphicon-resize-vertical:before {
+ content: "\e119";
+}
+.glyphicon-resize-horizontal:before {
+ content: "\e120";
+}
+.glyphicon-hdd:before {
+ content: "\e121";
+}
+.glyphicon-bullhorn:before {
+ content: "\e122";
+}
+.glyphicon-bell:before {
+ content: "\e123";
+}
+.glyphicon-certificate:before {
+ content: "\e124";
+}
+.glyphicon-thumbs-up:before {
+ content: "\e125";
+}
+.glyphicon-thumbs-down:before {
+ content: "\e126";
+}
+.glyphicon-hand-right:before {
+ content: "\e127";
+}
+.glyphicon-hand-left:before {
+ content: "\e128";
+}
+.glyphicon-hand-up:before {
+ content: "\e129";
+}
+.glyphicon-hand-down:before {
+ content: "\e130";
+}
+.glyphicon-circle-arrow-right:before {
+ content: "\e131";
+}
+.glyphicon-circle-arrow-left:before {
+ content: "\e132";
+}
+.glyphicon-circle-arrow-up:before {
+ content: "\e133";
+}
+.glyphicon-circle-arrow-down:before {
+ content: "\e134";
+}
+.glyphicon-globe:before {
+ content: "\e135";
+}
+.glyphicon-wrench:before {
+ content: "\e136";
+}
+.glyphicon-tasks:before {
+ content: "\e137";
+}
+.glyphicon-filter:before {
+ content: "\e138";
+}
+.glyphicon-briefcase:before {
+ content: "\e139";
+}
+.glyphicon-fullscreen:before {
+ content: "\e140";
+}
+.glyphicon-dashboard:before {
+ content: "\e141";
+}
+.glyphicon-paperclip:before {
+ content: "\e142";
+}
+.glyphicon-heart-empty:before {
+ content: "\e143";
+}
+.glyphicon-link:before {
+ content: "\e144";
+}
+.glyphicon-phone:before {
+ content: "\e145";
+}
+.glyphicon-pushpin:before {
+ content: "\e146";
+}
+.glyphicon-usd:before {
+ content: "\e148";
+}
+.glyphicon-gbp:before {
+ content: "\e149";
+}
+.glyphicon-sort:before {
+ content: "\e150";
+}
+.glyphicon-sort-by-alphabet:before {
+ content: "\e151";
+}
+.glyphicon-sort-by-alphabet-alt:before {
+ content: "\e152";
+}
+.glyphicon-sort-by-order:before {
+ content: "\e153";
+}
+.glyphicon-sort-by-order-alt:before {
+ content: "\e154";
+}
+.glyphicon-sort-by-attributes:before {
+ content: "\e155";
+}
+.glyphicon-sort-by-attributes-alt:before {
+ content: "\e156";
+}
+.glyphicon-unchecked:before {
+ content: "\e157";
+}
+.glyphicon-expand:before {
+ content: "\e158";
+}
+.glyphicon-collapse-down:before {
+ content: "\e159";
+}
+.glyphicon-collapse-up:before {
+ content: "\e160";
+}
+.glyphicon-log-in:before {
+ content: "\e161";
+}
+.glyphicon-flash:before {
+ content: "\e162";
+}
+.glyphicon-log-out:before {
+ content: "\e163";
+}
+.glyphicon-new-window:before {
+ content: "\e164";
+}
+.glyphicon-record:before {
+ content: "\e165";
+}
+.glyphicon-save:before {
+ content: "\e166";
+}
+.glyphicon-open:before {
+ content: "\e167";
+}
+.glyphicon-saved:before {
+ content: "\e168";
+}
+.glyphicon-import:before {
+ content: "\e169";
+}
+.glyphicon-export:before {
+ content: "\e170";
+}
+.glyphicon-send:before {
+ content: "\e171";
+}
+.glyphicon-floppy-disk:before {
+ content: "\e172";
+}
+.glyphicon-floppy-saved:before {
+ content: "\e173";
+}
+.glyphicon-floppy-remove:before {
+ content: "\e174";
+}
+.glyphicon-floppy-save:before {
+ content: "\e175";
+}
+.glyphicon-floppy-open:before {
+ content: "\e176";
+}
+.glyphicon-credit-card:before {
+ content: "\e177";
+}
+.glyphicon-transfer:before {
+ content: "\e178";
+}
+.glyphicon-cutlery:before {
+ content: "\e179";
+}
+.glyphicon-header:before {
+ content: "\e180";
+}
+.glyphicon-compressed:before {
+ content: "\e181";
+}
+.glyphicon-earphone:before {
+ content: "\e182";
+}
+.glyphicon-phone-alt:before {
+ content: "\e183";
+}
+.glyphicon-tower:before {
+ content: "\e184";
+}
+.glyphicon-stats:before {
+ content: "\e185";
+}
+.glyphicon-sd-video:before {
+ content: "\e186";
+}
+.glyphicon-hd-video:before {
+ content: "\e187";
+}
+.glyphicon-subtitles:before {
+ content: "\e188";
+}
+.glyphicon-sound-stereo:before {
+ content: "\e189";
+}
+.glyphicon-sound-dolby:before {
+ content: "\e190";
+}
+.glyphicon-sound-5-1:before {
+ content: "\e191";
+}
+.glyphicon-sound-6-1:before {
+ content: "\e192";
+}
+.glyphicon-sound-7-1:before {
+ content: "\e193";
+}
+.glyphicon-copyright-mark:before {
+ content: "\e194";
+}
+.glyphicon-registration-mark:before {
+ content: "\e195";
+}
+.glyphicon-cloud-download:before {
+ content: "\e197";
+}
+.glyphicon-cloud-upload:before {
+ content: "\e198";
+}
+.glyphicon-tree-conifer:before {
+ content: "\e199";
+}
+.glyphicon-tree-deciduous:before {
+ content: "\e200";
+}
+* {
+ -webkit-box-sizing: border-box;
+ -moz-box-sizing: border-box;
+ box-sizing: border-box;
+}
+*:before,
+*:after {
+ -webkit-box-sizing: border-box;
+ -moz-box-sizing: border-box;
+ box-sizing: border-box;
+}
+html {
+ font-size: 10px;
+
+ -webkit-tap-highlight-color: rgba(0, 0, 0, 0);
+}
+body {
+ font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
+ font-size: 14px;
+ line-height: 1.42857143;
+ color: #333;
+ background-color: #fff;
+}
+input,
+button,
+select,
+textarea {
+ font-family: inherit;
+ font-size: inherit;
+ line-height: inherit;
+}
+a {
+ color: #428bca;
+ text-decoration: none;
+}
+a:hover,
+a:focus {
+ color: #2a6496;
+ text-decoration: underline;
+}
+a:focus {
+ outline: thin dotted;
+ outline: 5px auto -webkit-focus-ring-color;
+ outline-offset: -2px;
+}
+figure {
+ margin: 0;
+}
+img {
+ vertical-align: middle;
+}
+.img-responsive,
+.thumbnail > img,
+.thumbnail a > img,
+.carousel-inner > .item > img,
+.carousel-inner > .item > a > img {
+ display: block;
+ width: 100% \9;
+ max-width: 100%;
+ height: auto;
+}
+.img-rounded {
+ border-radius: 6px;
+}
+.img-thumbnail {
+ display: inline-block;
+ width: 100% \9;
+ max-width: 100%;
+ height: auto;
+ padding: 4px;
+ line-height: 1.42857143;
+ background-color: #fff;
+ border: 1px solid #ddd;
+ border-radius: 4px;
+ -webkit-transition: all .2s ease-in-out;
+ -o-transition: all .2s ease-in-out;
+ transition: all .2s ease-in-out;
+}
+.img-circle {
+ border-radius: 50%;
+}
+hr {
+ margin-top: 20px;
+ margin-bottom: 20px;
+ border: 0;
+ border-top: 1px solid #eee;
+}
+.sr-only {
+ position: absolute;
+ width: 1px;
+ height: 1px;
+ padding: 0;
+ margin: -1px;
+ overflow: hidden;
+ clip: rect(0, 0, 0, 0);
+ border: 0;
+}
+.sr-only-focusable:active,
+.sr-only-focusable:focus {
+ position: static;
+ width: auto;
+ height: auto;
+ margin: 0;
+ overflow: visible;
+ clip: auto;
+}
+h1,
+h2,
+h3,
+h4,
+h5,
+h6,
+.h1,
+.h2,
+.h3,
+.h4,
+.h5,
+.h6 {
+ font-family: inherit;
+ font-weight: 500;
+ line-height: 1.1;
+ color: inherit;
+}
+h1 small,
+h2 small,
+h3 small,
+h4 small,
+h5 small,
+h6 small,
+.h1 small,
+.h2 small,
+.h3 small,
+.h4 small,
+.h5 small,
+.h6 small,
+h1 .small,
+h2 .small,
+h3 .small,
+h4 .small,
+h5 .small,
+h6 .small,
+.h1 .small,
+.h2 .small,
+.h3 .small,
+.h4 .small,
+.h5 .small,
+.h6 .small {
+ font-weight: normal;
+ line-height: 1;
+ color: #777;
+}
+h1,
+.h1,
+h2,
+.h2,
+h3,
+.h3 {
+ margin-top: 20px;
+ margin-bottom: 10px;
+}
+h1 small,
+.h1 small,
+h2 small,
+.h2 small,
+h3 small,
+.h3 small,
+h1 .small,
+.h1 .small,
+h2 .small,
+.h2 .small,
+h3 .small,
+.h3 .small {
+ font-size: 65%;
+}
+h4,
+.h4,
+h5,
+.h5,
+h6,
+.h6 {
+ margin-top: 10px;
+ margin-bottom: 10px;
+}
+h4 small,
+.h4 small,
+h5 small,
+.h5 small,
+h6 small,
+.h6 small,
+h4 .small,
+.h4 .small,
+h5 .small,
+.h5 .small,
+h6 .small,
+.h6 .small {
+ font-size: 75%;
+}
+h1,
+.h1 {
+ font-size: 36px;
+}
+h2,
+.h2 {
+ font-size: 30px;
+}
+h3,
+.h3 {
+ font-size: 24px;
+}
+h4,
+.h4 {
+ font-size: 18px;
+}
+h5,
+.h5 {
+ font-size: 14px;
+}
+h6,
+.h6 {
+ font-size: 12px;
+}
+p {
+ margin: 0 0 10px;
+}
+.lead {
+ margin-bottom: 20px;
+ font-size: 16px;
+ font-weight: 300;
+ line-height: 1.4;
+}
+@media (min-width: 768px) {
+ .lead {
+ font-size: 21px;
+ }
+}
+small,
+.small {
+ font-size: 85%;
+}
+cite {
+ font-style: normal;
+}
+mark,
+.mark {
+ padding: .2em;
+ background-color: #fcf8e3;
+}
+.text-left {
+ text-align: left;
+}
+.text-right {
+ text-align: right;
+}
+.text-center {
+ text-align: center;
+}
+.text-justify {
+ text-align: justify;
+}
+.text-nowrap {
+ white-space: nowrap;
+}
+.text-lowercase {
+ text-transform: lowercase;
+}
+.text-uppercase {
+ text-transform: uppercase;
+}
+.text-capitalize {
+ text-transform: capitalize;
+}
+.text-muted {
+ color: #777;
+}
+.text-primary {
+ color: #428bca;
+}
+a.text-primary:hover {
+ color: #3071a9;
+}
+.text-success {
+ color: #3c763d;
+}
+a.text-success:hover {
+ color: #2b542c;
+}
+.text-info {
+ color: #31708f;
+}
+a.text-info:hover {
+ color: #245269;
+}
+.text-warning {
+ color: #8a6d3b;
+}
+a.text-warning:hover {
+ color: #66512c;
+}
+.text-danger {
+ color: #a94442;
+}
+a.text-danger:hover {
+ color: #843534;
+}
+.bg-primary {
+ color: #fff;
+ background-color: #428bca;
+}
+a.bg-primary:hover {
+ background-color: #3071a9;
+}
+.bg-success {
+ background-color: #dff0d8;
+}
+a.bg-success:hover {
+ background-color: #c1e2b3;
+}
+.bg-info {
+ background-color: #d9edf7;
+}
+a.bg-info:hover {
+ background-color: #afd9ee;
+}
+.bg-warning {
+ background-color: #fcf8e3;
+}
+a.bg-warning:hover {
+ background-color: #f7ecb5;
+}
+.bg-danger {
+ background-color: #f2dede;
+}
+a.bg-danger:hover {
+ background-color: #e4b9b9;
+}
+.page-header {
+ padding-bottom: 9px;
+ margin: 40px 0 20px;
+ border-bottom: 1px solid #eee;
+}
+ul,
+ol {
+ margin-top: 0;
+ margin-bottom: 10px;
+}
+ul ul,
+ol ul,
+ul ol,
+ol ol {
+ margin-bottom: 0;
+}
+.list-unstyled {
+ padding-left: 0;
+ list-style: none;
+}
+.list-inline {
+ padding-left: 0;
+ margin-left: -5px;
+ list-style: none;
+}
+.list-inline > li {
+ display: inline-block;
+ padding-right: 5px;
+ padding-left: 5px;
+}
+dl {
+ margin-top: 0;
+ margin-bottom: 20px;
+}
+dt,
+dd {
+ line-height: 1.42857143;
+}
+dt {
+ font-weight: bold;
+}
+dd {
+ margin-left: 0;
+}
+@media (min-width: 862px) {
+ .dl-horizontal dt {
+ float: left;
+ width: 160px;
+ overflow: hidden;
+ clear: left;
+ text-align: right;
+ text-overflow: ellipsis;
+ white-space: nowrap;
+ }
+ .dl-horizontal dd {
+ margin-left: 180px;
+ }
+}
+abbr[title],
+abbr[data-original-title] {
+ cursor: help;
+ border-bottom: 1px dotted #777;
+}
+.initialism {
+ font-size: 90%;
+ text-transform: uppercase;
+}
+blockquote {
+ padding: 10px 20px;
+ margin: 0 0 20px;
+ font-size: 17.5px;
+ border-left: 5px solid #eee;
+}
+blockquote p:last-child,
+blockquote ul:last-child,
+blockquote ol:last-child {
+ margin-bottom: 0;
+}
+blockquote footer,
+blockquote small,
+blockquote .small {
+ display: block;
+ font-size: 80%;
+ line-height: 1.42857143;
+ color: #777;
+}
+blockquote footer:before,
+blockquote small:before,
+blockquote .small:before {
+ content: '\2014 \00A0';
+}
+.blockquote-reverse,
+blockquote.pull-right {
+ padding-right: 15px;
+ padding-left: 0;
+ text-align: right;
+ border-right: 5px solid #eee;
+ border-left: 0;
+}
+.blockquote-reverse footer:before,
+blockquote.pull-right footer:before,
+.blockquote-reverse small:before,
+blockquote.pull-right small:before,
+.blockquote-reverse .small:before,
+blockquote.pull-right .small:before {
+ content: '';
+}
+.blockquote-reverse footer:after,
+blockquote.pull-right footer:after,
+.blockquote-reverse small:after,
+blockquote.pull-right small:after,
+.blockquote-reverse .small:after,
+blockquote.pull-right .small:after {
+ content: '\00A0 \2014';
+}
+blockquote:before,
+blockquote:after {
+ content: "";
+}
+address {
+ margin-bottom: 20px;
+ font-style: normal;
+ line-height: 1.42857143;
+}
+code,
+kbd,
+pre,
+samp {
+ font-family: Menlo, Monaco, Consolas, "Courier New", monospace;
+}
+code {
+ padding: 2px 4px;
+ font-size: 90%;
+ color: #c7254e;
+ background-color: #f9f2f4;
+ border-radius: 4px;
+}
+kbd {
+ padding: 2px 4px;
+ font-size: 90%;
+ color: #fff;
+ background-color: #333;
+ border-radius: 3px;
+ -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, .25);
+ box-shadow: inset 0 -1px 0 rgba(0, 0, 0, .25);
+}
+kbd kbd {
+ padding: 0;
+ font-size: 100%;
+ -webkit-box-shadow: none;
+ box-shadow: none;
+}
+pre {
+ display: block;
+ padding: 9.5px;
+ margin: 0 0 10px;
+ font-size: 13px;
+ line-height: 1.42857143;
+ color: #333;
+ word-break: break-all;
+ word-wrap: break-word;
+ background-color: #f5f5f5;
+ border: 1px solid #ccc;
+ border-radius: 4px;
+}
+pre code {
+ padding: 0;
+ font-size: inherit;
+ color: inherit;
+ white-space: pre-wrap;
+ background-color: transparent;
+ border-radius: 0;
+}
+.pre-scrollable {
+ max-height: 340px;
+ overflow-y: scroll;
+}
+.container {
+ padding-right: 15px;
+ padding-left: 15px;
+ margin-right: auto;
+ margin-left: auto;
+}
+@media (min-width: 768px) {
+ .container {
+ width: 750px;
+ }
+}
+@media (min-width: 992px) {
+ .container {
+ width: 970px;
+ }
+}
+@media (min-width: 1200px) {
+ .container {
+ width: 1170px;
+ }
+}
+.container-fluid {
+ padding-right: 15px;
+ padding-left: 15px;
+ margin-right: auto;
+ margin-left: auto;
+}
+.row {
+ margin-right: -15px;
+ margin-left: -15px;
+}
+.col-xs-1, .col-sm-1, .col-md-1, .col-lg-1, .col-xs-2, .col-sm-2, .col-md-2, .col-lg-2, .col-xs-3, .col-sm-3, .col-md-3, .col-lg-3, .col-xs-4, .col-sm-4, .col-md-4, .col-lg-4, .col-xs-5, .col-sm-5, .col-md-5, .col-lg-5, .col-xs-6, .col-sm-6, .col-md-6, .col-lg-6, .col-xs-7, .col-sm-7, .col-md-7, .col-lg-7, .col-xs-8, .col-sm-8, .col-md-8, .col-lg-8, .col-xs-9, .col-sm-9, .col-md-9, .col-lg-9, .col-xs-10, .col-sm-10, .col-md-10, .col-lg-10, .col-xs-11, .col-sm-11, .col-md-11, .col-lg-11, .col-xs-12, .col-sm-12, .col-md-12, .col-lg-12 {
+ position: relative;
+ min-height: 1px;
+ padding-right: 15px;
+ padding-left: 15px;
+}
+.col-xs-1, .col-xs-2, .col-xs-3, .col-xs-4, .col-xs-5, .col-xs-6, .col-xs-7, .col-xs-8, .col-xs-9, .col-xs-10, .col-xs-11, .col-xs-12 {
+ float: left;
+}
+.col-xs-12 {
+ width: 100%;
+}
+.col-xs-11 {
+ width: 91.66666667%;
+}
+.col-xs-10 {
+ width: 83.33333333%;
+}
+.col-xs-9 {
+ width: 75%;
+}
+.col-xs-8 {
+ width: 66.66666667%;
+}
+.col-xs-7 {
+ width: 58.33333333%;
+}
+.col-xs-6 {
+ width: 50%;
+}
+.col-xs-5 {
+ width: 41.66666667%;
+}
+.col-xs-4 {
+ width: 33.33333333%;
+}
+.col-xs-3 {
+ width: 25%;
+}
+.col-xs-2 {
+ width: 16.66666667%;
+}
+.col-xs-1 {
+ width: 8.33333333%;
+}
+.col-xs-pull-12 {
+ right: 100%;
+}
+.col-xs-pull-11 {
+ right: 91.66666667%;
+}
+.col-xs-pull-10 {
+ right: 83.33333333%;
+}
+.col-xs-pull-9 {
+ right: 75%;
+}
+.col-xs-pull-8 {
+ right: 66.66666667%;
+}
+.col-xs-pull-7 {
+ right: 58.33333333%;
+}
+.col-xs-pull-6 {
+ right: 50%;
+}
+.col-xs-pull-5 {
+ right: 41.66666667%;
+}
+.col-xs-pull-4 {
+ right: 33.33333333%;
+}
+.col-xs-pull-3 {
+ right: 25%;
+}
+.col-xs-pull-2 {
+ right: 16.66666667%;
+}
+.col-xs-pull-1 {
+ right: 8.33333333%;
+}
+.col-xs-pull-0 {
+ right: auto;
+}
+.col-xs-push-12 {
+ left: 100%;
+}
+.col-xs-push-11 {
+ left: 91.66666667%;
+}
+.col-xs-push-10 {
+ left: 83.33333333%;
+}
+.col-xs-push-9 {
+ left: 75%;
+}
+.col-xs-push-8 {
+ left: 66.66666667%;
+}
+.col-xs-push-7 {
+ left: 58.33333333%;
+}
+.col-xs-push-6 {
+ left: 50%;
+}
+.col-xs-push-5 {
+ left: 41.66666667%;
+}
+.col-xs-push-4 {
+ left: 33.33333333%;
+}
+.col-xs-push-3 {
+ left: 25%;
+}
+.col-xs-push-2 {
+ left: 16.66666667%;
+}
+.col-xs-push-1 {
+ left: 8.33333333%;
+}
+.col-xs-push-0 {
+ left: auto;
+}
+.col-xs-offset-12 {
+ margin-left: 100%;
+}
+.col-xs-offset-11 {
+ margin-left: 91.66666667%;
+}
+.col-xs-offset-10 {
+ margin-left: 83.33333333%;
+}
+.col-xs-offset-9 {
+ margin-left: 75%;
+}
+.col-xs-offset-8 {
+ margin-left: 66.66666667%;
+}
+.col-xs-offset-7 {
+ margin-left: 58.33333333%;
+}
+.col-xs-offset-6 {
+ margin-left: 50%;
+}
+.col-xs-offset-5 {
+ margin-left: 41.66666667%;
+}
+.col-xs-offset-4 {
+ margin-left: 33.33333333%;
+}
+.col-xs-offset-3 {
+ margin-left: 25%;
+}
+.col-xs-offset-2 {
+ margin-left: 16.66666667%;
+}
+.col-xs-offset-1 {
+ margin-left: 8.33333333%;
+}
+.col-xs-offset-0 {
+ margin-left: 0;
+}
+@media (min-width: 768px) {
+ .col-sm-1, .col-sm-2, .col-sm-3, .col-sm-4, .col-sm-5, .col-sm-6, .col-sm-7, .col-sm-8, .col-sm-9, .col-sm-10, .col-sm-11, .col-sm-12 {
+ float: left;
+ }
+ .col-sm-12 {
+ width: 100%;
+ }
+ .col-sm-11 {
+ width: 91.66666667%;
+ }
+ .col-sm-10 {
+ width: 83.33333333%;
+ }
+ .col-sm-9 {
+ width: 75%;
+ }
+ .col-sm-8 {
+ width: 66.66666667%;
+ }
+ .col-sm-7 {
+ width: 58.33333333%;
+ }
+ .col-sm-6 {
+ width: 50%;
+ }
+ .col-sm-5 {
+ width: 41.66666667%;
+ }
+ .col-sm-4 {
+ width: 33.33333333%;
+ }
+ .col-sm-3 {
+ width: 25%;
+ }
+ .col-sm-2 {
+ width: 16.66666667%;
+ }
+ .col-sm-1 {
+ width: 8.33333333%;
+ }
+ .col-sm-pull-12 {
+ right: 100%;
+ }
+ .col-sm-pull-11 {
+ right: 91.66666667%;
+ }
+ .col-sm-pull-10 {
+ right: 83.33333333%;
+ }
+ .col-sm-pull-9 {
+ right: 75%;
+ }
+ .col-sm-pull-8 {
+ right: 66.66666667%;
+ }
+ .col-sm-pull-7 {
+ right: 58.33333333%;
+ }
+ .col-sm-pull-6 {
+ right: 50%;
+ }
+ .col-sm-pull-5 {
+ right: 41.66666667%;
+ }
+ .col-sm-pull-4 {
+ right: 33.33333333%;
+ }
+ .col-sm-pull-3 {
+ right: 25%;
+ }
+ .col-sm-pull-2 {
+ right: 16.66666667%;
+ }
+ .col-sm-pull-1 {
+ right: 8.33333333%;
+ }
+ .col-sm-pull-0 {
+ right: auto;
+ }
+ .col-sm-push-12 {
+ left: 100%;
+ }
+ .col-sm-push-11 {
+ left: 91.66666667%;
+ }
+ .col-sm-push-10 {
+ left: 83.33333333%;
+ }
+ .col-sm-push-9 {
+ left: 75%;
+ }
+ .col-sm-push-8 {
+ left: 66.66666667%;
+ }
+ .col-sm-push-7 {
+ left: 58.33333333%;
+ }
+ .col-sm-push-6 {
+ left: 50%;
+ }
+ .col-sm-push-5 {
+ left: 41.66666667%;
+ }
+ .col-sm-push-4 {
+ left: 33.33333333%;
+ }
+ .col-sm-push-3 {
+ left: 25%;
+ }
+ .col-sm-push-2 {
+ left: 16.66666667%;
+ }
+ .col-sm-push-1 {
+ left: 8.33333333%;
+ }
+ .col-sm-push-0 {
+ left: auto;
+ }
+ .col-sm-offset-12 {
+ margin-left: 100%;
+ }
+ .col-sm-offset-11 {
+ margin-left: 91.66666667%;
+ }
+ .col-sm-offset-10 {
+ margin-left: 83.33333333%;
+ }
+ .col-sm-offset-9 {
+ margin-left: 75%;
+ }
+ .col-sm-offset-8 {
+ margin-left: 66.66666667%;
+ }
+ .col-sm-offset-7 {
+ margin-left: 58.33333333%;
+ }
+ .col-sm-offset-6 {
+ margin-left: 50%;
+ }
+ .col-sm-offset-5 {
+ margin-left: 41.66666667%;
+ }
+ .col-sm-offset-4 {
+ margin-left: 33.33333333%;
+ }
+ .col-sm-offset-3 {
+ margin-left: 25%;
+ }
+ .col-sm-offset-2 {
+ margin-left: 16.66666667%;
+ }
+ .col-sm-offset-1 {
+ margin-left: 8.33333333%;
+ }
+ .col-sm-offset-0 {
+ margin-left: 0;
+ }
+}
+@media (min-width: 992px) {
+ .col-md-1, .col-md-2, .col-md-3, .col-md-4, .col-md-5, .col-md-6, .col-md-7, .col-md-8, .col-md-9, .col-md-10, .col-md-11, .col-md-12 {
+ float: left;
+ }
+ .col-md-12 {
+ width: 100%;
+ }
+ .col-md-11 {
+ width: 91.66666667%;
+ }
+ .col-md-10 {
+ width: 83.33333333%;
+ }
+ .col-md-9 {
+ width: 75%;
+ }
+ .col-md-8 {
+ width: 66.66666667%;
+ }
+ .col-md-7 {
+ width: 58.33333333%;
+ }
+ .col-md-6 {
+ width: 50%;
+ }
+ .col-md-5 {
+ width: 41.66666667%;
+ }
+ .col-md-4 {
+ width: 33.33333333%;
+ }
+ .col-md-3 {
+ width: 25%;
+ }
+ .col-md-2 {
+ width: 16.66666667%;
+ }
+ .col-md-1 {
+ width: 8.33333333%;
+ }
+ .col-md-pull-12 {
+ right: 100%;
+ }
+ .col-md-pull-11 {
+ right: 91.66666667%;
+ }
+ .col-md-pull-10 {
+ right: 83.33333333%;
+ }
+ .col-md-pull-9 {
+ right: 75%;
+ }
+ .col-md-pull-8 {
+ right: 66.66666667%;
+ }
+ .col-md-pull-7 {
+ right: 58.33333333%;
+ }
+ .col-md-pull-6 {
+ right: 50%;
+ }
+ .col-md-pull-5 {
+ right: 41.66666667%;
+ }
+ .col-md-pull-4 {
+ right: 33.33333333%;
+ }
+ .col-md-pull-3 {
+ right: 25%;
+ }
+ .col-md-pull-2 {
+ right: 16.66666667%;
+ }
+ .col-md-pull-1 {
+ right: 8.33333333%;
+ }
+ .col-md-pull-0 {
+ right: auto;
+ }
+ .col-md-push-12 {
+ left: 100%;
+ }
+ .col-md-push-11 {
+ left: 91.66666667%;
+ }
+ .col-md-push-10 {
+ left: 83.33333333%;
+ }
+ .col-md-push-9 {
+ left: 75%;
+ }
+ .col-md-push-8 {
+ left: 66.66666667%;
+ }
+ .col-md-push-7 {
+ left: 58.33333333%;
+ }
+ .col-md-push-6 {
+ left: 50%;
+ }
+ .col-md-push-5 {
+ left: 41.66666667%;
+ }
+ .col-md-push-4 {
+ left: 33.33333333%;
+ }
+ .col-md-push-3 {
+ left: 25%;
+ }
+ .col-md-push-2 {
+ left: 16.66666667%;
+ }
+ .col-md-push-1 {
+ left: 8.33333333%;
+ }
+ .col-md-push-0 {
+ left: auto;
+ }
+ .col-md-offset-12 {
+ margin-left: 100%;
+ }
+ .col-md-offset-11 {
+ margin-left: 91.66666667%;
+ }
+ .col-md-offset-10 {
+ margin-left: 83.33333333%;
+ }
+ .col-md-offset-9 {
+ margin-left: 75%;
+ }
+ .col-md-offset-8 {
+ margin-left: 66.66666667%;
+ }
+ .col-md-offset-7 {
+ margin-left: 58.33333333%;
+ }
+ .col-md-offset-6 {
+ margin-left: 50%;
+ }
+ .col-md-offset-5 {
+ margin-left: 41.66666667%;
+ }
+ .col-md-offset-4 {
+ margin-left: 33.33333333%;
+ }
+ .col-md-offset-3 {
+ margin-left: 25%;
+ }
+ .col-md-offset-2 {
+ margin-left: 16.66666667%;
+ }
+ .col-md-offset-1 {
+ margin-left: 8.33333333%;
+ }
+ .col-md-offset-0 {
+ margin-left: 0;
+ }
+}
+@media (min-width: 1200px) {
+ .col-lg-1, .col-lg-2, .col-lg-3, .col-lg-4, .col-lg-5, .col-lg-6, .col-lg-7, .col-lg-8, .col-lg-9, .col-lg-10, .col-lg-11, .col-lg-12 {
+ float: left;
+ }
+ .col-lg-12 {
+ width: 100%;
+ }
+ .col-lg-11 {
+ width: 91.66666667%;
+ }
+ .col-lg-10 {
+ width: 83.33333333%;
+ }
+ .col-lg-9 {
+ width: 75%;
+ }
+ .col-lg-8 {
+ width: 66.66666667%;
+ }
+ .col-lg-7 {
+ width: 58.33333333%;
+ }
+ .col-lg-6 {
+ width: 50%;
+ }
+ .col-lg-5 {
+ width: 41.66666667%;
+ }
+ .col-lg-4 {
+ width: 33.33333333%;
+ }
+ .col-lg-3 {
+ width: 25%;
+ }
+ .col-lg-2 {
+ width: 16.66666667%;
+ }
+ .col-lg-1 {
+ width: 8.33333333%;
+ }
+ .col-lg-pull-12 {
+ right: 100%;
+ }
+ .col-lg-pull-11 {
+ right: 91.66666667%;
+ }
+ .col-lg-pull-10 {
+ right: 83.33333333%;
+ }
+ .col-lg-pull-9 {
+ right: 75%;
+ }
+ .col-lg-pull-8 {
+ right: 66.66666667%;
+ }
+ .col-lg-pull-7 {
+ right: 58.33333333%;
+ }
+ .col-lg-pull-6 {
+ right: 50%;
+ }
+ .col-lg-pull-5 {
+ right: 41.66666667%;
+ }
+ .col-lg-pull-4 {
+ right: 33.33333333%;
+ }
+ .col-lg-pull-3 {
+ right: 25%;
+ }
+ .col-lg-pull-2 {
+ right: 16.66666667%;
+ }
+ .col-lg-pull-1 {
+ right: 8.33333333%;
+ }
+ .col-lg-pull-0 {
+ right: auto;
+ }
+ .col-lg-push-12 {
+ left: 100%;
+ }
+ .col-lg-push-11 {
+ left: 91.66666667%;
+ }
+ .col-lg-push-10 {
+ left: 83.33333333%;
+ }
+ .col-lg-push-9 {
+ left: 75%;
+ }
+ .col-lg-push-8 {
+ left: 66.66666667%;
+ }
+ .col-lg-push-7 {
+ left: 58.33333333%;
+ }
+ .col-lg-push-6 {
+ left: 50%;
+ }
+ .col-lg-push-5 {
+ left: 41.66666667%;
+ }
+ .col-lg-push-4 {
+ left: 33.33333333%;
+ }
+ .col-lg-push-3 {
+ left: 25%;
+ }
+ .col-lg-push-2 {
+ left: 16.66666667%;
+ }
+ .col-lg-push-1 {
+ left: 8.33333333%;
+ }
+ .col-lg-push-0 {
+ left: auto;
+ }
+ .col-lg-offset-12 {
+ margin-left: 100%;
+ }
+ .col-lg-offset-11 {
+ margin-left: 91.66666667%;
+ }
+ .col-lg-offset-10 {
+ margin-left: 83.33333333%;
+ }
+ .col-lg-offset-9 {
+ margin-left: 75%;
+ }
+ .col-lg-offset-8 {
+ margin-left: 66.66666667%;
+ }
+ .col-lg-offset-7 {
+ margin-left: 58.33333333%;
+ }
+ .col-lg-offset-6 {
+ margin-left: 50%;
+ }
+ .col-lg-offset-5 {
+ margin-left: 41.66666667%;
+ }
+ .col-lg-offset-4 {
+ margin-left: 33.33333333%;
+ }
+ .col-lg-offset-3 {
+ margin-left: 25%;
+ }
+ .col-lg-offset-2 {
+ margin-left: 16.66666667%;
+ }
+ .col-lg-offset-1 {
+ margin-left: 8.33333333%;
+ }
+ .col-lg-offset-0 {
+ margin-left: 0;
+ }
+}
+table {
+ background-color: transparent;
+}
+th {
+ text-align: left;
+}
+.table {
+ width: 100%;
+ max-width: 100%;
+ margin-bottom: 20px;
+}
+.table > thead > tr > th,
+.table > tbody > tr > th,
+.table > tfoot > tr > th,
+.table > thead > tr > td,
+.table > tbody > tr > td,
+.table > tfoot > tr > td {
+ padding: 8px;
+ line-height: 1.42857143;
+ vertical-align: top;
+ border-top: 1px solid #ddd;
+}
+.table > thead > tr > th {
+ vertical-align: bottom;
+ border-bottom: 2px solid #ddd;
+}
+.table > caption + thead > tr:first-child > th,
+.table > colgroup + thead > tr:first-child > th,
+.table > thead:first-child > tr:first-child > th,
+.table > caption + thead > tr:first-child > td,
+.table > colgroup + thead > tr:first-child > td,
+.table > thead:first-child > tr:first-child > td {
+ border-top: 0;
+}
+.table > tbody + tbody {
+ border-top: 2px solid #ddd;
+}
+.table .table {
+ background-color: #fff;
+}
+.table-condensed > thead > tr > th,
+.table-condensed > tbody > tr > th,
+.table-condensed > tfoot > tr > th,
+.table-condensed > thead > tr > td,
+.table-condensed > tbody > tr > td,
+.table-condensed > tfoot > tr > td {
+ padding: 5px;
+}
+.table-bordered {
+ border: 1px solid #ddd;
+}
+.table-bordered > thead > tr > th,
+.table-bordered > tbody > tr > th,
+.table-bordered > tfoot > tr > th,
+.table-bordered > thead > tr > td,
+.table-bordered > tbody > tr > td,
+.table-bordered > tfoot > tr > td {
+ border: 1px solid #ddd;
+}
+.table-bordered > thead > tr > th,
+.table-bordered > thead > tr > td {
+ border-bottom-width: 2px;
+}
+.table-striped > tbody > tr:nth-child(odd) > td,
+.table-striped > tbody > tr:nth-child(odd) > th {
+ background-color: #f9f9f9;
+}
+.table-hover > tbody > tr:hover > td,
+.table-hover > tbody > tr:hover > th {
+ background-color: #f5f5f5;
+}
+table col[class*="col-"] {
+ position: static;
+ display: table-column;
+ float: none;
+}
+table td[class*="col-"],
+table th[class*="col-"] {
+ position: static;
+ display: table-cell;
+ float: none;
+}
+.table > thead > tr > td.active,
+.table > tbody > tr > td.active,
+.table > tfoot > tr > td.active,
+.table > thead > tr > th.active,
+.table > tbody > tr > th.active,
+.table > tfoot > tr > th.active,
+.table > thead > tr.active > td,
+.table > tbody > tr.active > td,
+.table > tfoot > tr.active > td,
+.table > thead > tr.active > th,
+.table > tbody > tr.active > th,
+.table > tfoot > tr.active > th {
+ background-color: #f5f5f5;
+}
+.table-hover > tbody > tr > td.active:hover,
+.table-hover > tbody > tr > th.active:hover,
+.table-hover > tbody > tr.active:hover > td,
+.table-hover > tbody > tr:hover > .active,
+.table-hover > tbody > tr.active:hover > th {
+ background-color: #e8e8e8;
+}
+.table > thead > tr > td.success,
+.table > tbody > tr > td.success,
+.table > tfoot > tr > td.success,
+.table > thead > tr > th.success,
+.table > tbody > tr > th.success,
+.table > tfoot > tr > th.success,
+.table > thead > tr.success > td,
+.table > tbody > tr.success > td,
+.table > tfoot > tr.success > td,
+.table > thead > tr.success > th,
+.table > tbody > tr.success > th,
+.table > tfoot > tr.success > th {
+ background-color: #dff0d8;
+}
+.table-hover > tbody > tr > td.success:hover,
+.table-hover > tbody > tr > th.success:hover,
+.table-hover > tbody > tr.success:hover > td,
+.table-hover > tbody > tr:hover > .success,
+.table-hover > tbody > tr.success:hover > th {
+ background-color: #d0e9c6;
+}
+.table > thead > tr > td.info,
+.table > tbody > tr > td.info,
+.table > tfoot > tr > td.info,
+.table > thead > tr > th.info,
+.table > tbody > tr > th.info,
+.table > tfoot > tr > th.info,
+.table > thead > tr.info > td,
+.table > tbody > tr.info > td,
+.table > tfoot > tr.info > td,
+.table > thead > tr.info > th,
+.table > tbody > tr.info > th,
+.table > tfoot > tr.info > th {
+ background-color: #d9edf7;
+}
+.table-hover > tbody > tr > td.info:hover,
+.table-hover > tbody > tr > th.info:hover,
+.table-hover > tbody > tr.info:hover > td,
+.table-hover > tbody > tr:hover > .info,
+.table-hover > tbody > tr.info:hover > th {
+ background-color: #c4e3f3;
+}
+.table > thead > tr > td.warning,
+.table > tbody > tr > td.warning,
+.table > tfoot > tr > td.warning,
+.table > thead > tr > th.warning,
+.table > tbody > tr > th.warning,
+.table > tfoot > tr > th.warning,
+.table > thead > tr.warning > td,
+.table > tbody > tr.warning > td,
+.table > tfoot > tr.warning > td,
+.table > thead > tr.warning > th,
+.table > tbody > tr.warning > th,
+.table > tfoot > tr.warning > th {
+ background-color: #fcf8e3;
+}
+.table-hover > tbody > tr > td.warning:hover,
+.table-hover > tbody > tr > th.warning:hover,
+.table-hover > tbody > tr.warning:hover > td,
+.table-hover > tbody > tr:hover > .warning,
+.table-hover > tbody > tr.warning:hover > th {
+ background-color: #faf2cc;
+}
+.table > thead > tr > td.danger,
+.table > tbody > tr > td.danger,
+.table > tfoot > tr > td.danger,
+.table > thead > tr > th.danger,
+.table > tbody > tr > th.danger,
+.table > tfoot > tr > th.danger,
+.table > thead > tr.danger > td,
+.table > tbody > tr.danger > td,
+.table > tfoot > tr.danger > td,
+.table > thead > tr.danger > th,
+.table > tbody > tr.danger > th,
+.table > tfoot > tr.danger > th {
+ background-color: #f2dede;
+}
+.table-hover > tbody > tr > td.danger:hover,
+.table-hover > tbody > tr > th.danger:hover,
+.table-hover > tbody > tr.danger:hover > td,
+.table-hover > tbody > tr:hover > .danger,
+.table-hover > tbody > tr.danger:hover > th {
+ background-color: #ebcccc;
+}
+@media screen and (max-width: 767px) {
+ .table-responsive {
+ width: 100%;
+ margin-bottom: 15px;
+ overflow-x: auto;
+ overflow-y: hidden;
+ -webkit-overflow-scrolling: touch;
+ -ms-overflow-style: -ms-autohiding-scrollbar;
+ border: 1px solid #ddd;
+ }
+ .table-responsive > .table {
+ margin-bottom: 0;
+ }
+ .table-responsive > .table > thead > tr > th,
+ .table-responsive > .table > tbody > tr > th,
+ .table-responsive > .table > tfoot > tr > th,
+ .table-responsive > .table > thead > tr > td,
+ .table-responsive > .table > tbody > tr > td,
+ .table-responsive > .table > tfoot > tr > td {
+ white-space: nowrap;
+ }
+ .table-responsive > .table-bordered {
+ border: 0;
+ }
+ .table-responsive > .table-bordered > thead > tr > th:first-child,
+ .table-responsive > .table-bordered > tbody > tr > th:first-child,
+ .table-responsive > .table-bordered > tfoot > tr > th:first-child,
+ .table-responsive > .table-bordered > thead > tr > td:first-child,
+ .table-responsive > .table-bordered > tbody > tr > td:first-child,
+ .table-responsive > .table-bordered > tfoot > tr > td:first-child {
+ border-left: 0;
+ }
+ .table-responsive > .table-bordered > thead > tr > th:last-child,
+ .table-responsive > .table-bordered > tbody > tr > th:last-child,
+ .table-responsive > .table-bordered > tfoot > tr > th:last-child,
+ .table-responsive > .table-bordered > thead > tr > td:last-child,
+ .table-responsive > .table-bordered > tbody > tr > td:last-child,
+ .table-responsive > .table-bordered > tfoot > tr > td:last-child {
+ border-right: 0;
+ }
+ .table-responsive > .table-bordered > tbody > tr:last-child > th,
+ .table-responsive > .table-bordered > tfoot > tr:last-child > th,
+ .table-responsive > .table-bordered > tbody > tr:last-child > td,
+ .table-responsive > .table-bordered > tfoot > tr:last-child > td {
+ border-bottom: 0;
+ }
+}
+fieldset {
+ min-width: 0;
+ padding: 0;
+ margin: 0;
+ border: 0;
+}
+legend {
+ display: block;
+ width: 100%;
+ padding: 0;
+ margin-bottom: 20px;
+ font-size: 21px;
+ line-height: inherit;
+ color: #333;
+ border: 0;
+ border-bottom: 1px solid #e5e5e5;
+}
+label {
+ display: inline-block;
+ max-width: 100%;
+ margin-bottom: 5px;
+ font-weight: bold;
+}
+input[type="search"] {
+ -webkit-box-sizing: border-box;
+ -moz-box-sizing: border-box;
+ box-sizing: border-box;
+}
+input[type="radio"],
+input[type="checkbox"] {
+ margin: 4px 0 0;
+ margin-top: 1px \9;
+ line-height: normal;
+}
+input[type="file"] {
+ display: block;
+}
+input[type="range"] {
+ display: block;
+ width: 100%;
+}
+select[multiple],
+select[size] {
+ height: auto;
+}
+input[type="file"]:focus,
+input[type="radio"]:focus,
+input[type="checkbox"]:focus {
+ outline: thin dotted;
+ outline: 5px auto -webkit-focus-ring-color;
+ outline-offset: -2px;
+}
+output {
+ display: block;
+ padding-top: 7px;
+ font-size: 14px;
+ line-height: 1.42857143;
+ color: #555;
+}
+.form-control {
+ display: block;
+ width: 100%;
+ height: 34px;
+ padding: 6px 12px;
+ font-size: 14px;
+ line-height: 1.42857143;
+ color: #555;
+ background-color: #fff;
+ background-image: none;
+ border: 1px solid #ccc;
+ border-radius: 4px;
+ -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075);
+ box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075);
+ -webkit-transition: border-color ease-in-out .15s, -webkit-box-shadow ease-in-out .15s;
+ -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
+ transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
+}
+.form-control:focus {
+ border-color: #66afe9;
+ outline: 0;
+ -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, .6);
+ box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, .6);
+}
+.form-control::-moz-placeholder {
+ color: #777;
+ opacity: 1;
+}
+.form-control:-ms-input-placeholder {
+ color: #777;
+}
+.form-control::-webkit-input-placeholder {
+ color: #777;
+}
+.form-control[disabled],
+.form-control[readonly],
+fieldset[disabled] .form-control {
+ cursor: not-allowed;
+ background-color: #eee;
+ opacity: 1;
+}
+textarea.form-control {
+ height: auto;
+}
+input[type="search"] {
+ -webkit-appearance: none;
+}
+input[type="date"],
+input[type="time"],
+input[type="datetime-local"],
+input[type="month"] {
+ line-height: 34px;
+ line-height: 1.42857143 \0;
+}
+input[type="date"].input-sm,
+input[type="time"].input-sm,
+input[type="datetime-local"].input-sm,
+input[type="month"].input-sm {
+ line-height: 30px;
+}
+input[type="date"].input-lg,
+input[type="time"].input-lg,
+input[type="datetime-local"].input-lg,
+input[type="month"].input-lg {
+ line-height: 46px;
+}
+.form-group {
+ margin-bottom: 15px;
+}
+.radio,
+.checkbox {
+ position: relative;
+ display: block;
+ min-height: 20px;
+ margin-top: 10px;
+ margin-bottom: 10px;
+}
+.radio label,
+.checkbox label {
+ padding-left: 20px;
+ margin-bottom: 0;
+ font-weight: normal;
+ cursor: pointer;
+}
+.radio input[type="radio"],
+.radio-inline input[type="radio"],
+.checkbox input[type="checkbox"],
+.checkbox-inline input[type="checkbox"] {
+ position: absolute;
+ margin-top: 4px \9;
+ margin-left: -20px;
+}
+.radio + .radio,
+.checkbox + .checkbox {
+ margin-top: -5px;
+}
+.radio-inline,
+.checkbox-inline {
+ display: inline-block;
+ padding-left: 20px;
+ margin-bottom: 0;
+ font-weight: normal;
+ vertical-align: middle;
+ cursor: pointer;
+}
+.radio-inline + .radio-inline,
+.checkbox-inline + .checkbox-inline {
+ margin-top: 0;
+ margin-left: 10px;
+}
+input[type="radio"][disabled],
+input[type="checkbox"][disabled],
+input[type="radio"].disabled,
+input[type="checkbox"].disabled,
+fieldset[disabled] input[type="radio"],
+fieldset[disabled] input[type="checkbox"] {
+ cursor: not-allowed;
+}
+.radio-inline.disabled,
+.checkbox-inline.disabled,
+fieldset[disabled] .radio-inline,
+fieldset[disabled] .checkbox-inline {
+ cursor: not-allowed;
+}
+.radio.disabled label,
+.checkbox.disabled label,
+fieldset[disabled] .radio label,
+fieldset[disabled] .checkbox label {
+ cursor: not-allowed;
+}
+.form-control-static {
+ padding-top: 7px;
+ padding-bottom: 7px;
+ margin-bottom: 0;
+}
+.form-control-static.input-lg,
+.form-control-static.input-sm {
+ padding-right: 0;
+ padding-left: 0;
+}
+.input-sm,
+.form-horizontal .form-group-sm .form-control {
+ height: 30px;
+ padding: 5px 10px;
+ font-size: 12px;
+ line-height: 1.5;
+ border-radius: 3px;
+}
+select.input-sm {
+ height: 30px;
+ line-height: 30px;
+}
+textarea.input-sm,
+select[multiple].input-sm {
+ height: auto;
+}
+.input-lg,
+.form-horizontal .form-group-lg .form-control {
+ height: 46px;
+ padding: 10px 16px;
+ font-size: 18px;
+ line-height: 1.33;
+ border-radius: 6px;
+}
+select.input-lg {
+ height: 46px;
+ line-height: 46px;
+}
+textarea.input-lg,
+select[multiple].input-lg {
+ height: auto;
+}
+.has-feedback {
+ position: relative;
+}
+.has-feedback .form-control {
+ padding-right: 42.5px;
+}
+.form-control-feedback {
+ position: absolute;
+ top: 25px;
+ right: 0;
+ z-index: 2;
+ display: block;
+ width: 34px;
+ height: 34px;
+ line-height: 34px;
+ text-align: center;
+}
+.input-lg + .form-control-feedback {
+ width: 46px;
+ height: 46px;
+ line-height: 46px;
+}
+.input-sm + .form-control-feedback {
+ width: 30px;
+ height: 30px;
+ line-height: 30px;
+}
+.has-success .help-block,
+.has-success .control-label,
+.has-success .radio,
+.has-success .checkbox,
+.has-success .radio-inline,
+.has-success .checkbox-inline {
+ color: #3c763d;
+}
+.has-success .form-control {
+ border-color: #3c763d;
+ -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075);
+ box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075);
+}
+.has-success .form-control:focus {
+ border-color: #2b542c;
+ -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #67b168;
+ box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #67b168;
+}
+.has-success .input-group-addon {
+ color: #3c763d;
+ background-color: #dff0d8;
+ border-color: #3c763d;
+}
+.has-success .form-control-feedback {
+ color: #3c763d;
+}
+.has-warning .help-block,
+.has-warning .control-label,
+.has-warning .radio,
+.has-warning .checkbox,
+.has-warning .radio-inline,
+.has-warning .checkbox-inline {
+ color: #8a6d3b;
+}
+.has-warning .form-control {
+ border-color: #8a6d3b;
+ -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075);
+ box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075);
+}
+.has-warning .form-control:focus {
+ border-color: #66512c;
+ -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #c0a16b;
+ box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #c0a16b;
+}
+.has-warning .input-group-addon {
+ color: #8a6d3b;
+ background-color: #fcf8e3;
+ border-color: #8a6d3b;
+}
+.has-warning .form-control-feedback {
+ color: #8a6d3b;
+}
+.has-error .help-block,
+.has-error .control-label,
+.has-error .radio,
+.has-error .checkbox,
+.has-error .radio-inline,
+.has-error .checkbox-inline {
+ color: #a94442;
+}
+.has-error .form-control {
+ border-color: #a94442;
+ -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075);
+ box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075);
+}
+.has-error .form-control:focus {
+ border-color: #843534;
+ -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #ce8483;
+ box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #ce8483;
+}
+.has-error .input-group-addon {
+ color: #a94442;
+ background-color: #f2dede;
+ border-color: #a94442;
+}
+.has-error .form-control-feedback {
+ color: #a94442;
+}
+.has-feedback label.sr-only ~ .form-control-feedback {
+ top: 0;
+}
+.help-block {
+ display: block;
+ margin-top: 5px;
+ margin-bottom: 10px;
+ color: #737373;
+}
+@media (min-width: 768px) {
+ .form-inline .form-group {
+ display: inline-block;
+ margin-bottom: 0;
+ vertical-align: middle;
+ }
+ .form-inline .form-control {
+ display: inline-block;
+ width: auto;
+ vertical-align: middle;
+ }
+ .form-inline .input-group {
+ display: inline-table;
+ vertical-align: middle;
+ }
+ .form-inline .input-group .input-group-addon,
+ .form-inline .input-group .input-group-btn,
+ .form-inline .input-group .form-control {
+ width: auto;
+ }
+ .form-inline .input-group > .form-control {
+ width: 100%;
+ }
+ .form-inline .control-label {
+ margin-bottom: 0;
+ vertical-align: middle;
+ }
+ .form-inline .radio,
+ .form-inline .checkbox {
+ display: inline-block;
+ margin-top: 0;
+ margin-bottom: 0;
+ vertical-align: middle;
+ }
+ .form-inline .radio label,
+ .form-inline .checkbox label {
+ padding-left: 0;
+ }
+ .form-inline .radio input[type="radio"],
+ .form-inline .checkbox input[type="checkbox"] {
+ position: relative;
+ margin-left: 0;
+ }
+ .form-inline .has-feedback .form-control-feedback {
+ top: 0;
+ }
+}
+.form-horizontal .radio,
+.form-horizontal .checkbox,
+.form-horizontal .radio-inline,
+.form-horizontal .checkbox-inline {
+ padding-top: 7px;
+ margin-top: 0;
+ margin-bottom: 0;
+}
+.form-horizontal .radio,
+.form-horizontal .checkbox {
+ min-height: 27px;
+}
+.form-horizontal .form-group {
+ margin-right: -15px;
+ margin-left: -15px;
+}
+@media (min-width: 768px) {
+ .form-horizontal .control-label {
+ padding-top: 7px;
+ margin-bottom: 0;
+ text-align: right;
+ }
+}
+.form-horizontal .has-feedback .form-control-feedback {
+ top: 0;
+ right: 15px;
+}
+@media (min-width: 768px) {
+ .form-horizontal .form-group-lg .control-label {
+ padding-top: 14.3px;
+ }
+}
+@media (min-width: 768px) {
+ .form-horizontal .form-group-sm .control-label {
+ padding-top: 6px;
+ }
+}
+.btn {
+ display: inline-block;
+ padding: 6px 12px;
+ margin-bottom: 0;
+ font-size: 14px;
+ font-weight: normal;
+ line-height: 1.42857143;
+ text-align: center;
+ white-space: nowrap;
+ vertical-align: middle;
+ cursor: pointer;
+ -webkit-user-select: none;
+ -moz-user-select: none;
+ -ms-user-select: none;
+ user-select: none;
+ background-image: none;
+ border: 1px solid transparent;
+ border-radius: 4px;
+}
+.btn:focus,
+.btn:active:focus,
+.btn.active:focus {
+ outline: thin dotted;
+ outline: 5px auto -webkit-focus-ring-color;
+ outline-offset: -2px;
+}
+.btn:hover,
+.btn:focus {
+ color: #333;
+ text-decoration: none;
+}
+.btn:active,
+.btn.active {
+ background-image: none;
+ outline: 0;
+ -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, .125);
+ box-shadow: inset 0 3px 5px rgba(0, 0, 0, .125);
+}
+.btn.disabled,
+.btn[disabled],
+fieldset[disabled] .btn {
+ pointer-events: none;
+ cursor: not-allowed;
+ filter: alpha(opacity=65);
+ -webkit-box-shadow: none;
+ box-shadow: none;
+ opacity: .65;
+}
+.btn-default {
+ color: #333;
+ background-color: #fff;
+ border-color: #ccc;
+}
+.btn-default:hover,
+.btn-default:focus,
+.btn-default:active,
+.btn-default.active,
+.open > .dropdown-toggle.btn-default {
+ color: #333;
+ background-color: #e6e6e6;
+ border-color: #adadad;
+}
+.btn-default:active,
+.btn-default.active,
+.open > .dropdown-toggle.btn-default {
+ background-image: none;
+}
+.btn-default.disabled,
+.btn-default[disabled],
+fieldset[disabled] .btn-default,
+.btn-default.disabled:hover,
+.btn-default[disabled]:hover,
+fieldset[disabled] .btn-default:hover,
+.btn-default.disabled:focus,
+.btn-default[disabled]:focus,
+fieldset[disabled] .btn-default:focus,
+.btn-default.disabled:active,
+.btn-default[disabled]:active,
+fieldset[disabled] .btn-default:active,
+.btn-default.disabled.active,
+.btn-default[disabled].active,
+fieldset[disabled] .btn-default.active {
+ background-color: #fff;
+ border-color: #ccc;
+}
+.btn-default .badge {
+ color: #fff;
+ background-color: #333;
+}
+.btn-primary {
+ color: #fff;
+ background-color: #428bca;
+ border-color: #357ebd;
+}
+.btn-primary:hover,
+.btn-primary:focus,
+.btn-primary:active,
+.btn-primary.active,
+.open > .dropdown-toggle.btn-primary {
+ color: #fff;
+ background-color: #3071a9;
+ border-color: #285e8e;
+}
+.btn-primary:active,
+.btn-primary.active,
+.open > .dropdown-toggle.btn-primary {
+ background-image: none;
+}
+.btn-primary.disabled,
+.btn-primary[disabled],
+fieldset[disabled] .btn-primary,
+.btn-primary.disabled:hover,
+.btn-primary[disabled]:hover,
+fieldset[disabled] .btn-primary:hover,
+.btn-primary.disabled:focus,
+.btn-primary[disabled]:focus,
+fieldset[disabled] .btn-primary:focus,
+.btn-primary.disabled:active,
+.btn-primary[disabled]:active,
+fieldset[disabled] .btn-primary:active,
+.btn-primary.disabled.active,
+.btn-primary[disabled].active,
+fieldset[disabled] .btn-primary.active {
+ background-color: #428bca;
+ border-color: #357ebd;
+}
+.btn-primary .badge {
+ color: #428bca;
+ background-color: #fff;
+}
+.btn-success {
+ color: #fff;
+ background-color: #5cb85c;
+ border-color: #4cae4c;
+}
+.btn-success:hover,
+.btn-success:focus,
+.btn-success:active,
+.btn-success.active,
+.open > .dropdown-toggle.btn-success {
+ color: #fff;
+ background-color: #449d44;
+ border-color: #398439;
+}
+.btn-success:active,
+.btn-success.active,
+.open > .dropdown-toggle.btn-success {
+ background-image: none;
+}
+.btn-success.disabled,
+.btn-success[disabled],
+fieldset[disabled] .btn-success,
+.btn-success.disabled:hover,
+.btn-success[disabled]:hover,
+fieldset[disabled] .btn-success:hover,
+.btn-success.disabled:focus,
+.btn-success[disabled]:focus,
+fieldset[disabled] .btn-success:focus,
+.btn-success.disabled:active,
+.btn-success[disabled]:active,
+fieldset[disabled] .btn-success:active,
+.btn-success.disabled.active,
+.btn-success[disabled].active,
+fieldset[disabled] .btn-success.active {
+ background-color: #5cb85c;
+ border-color: #4cae4c;
+}
+.btn-success .badge {
+ color: #5cb85c;
+ background-color: #fff;
+}
+.btn-info {
+ color: #fff;
+ background-color: #5bc0de;
+ border-color: #46b8da;
+}
+.btn-info:hover,
+.btn-info:focus,
+.btn-info:active,
+.btn-info.active,
+.open > .dropdown-toggle.btn-info {
+ color: #fff;
+ background-color: #31b0d5;
+ border-color: #269abc;
+}
+.btn-info:active,
+.btn-info.active,
+.open > .dropdown-toggle.btn-info {
+ background-image: none;
+}
+.btn-info.disabled,
+.btn-info[disabled],
+fieldset[disabled] .btn-info,
+.btn-info.disabled:hover,
+.btn-info[disabled]:hover,
+fieldset[disabled] .btn-info:hover,
+.btn-info.disabled:focus,
+.btn-info[disabled]:focus,
+fieldset[disabled] .btn-info:focus,
+.btn-info.disabled:active,
+.btn-info[disabled]:active,
+fieldset[disabled] .btn-info:active,
+.btn-info.disabled.active,
+.btn-info[disabled].active,
+fieldset[disabled] .btn-info.active {
+ background-color: #5bc0de;
+ border-color: #46b8da;
+}
+.btn-info .badge {
+ color: #5bc0de;
+ background-color: #fff;
+}
+.btn-warning {
+ color: #fff;
+ background-color: #f0ad4e;
+ border-color: #eea236;
+}
+.btn-warning:hover,
+.btn-warning:focus,
+.btn-warning:active,
+.btn-warning.active,
+.open > .dropdown-toggle.btn-warning {
+ color: #fff;
+ background-color: #ec971f;
+ border-color: #d58512;
+}
+.btn-warning:active,
+.btn-warning.active,
+.open > .dropdown-toggle.btn-warning {
+ background-image: none;
+}
+.btn-warning.disabled,
+.btn-warning[disabled],
+fieldset[disabled] .btn-warning,
+.btn-warning.disabled:hover,
+.btn-warning[disabled]:hover,
+fieldset[disabled] .btn-warning:hover,
+.btn-warning.disabled:focus,
+.btn-warning[disabled]:focus,
+fieldset[disabled] .btn-warning:focus,
+.btn-warning.disabled:active,
+.btn-warning[disabled]:active,
+fieldset[disabled] .btn-warning:active,
+.btn-warning.disabled.active,
+.btn-warning[disabled].active,
+fieldset[disabled] .btn-warning.active {
+ background-color: #f0ad4e;
+ border-color: #eea236;
+}
+.btn-warning .badge {
+ color: #f0ad4e;
+ background-color: #fff;
+}
+.btn-danger {
+ color: #fff;
+ background-color: #d9534f;
+ border-color: #d43f3a;
+}
+.btn-danger:hover,
+.btn-danger:focus,
+.btn-danger:active,
+.btn-danger.active,
+.open > .dropdown-toggle.btn-danger {
+ color: #fff;
+ background-color: #c9302c;
+ border-color: #ac2925;
+}
+.btn-danger:active,
+.btn-danger.active,
+.open > .dropdown-toggle.btn-danger {
+ background-image: none;
+}
+.btn-danger.disabled,
+.btn-danger[disabled],
+fieldset[disabled] .btn-danger,
+.btn-danger.disabled:hover,
+.btn-danger[disabled]:hover,
+fieldset[disabled] .btn-danger:hover,
+.btn-danger.disabled:focus,
+.btn-danger[disabled]:focus,
+fieldset[disabled] .btn-danger:focus,
+.btn-danger.disabled:active,
+.btn-danger[disabled]:active,
+fieldset[disabled] .btn-danger:active,
+.btn-danger.disabled.active,
+.btn-danger[disabled].active,
+fieldset[disabled] .btn-danger.active {
+ background-color: #d9534f;
+ border-color: #d43f3a;
+}
+.btn-danger .badge {
+ color: #d9534f;
+ background-color: #fff;
+}
+.btn-link {
+ font-weight: normal;
+ color: #428bca;
+ cursor: pointer;
+ border-radius: 0;
+}
+.btn-link,
+.btn-link:active,
+.btn-link[disabled],
+fieldset[disabled] .btn-link {
+ background-color: transparent;
+ -webkit-box-shadow: none;
+ box-shadow: none;
+}
+.btn-link,
+.btn-link:hover,
+.btn-link:focus,
+.btn-link:active {
+ border-color: transparent;
+}
+.btn-link:hover,
+.btn-link:focus {
+ color: #2a6496;
+ text-decoration: underline;
+ background-color: transparent;
+}
+.btn-link[disabled]:hover,
+fieldset[disabled] .btn-link:hover,
+.btn-link[disabled]:focus,
+fieldset[disabled] .btn-link:focus {
+ color: #777;
+ text-decoration: none;
+}
+.btn-lg,
+.btn-group-lg > .btn {
+ padding: 10px 16px;
+ font-size: 18px;
+ line-height: 1.33;
+ border-radius: 6px;
+}
+.btn-sm,
+.btn-group-sm > .btn {
+ padding: 5px 10px;
+ font-size: 12px;
+ line-height: 1.5;
+ border-radius: 3px;
+}
+.btn-xs,
+.btn-group-xs > .btn {
+ padding: 1px 5px;
+ font-size: 12px;
+ line-height: 1.5;
+ border-radius: 3px;
+}
+.btn-block {
+ display: block;
+ width: 100%;
+}
+.btn-block + .btn-block {
+ margin-top: 5px;
+}
+input[type="submit"].btn-block,
+input[type="reset"].btn-block,
+input[type="button"].btn-block {
+ width: 100%;
+}
+.fade {
+ opacity: 0;
+ -webkit-transition: opacity .15s linear;
+ -o-transition: opacity .15s linear;
+ transition: opacity .15s linear;
+}
+.fade.in {
+ opacity: 1;
+}
+.collapse {
+ display: none;
+}
+.collapse.in {
+ display: block;
+}
+tr.collapse.in {
+ display: table-row;
+}
+tbody.collapse.in {
+ display: table-row-group;
+}
+.collapsing {
+ position: relative;
+ height: 0;
+ overflow: hidden;
+ -webkit-transition: height .35s ease;
+ -o-transition: height .35s ease;
+ transition: height .35s ease;
+}
+.caret {
+ display: inline-block;
+ width: 0;
+ height: 0;
+ margin-left: 2px;
+ vertical-align: middle;
+ border-top: 4px solid;
+ border-right: 4px solid transparent;
+ border-left: 4px solid transparent;
+}
+.dropdown {
+ position: relative;
+}
+.dropdown-toggle:focus {
+ outline: 0;
+}
+.dropdown-menu {
+ position: absolute;
+ top: 100%;
+ left: 0;
+ z-index: 1000;
+ display: none;
+ float: left;
+ min-width: 160px;
+ padding: 5px 0;
+ margin: 2px 0 0;
+ font-size: 14px;
+ text-align: left;
+ list-style: none;
+ background-color: #fff;
+ -webkit-background-clip: padding-box;
+ background-clip: padding-box;
+ border: 1px solid #ccc;
+ border: 1px solid rgba(0, 0, 0, .15);
+ border-radius: 4px;
+ -webkit-box-shadow: 0 6px 12px rgba(0, 0, 0, .175);
+ box-shadow: 0 6px 12px rgba(0, 0, 0, .175);
+}
+.dropdown-menu.pull-right {
+ right: 0;
+ left: auto;
+}
+.dropdown-menu .divider {
+ height: 1px;
+ margin: 9px 0;
+ overflow: hidden;
+ background-color: #e5e5e5;
+}
+.dropdown-menu > li > a {
+ display: block;
+ padding: 3px 20px;
+ clear: both;
+ font-weight: normal;
+ line-height: 1.42857143;
+ color: #333;
+ white-space: nowrap;
+}
+.dropdown-menu > li > a:hover,
+.dropdown-menu > li > a:focus {
+ color: #262626;
+ text-decoration: none;
+ background-color: #f5f5f5;
+}
+.dropdown-menu > .active > a,
+.dropdown-menu > .active > a:hover,
+.dropdown-menu > .active > a:focus {
+ color: #fff;
+ text-decoration: none;
+ background-color: #428bca;
+ outline: 0;
+}
+.dropdown-menu > .disabled > a,
+.dropdown-menu > .disabled > a:hover,
+.dropdown-menu > .disabled > a:focus {
+ color: #777;
+}
+.dropdown-menu > .disabled > a:hover,
+.dropdown-menu > .disabled > a:focus {
+ text-decoration: none;
+ cursor: not-allowed;
+ background-color: transparent;
+ background-image: none;
+ filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);
+}
+.open > .dropdown-menu {
+ display: block;
+}
+.open > a {
+ outline: 0;
+}
+.dropdown-menu-right {
+ right: 0;
+ left: auto;
+}
+.dropdown-menu-left {
+ right: auto;
+ left: 0;
+}
+.dropdown-header {
+ display: block;
+ padding: 3px 20px;
+ font-size: 12px;
+ line-height: 1.42857143;
+ color: #777;
+ white-space: nowrap;
+}
+.dropdown-backdrop {
+ position: fixed;
+ top: 0;
+ right: 0;
+ bottom: 0;
+ left: 0;
+ z-index: 990;
+}
+.pull-right > .dropdown-menu {
+ right: 0;
+ left: auto;
+}
+.dropup .caret,
+.navbar-fixed-bottom .dropdown .caret {
+ content: "";
+ border-top: 0;
+ border-bottom: 4px solid;
+}
+.dropup .dropdown-menu,
+.navbar-fixed-bottom .dropdown .dropdown-menu {
+ top: auto;
+ bottom: 100%;
+ margin-bottom: 1px;
+}
+@media (min-width: 862px) {
+ .navbar-right .dropdown-menu {
+ right: 0;
+ left: auto;
+ }
+ .navbar-right .dropdown-menu-left {
+ right: auto;
+ left: 0;
+ }
+}
+.btn-group,
+.btn-group-vertical {
+ position: relative;
+ display: inline-block;
+ vertical-align: middle;
+}
+.btn-group > .btn,
+.btn-group-vertical > .btn {
+ position: relative;
+ float: left;
+}
+.btn-group > .btn:hover,
+.btn-group-vertical > .btn:hover,
+.btn-group > .btn:focus,
+.btn-group-vertical > .btn:focus,
+.btn-group > .btn:active,
+.btn-group-vertical > .btn:active,
+.btn-group > .btn.active,
+.btn-group-vertical > .btn.active {
+ z-index: 2;
+}
+.btn-group > .btn:focus,
+.btn-group-vertical > .btn:focus {
+ outline: 0;
+}
+.btn-group .btn + .btn,
+.btn-group .btn + .btn-group,
+.btn-group .btn-group + .btn,
+.btn-group .btn-group + .btn-group {
+ margin-left: -1px;
+}
+.btn-toolbar {
+ margin-left: -5px;
+}
+.btn-toolbar .btn-group,
+.btn-toolbar .input-group {
+ float: left;
+}
+.btn-toolbar > .btn,
+.btn-toolbar > .btn-group,
+.btn-toolbar > .input-group {
+ margin-left: 5px;
+}
+.btn-group > .btn:not(:first-child):not(:last-child):not(.dropdown-toggle) {
+ border-radius: 0;
+}
+.btn-group > .btn:first-child {
+ margin-left: 0;
+}
+.btn-group > .btn:first-child:not(:last-child):not(.dropdown-toggle) {
+ border-top-right-radius: 0;
+ border-bottom-right-radius: 0;
+}
+.btn-group > .btn:last-child:not(:first-child),
+.btn-group > .dropdown-toggle:not(:first-child) {
+ border-top-left-radius: 0;
+ border-bottom-left-radius: 0;
+}
+.btn-group > .btn-group {
+ float: left;
+}
+.btn-group > .btn-group:not(:first-child):not(:last-child) > .btn {
+ border-radius: 0;
+}
+.btn-group > .btn-group:first-child > .btn:last-child,
+.btn-group > .btn-group:first-child > .dropdown-toggle {
+ border-top-right-radius: 0;
+ border-bottom-right-radius: 0;
+}
+.btn-group > .btn-group:last-child > .btn:first-child {
+ border-top-left-radius: 0;
+ border-bottom-left-radius: 0;
+}
+.btn-group .dropdown-toggle:active,
+.btn-group.open .dropdown-toggle {
+ outline: 0;
+}
+.btn-group > .btn + .dropdown-toggle {
+ padding-right: 8px;
+ padding-left: 8px;
+}
+.btn-group > .btn-lg + .dropdown-toggle {
+ padding-right: 12px;
+ padding-left: 12px;
+}
+.btn-group.open .dropdown-toggle {
+ -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, .125);
+ box-shadow: inset 0 3px 5px rgba(0, 0, 0, .125);
+}
+.btn-group.open .dropdown-toggle.btn-link {
+ -webkit-box-shadow: none;
+ box-shadow: none;
+}
+.btn .caret {
+ margin-left: 0;
+}
+.btn-lg .caret {
+ border-width: 5px 5px 0;
+ border-bottom-width: 0;
+}
+.dropup .btn-lg .caret {
+ border-width: 0 5px 5px;
+}
+.btn-group-vertical > .btn,
+.btn-group-vertical > .btn-group,
+.btn-group-vertical > .btn-group > .btn {
+ display: block;
+ float: none;
+ width: 100%;
+ max-width: 100%;
+}
+.btn-group-vertical > .btn-group > .btn {
+ float: none;
+}
+.btn-group-vertical > .btn + .btn,
+.btn-group-vertical > .btn + .btn-group,
+.btn-group-vertical > .btn-group + .btn,
+.btn-group-vertical > .btn-group + .btn-group {
+ margin-top: -1px;
+ margin-left: 0;
+}
+.btn-group-vertical > .btn:not(:first-child):not(:last-child) {
+ border-radius: 0;
+}
+.btn-group-vertical > .btn:first-child:not(:last-child) {
+ border-top-right-radius: 4px;
+ border-bottom-right-radius: 0;
+ border-bottom-left-radius: 0;
+}
+.btn-group-vertical > .btn:last-child:not(:first-child) {
+ border-top-left-radius: 0;
+ border-top-right-radius: 0;
+ border-bottom-left-radius: 4px;
+}
+.btn-group-vertical > .btn-group:not(:first-child):not(:last-child) > .btn {
+ border-radius: 0;
+}
+.btn-group-vertical > .btn-group:first-child:not(:last-child) > .btn:last-child,
+.btn-group-vertical > .btn-group:first-child:not(:last-child) > .dropdown-toggle {
+ border-bottom-right-radius: 0;
+ border-bottom-left-radius: 0;
+}
+.btn-group-vertical > .btn-group:last-child:not(:first-child) > .btn:first-child {
+ border-top-left-radius: 0;
+ border-top-right-radius: 0;
+}
+.btn-group-justified {
+ display: table;
+ width: 100%;
+ table-layout: fixed;
+ border-collapse: separate;
+}
+.btn-group-justified > .btn,
+.btn-group-justified > .btn-group {
+ display: table-cell;
+ float: none;
+ width: 1%;
+}
+.btn-group-justified > .btn-group .btn {
+ width: 100%;
+}
+.btn-group-justified > .btn-group .dropdown-menu {
+ left: auto;
+}
+[data-toggle="buttons"] > .btn > input[type="radio"],
+[data-toggle="buttons"] > .btn > input[type="checkbox"] {
+ position: absolute;
+ z-index: -1;
+ filter: alpha(opacity=0);
+ opacity: 0;
+}
+.input-group {
+ position: relative;
+ display: table;
+ border-collapse: separate;
+}
+.input-group[class*="col-"] {
+ float: none;
+ padding-right: 0;
+ padding-left: 0;
+}
+.input-group .form-control {
+ position: relative;
+ z-index: 2;
+ float: left;
+ width: 100%;
+ margin-bottom: 0;
+}
+.input-group-lg > .form-control,
+.input-group-lg > .input-group-addon,
+.input-group-lg > .input-group-btn > .btn {
+ height: 46px;
+ padding: 10px 16px;
+ font-size: 18px;
+ line-height: 1.33;
+ border-radius: 6px;
+}
+select.input-group-lg > .form-control,
+select.input-group-lg > .input-group-addon,
+select.input-group-lg > .input-group-btn > .btn {
+ height: 46px;
+ line-height: 46px;
+}
+textarea.input-group-lg > .form-control,
+textarea.input-group-lg > .input-group-addon,
+textarea.input-group-lg > .input-group-btn > .btn,
+select[multiple].input-group-lg > .form-control,
+select[multiple].input-group-lg > .input-group-addon,
+select[multiple].input-group-lg > .input-group-btn > .btn {
+ height: auto;
+}
+.input-group-sm > .form-control,
+.input-group-sm > .input-group-addon,
+.input-group-sm > .input-group-btn > .btn {
+ height: 30px;
+ padding: 5px 10px;
+ font-size: 12px;
+ line-height: 1.5;
+ border-radius: 3px;
+}
+select.input-group-sm > .form-control,
+select.input-group-sm > .input-group-addon,
+select.input-group-sm > .input-group-btn > .btn {
+ height: 30px;
+ line-height: 30px;
+}
+textarea.input-group-sm > .form-control,
+textarea.input-group-sm > .input-group-addon,
+textarea.input-group-sm > .input-group-btn > .btn,
+select[multiple].input-group-sm > .form-control,
+select[multiple].input-group-sm > .input-group-addon,
+select[multiple].input-group-sm > .input-group-btn > .btn {
+ height: auto;
+}
+.input-group-addon,
+.input-group-btn,
+.input-group .form-control {
+ display: table-cell;
+}
+.input-group-addon:not(:first-child):not(:last-child),
+.input-group-btn:not(:first-child):not(:last-child),
+.input-group .form-control:not(:first-child):not(:last-child) {
+ border-radius: 0;
+}
+.input-group-addon,
+.input-group-btn {
+ width: 1%;
+ white-space: nowrap;
+ vertical-align: middle;
+}
+.input-group-addon {
+ padding: 6px 12px;
+ font-size: 14px;
+ font-weight: normal;
+ line-height: 1;
+ color: #555;
+ text-align: center;
+ background-color: #eee;
+ border: 1px solid #ccc;
+ border-radius: 4px;
+}
+.input-group-addon.input-sm {
+ padding: 5px 10px;
+ font-size: 12px;
+ border-radius: 3px;
+}
+.input-group-addon.input-lg {
+ padding: 10px 16px;
+ font-size: 18px;
+ border-radius: 6px;
+}
+.input-group-addon input[type="radio"],
+.input-group-addon input[type="checkbox"] {
+ margin-top: 0;
+}
+.input-group .form-control:first-child,
+.input-group-addon:first-child,
+.input-group-btn:first-child > .btn,
+.input-group-btn:first-child > .btn-group > .btn,
+.input-group-btn:first-child > .dropdown-toggle,
+.input-group-btn:last-child > .btn:not(:last-child):not(.dropdown-toggle),
+.input-group-btn:last-child > .btn-group:not(:last-child) > .btn {
+ border-top-right-radius: 0;
+ border-bottom-right-radius: 0;
+}
+.input-group-addon:first-child {
+ border-right: 0;
+}
+.input-group .form-control:last-child,
+.input-group-addon:last-child,
+.input-group-btn:last-child > .btn,
+.input-group-btn:last-child > .btn-group > .btn,
+.input-group-btn:last-child > .dropdown-toggle,
+.input-group-btn:first-child > .btn:not(:first-child),
+.input-group-btn:first-child > .btn-group:not(:first-child) > .btn {
+ border-top-left-radius: 0;
+ border-bottom-left-radius: 0;
+}
+.input-group-addon:last-child {
+ border-left: 0;
+}
+.input-group-btn {
+ position: relative;
+ font-size: 0;
+ white-space: nowrap;
+}
+.input-group-btn > .btn {
+ position: relative;
+}
+.input-group-btn > .btn + .btn {
+ margin-left: -1px;
+}
+.input-group-btn > .btn:hover,
+.input-group-btn > .btn:focus,
+.input-group-btn > .btn:active {
+ z-index: 2;
+}
+.input-group-btn:first-child > .btn,
+.input-group-btn:first-child > .btn-group {
+ margin-right: -1px;
+}
+.input-group-btn:last-child > .btn,
+.input-group-btn:last-child > .btn-group {
+ margin-left: -1px;
+}
+.nav {
+ padding-left: 0;
+ margin-bottom: 0;
+ list-style: none;
+}
+.nav > li {
+ position: relative;
+ display: block;
+}
+.nav > li > a {
+ position: relative;
+ display: block;
+ padding: 10px 15px;
+}
+.nav > li > a:hover,
+.nav > li > a:focus {
+ text-decoration: none;
+ background-color: #eee;
+}
+.nav > li.disabled > a {
+ color: #777;
+}
+.nav > li.disabled > a:hover,
+.nav > li.disabled > a:focus {
+ color: #777;
+ text-decoration: none;
+ cursor: not-allowed;
+ background-color: transparent;
+}
+.nav .open > a,
+.nav .open > a:hover,
+.nav .open > a:focus {
+ background-color: #eee;
+ border-color: #428bca;
+}
+.nav .nav-divider {
+ height: 1px;
+ margin: 9px 0;
+ overflow: hidden;
+ background-color: #e5e5e5;
+}
+.nav > li > a > img {
+ max-width: none;
+}
+.nav-tabs {
+ border-bottom: 1px solid #ddd;
+}
+.nav-tabs > li {
+ float: left;
+ margin-bottom: -1px;
+}
+.nav-tabs > li > a {
+ margin-right: 2px;
+ line-height: 1.42857143;
+ border: 1px solid transparent;
+ border-radius: 4px 4px 0 0;
+}
+.nav-tabs > li > a:hover {
+ border-color: #eee #eee #ddd;
+}
+.nav-tabs > li.active > a,
+.nav-tabs > li.active > a:hover,
+.nav-tabs > li.active > a:focus {
+ color: #555;
+ cursor: default;
+ background-color: #fff;
+ border: 1px solid #ddd;
+ border-bottom-color: transparent;
+}
+.nav-tabs.nav-justified {
+ width: 100%;
+ border-bottom: 0;
+}
+.nav-tabs.nav-justified > li {
+ float: none;
+}
+.nav-tabs.nav-justified > li > a {
+ margin-bottom: 5px;
+ text-align: center;
+}
+.nav-tabs.nav-justified > .dropdown .dropdown-menu {
+ top: auto;
+ left: auto;
+}
+@media (min-width: 768px) {
+ .nav-tabs.nav-justified > li {
+ display: table-cell;
+ width: 1%;
+ }
+ .nav-tabs.nav-justified > li > a {
+ margin-bottom: 0;
+ }
+}
+.nav-tabs.nav-justified > li > a {
+ margin-right: 0;
+ border-radius: 4px;
+}
+.nav-tabs.nav-justified > .active > a,
+.nav-tabs.nav-justified > .active > a:hover,
+.nav-tabs.nav-justified > .active > a:focus {
+ border: 1px solid #ddd;
+}
+@media (min-width: 768px) {
+ .nav-tabs.nav-justified > li > a {
+ border-bottom: 1px solid #ddd;
+ border-radius: 4px 4px 0 0;
+ }
+ .nav-tabs.nav-justified > .active > a,
+ .nav-tabs.nav-justified > .active > a:hover,
+ .nav-tabs.nav-justified > .active > a:focus {
+ border-bottom-color: #fff;
+ }
+}
+.nav-pills > li {
+ float: left;
+}
+.nav-pills > li > a {
+ border-radius: 4px;
+}
+.nav-pills > li + li {
+ margin-left: 2px;
+}
+.nav-pills > li.active > a,
+.nav-pills > li.active > a:hover,
+.nav-pills > li.active > a:focus {
+ color: #fff;
+ background-color: #428bca;
+}
+.nav-stacked > li {
+ float: none;
+}
+.nav-stacked > li + li {
+ margin-top: 2px;
+ margin-left: 0;
+}
+.nav-justified {
+ width: 100%;
+}
+.nav-justified > li {
+ float: none;
+}
+.nav-justified > li > a {
+ margin-bottom: 5px;
+ text-align: center;
+}
+.nav-justified > .dropdown .dropdown-menu {
+ top: auto;
+ left: auto;
+}
+@media (min-width: 768px) {
+ .nav-justified > li {
+ display: table-cell;
+ width: 1%;
+ }
+ .nav-justified > li > a {
+ margin-bottom: 0;
+ }
+}
+.nav-tabs-justified {
+ border-bottom: 0;
+}
+.nav-tabs-justified > li > a {
+ margin-right: 0;
+ border-radius: 4px;
+}
+.nav-tabs-justified > .active > a,
+.nav-tabs-justified > .active > a:hover,
+.nav-tabs-justified > .active > a:focus {
+ border: 1px solid #ddd;
+}
+@media (min-width: 768px) {
+ .nav-tabs-justified > li > a {
+ border-bottom: 1px solid #ddd;
+ border-radius: 4px 4px 0 0;
+ }
+ .nav-tabs-justified > .active > a,
+ .nav-tabs-justified > .active > a:hover,
+ .nav-tabs-justified > .active > a:focus {
+ border-bottom-color: #fff;
+ }
+}
+.tab-content > .tab-pane {
+ display: none;
+}
+.tab-content > .active {
+ display: block;
+}
+.nav-tabs .dropdown-menu {
+ margin-top: -1px;
+ border-top-left-radius: 0;
+ border-top-right-radius: 0;
+}
+.navbar {
+ position: relative;
+ min-height: 50px;
+ margin-bottom: 20px;
+ border: 1px solid transparent;
+}
+@media (min-width: 862px) {
+ .navbar {
+ border-radius: 4px;
+ }
+}
+@media (min-width: 862px) {
+ .navbar-header {
+ float: left;
+ }
+}
+.navbar-collapse {
+ padding-right: 15px;
+ padding-left: 15px;
+ overflow-x: visible;
+ -webkit-overflow-scrolling: touch;
+ border-top: 1px solid transparent;
+ -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, .1);
+ box-shadow: inset 0 1px 0 rgba(255, 255, 255, .1);
+}
+.navbar-collapse.in {
+ overflow-y: auto;
+}
+@media (min-width: 862px) {
+ .navbar-collapse {
+ width: auto;
+ border-top: 0;
+ -webkit-box-shadow: none;
+ box-shadow: none;
+ }
+ .navbar-collapse.collapse {
+ display: block !important;
+ height: auto !important;
+ padding-bottom: 0;
+ overflow: visible !important;
+ }
+ .navbar-collapse.in {
+ overflow-y: visible;
+ }
+ .navbar-fixed-top .navbar-collapse,
+ .navbar-static-top .navbar-collapse,
+ .navbar-fixed-bottom .navbar-collapse {
+ padding-right: 0;
+ padding-left: 0;
+ }
+}
+.navbar-fixed-top .navbar-collapse,
+.navbar-fixed-bottom .navbar-collapse {
+ max-height: 340px;
+}
+@media (max-width: 480px) and (orientation: landscape) {
+ .navbar-fixed-top .navbar-collapse,
+ .navbar-fixed-bottom .navbar-collapse {
+ max-height: 200px;
+ }
+}
+.container > .navbar-header,
+.container-fluid > .navbar-header,
+.container > .navbar-collapse,
+.container-fluid > .navbar-collapse {
+ margin-right: -15px;
+ margin-left: -15px;
+}
+@media (min-width: 862px) {
+ .container > .navbar-header,
+ .container-fluid > .navbar-header,
+ .container > .navbar-collapse,
+ .container-fluid > .navbar-collapse {
+ margin-right: 0;
+ margin-left: 0;
+ }
+}
+.navbar-static-top {
+ z-index: 1000;
+ border-width: 0 0 1px;
+}
+@media (min-width: 862px) {
+ .navbar-static-top {
+ border-radius: 0;
+ }
+}
+.navbar-fixed-top,
+.navbar-fixed-bottom {
+ position: fixed;
+ right: 0;
+ left: 0;
+ z-index: 1030;
+ -webkit-transform: translate3d(0, 0, 0);
+ -o-transform: translate3d(0, 0, 0);
+ transform: translate3d(0, 0, 0);
+}
+@media (min-width: 862px) {
+ .navbar-fixed-top,
+ .navbar-fixed-bottom {
+ border-radius: 0;
+ }
+}
+.navbar-fixed-top {
+ top: 0;
+ border-width: 0 0 1px;
+}
+.navbar-fixed-bottom {
+ bottom: 0;
+ margin-bottom: 0;
+ border-width: 1px 0 0;
+}
+.navbar-brand {
+ float: left;
+ height: 50px;
+ padding: 15px 15px;
+ font-size: 18px;
+ line-height: 20px;
+}
+.navbar-brand:hover,
+.navbar-brand:focus {
+ text-decoration: none;
+}
+@media (min-width: 862px) {
+ .navbar > .container .navbar-brand,
+ .navbar > .container-fluid .navbar-brand {
+ margin-left: -15px;
+ }
+}
+.navbar-toggle {
+ position: relative;
+ float: right;
+ padding: 9px 10px;
+ margin-top: 8px;
+ margin-right: 15px;
+ margin-bottom: 8px;
+ background-color: transparent;
+ background-image: none;
+ border: 1px solid transparent;
+ border-radius: 4px;
+}
+.navbar-toggle:focus {
+ outline: 0;
+}
+.navbar-toggle .icon-bar {
+ display: block;
+ width: 22px;
+ height: 2px;
+ border-radius: 1px;
+}
+.navbar-toggle .icon-bar + .icon-bar {
+ margin-top: 4px;
+}
+@media (min-width: 862px) {
+ .navbar-toggle {
+ display: none;
+ }
+}
+.navbar-nav {
+ margin: 7.5px -15px;
+}
+.navbar-nav > li > a {
+ padding-top: 10px;
+ padding-bottom: 10px;
+ line-height: 20px;
+}
+@media (max-width: 861px) {
+ .navbar-nav .open .dropdown-menu {
+ position: static;
+ float: none;
+ width: auto;
+ margin-top: 0;
+ background-color: transparent;
+ border: 0;
+ -webkit-box-shadow: none;
+ box-shadow: none;
+ }
+ .navbar-nav .open .dropdown-menu > li > a,
+ .navbar-nav .open .dropdown-menu .dropdown-header {
+ padding: 5px 15px 5px 25px;
+ }
+ .navbar-nav .open .dropdown-menu > li > a {
+ line-height: 20px;
+ }
+ .navbar-nav .open .dropdown-menu > li > a:hover,
+ .navbar-nav .open .dropdown-menu > li > a:focus {
+ background-image: none;
+ }
+}
+@media (min-width: 862px) {
+ .navbar-nav {
+ float: left;
+ margin: 0;
+ }
+ .navbar-nav > li {
+ float: left;
+ }
+ .navbar-nav > li > a {
+ padding-top: 15px;
+ padding-bottom: 15px;
+ }
+ .navbar-nav.navbar-right:last-child {
+ margin-right: -15px;
+ }
+}
+@media (min-width: 862px) {
+ .navbar-left {
+ float: left !important;
+ }
+ .navbar-right {
+ float: right !important;
+ }
+}
+.navbar-form {
+ padding: 10px 15px;
+ margin-top: 8px;
+ margin-right: -15px;
+ margin-bottom: 8px;
+ margin-left: -15px;
+ border-top: 1px solid transparent;
+ border-bottom: 1px solid transparent;
+ -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, .1), 0 1px 0 rgba(255, 255, 255, .1);
+ box-shadow: inset 0 1px 0 rgba(255, 255, 255, .1), 0 1px 0 rgba(255, 255, 255, .1);
+}
+@media (min-width: 768px) {
+ .navbar-form .form-group {
+ display: inline-block;
+ margin-bottom: 0;
+ vertical-align: middle;
+ }
+ .navbar-form .form-control {
+ display: inline-block;
+ width: auto;
+ vertical-align: middle;
+ }
+ .navbar-form .input-group {
+ display: inline-table;
+ vertical-align: middle;
+ }
+ .navbar-form .input-group .input-group-addon,
+ .navbar-form .input-group .input-group-btn,
+ .navbar-form .input-group .form-control {
+ width: auto;
+ }
+ .navbar-form .input-group > .form-control {
+ width: 100%;
+ }
+ .navbar-form .control-label {
+ margin-bottom: 0;
+ vertical-align: middle;
+ }
+ .navbar-form .radio,
+ .navbar-form .checkbox {
+ display: inline-block;
+ margin-top: 0;
+ margin-bottom: 0;
+ vertical-align: middle;
+ }
+ .navbar-form .radio label,
+ .navbar-form .checkbox label {
+ padding-left: 0;
+ }
+ .navbar-form .radio input[type="radio"],
+ .navbar-form .checkbox input[type="checkbox"] {
+ position: relative;
+ margin-left: 0;
+ }
+ .navbar-form .has-feedback .form-control-feedback {
+ top: 0;
+ }
+}
+@media (max-width: 861px) {
+ .navbar-form .form-group {
+ margin-bottom: 5px;
+ }
+}
+@media (min-width: 862px) {
+ .navbar-form {
+ width: auto;
+ padding-top: 0;
+ padding-bottom: 0;
+ margin-right: 0;
+ margin-left: 0;
+ border: 0;
+ -webkit-box-shadow: none;
+ box-shadow: none;
+ }
+ .navbar-form.navbar-right:last-child {
+ margin-right: -15px;
+ }
+}
+.navbar-nav > li > .dropdown-menu {
+ margin-top: 0;
+ border-top-left-radius: 0;
+ border-top-right-radius: 0;
+}
+.navbar-fixed-bottom .navbar-nav > li > .dropdown-menu {
+ border-bottom-right-radius: 0;
+ border-bottom-left-radius: 0;
+}
+.navbar-btn {
+ margin-top: 8px;
+ margin-bottom: 8px;
+}
+.navbar-btn.btn-sm {
+ margin-top: 10px;
+ margin-bottom: 10px;
+}
+.navbar-btn.btn-xs {
+ margin-top: 14px;
+ margin-bottom: 14px;
+}
+.navbar-text {
+ margin-top: 15px;
+ margin-bottom: 15px;
+}
+@media (min-width: 862px) {
+ .navbar-text {
+ float: left;
+ margin-right: 15px;
+ margin-left: 15px;
+ }
+ .navbar-text.navbar-right:last-child {
+ margin-right: 0;
+ }
+}
+.navbar-default {
+ background-color: #f8f8f8;
+ border-color: #e7e7e7;
+}
+.navbar-default .navbar-brand {
+ color: #777;
+}
+.navbar-default .navbar-brand:hover,
+.navbar-default .navbar-brand:focus {
+ color: #5e5e5e;
+ background-color: transparent;
+}
+.navbar-default .navbar-text {
+ color: #777;
+}
+.navbar-default .navbar-nav > li > a {
+ color: #777;
+}
+.navbar-default .navbar-nav > li > a:hover,
+.navbar-default .navbar-nav > li > a:focus {
+ color: #333;
+ background-color: transparent;
+}
+.navbar-default .navbar-nav > .active > a,
+.navbar-default .navbar-nav > .active > a:hover,
+.navbar-default .navbar-nav > .active > a:focus {
+ color: #555;
+ background-color: #e7e7e7;
+}
+.navbar-default .navbar-nav > .disabled > a,
+.navbar-default .navbar-nav > .disabled > a:hover,
+.navbar-default .navbar-nav > .disabled > a:focus {
+ color: #ccc;
+ background-color: transparent;
+}
+.navbar-default .navbar-toggle {
+ border-color: #ddd;
+}
+.navbar-default .navbar-toggle:hover,
+.navbar-default .navbar-toggle:focus {
+ background-color: #ddd;
+}
+.navbar-default .navbar-toggle .icon-bar {
+ background-color: #888;
+}
+.navbar-default .navbar-collapse,
+.navbar-default .navbar-form {
+ border-color: #e7e7e7;
+}
+.navbar-default .navbar-nav > .open > a,
+.navbar-default .navbar-nav > .open > a:hover,
+.navbar-default .navbar-nav > .open > a:focus {
+ color: #555;
+ background-color: #e7e7e7;
+}
+@media (max-width: 861px) {
+ .navbar-default .navbar-nav .open .dropdown-menu > li > a {
+ color: #777;
+ }
+ .navbar-default .navbar-nav .open .dropdown-menu > li > a:hover,
+ .navbar-default .navbar-nav .open .dropdown-menu > li > a:focus {
+ color: #333;
+ background-color: transparent;
+ }
+ .navbar-default .navbar-nav .open .dropdown-menu > .active > a,
+ .navbar-default .navbar-nav .open .dropdown-menu > .active > a:hover,
+ .navbar-default .navbar-nav .open .dropdown-menu > .active > a:focus {
+ color: #555;
+ background-color: #e7e7e7;
+ }
+ .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a,
+ .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:hover,
+ .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:focus {
+ color: #ccc;
+ background-color: transparent;
+ }
+}
+.navbar-default .navbar-link {
+ color: #777;
+}
+.navbar-default .navbar-link:hover {
+ color: #333;
+}
+.navbar-default .btn-link {
+ color: #777;
+}
+.navbar-default .btn-link:hover,
+.navbar-default .btn-link:focus {
+ color: #333;
+}
+.navbar-default .btn-link[disabled]:hover,
+fieldset[disabled] .navbar-default .btn-link:hover,
+.navbar-default .btn-link[disabled]:focus,
+fieldset[disabled] .navbar-default .btn-link:focus {
+ color: #ccc;
+}
+.navbar-inverse {
+ background-color: #222;
+ border-color: #080808;
+}
+.navbar-inverse .navbar-brand {
+ color: #777;
+}
+.navbar-inverse .navbar-brand:hover,
+.navbar-inverse .navbar-brand:focus {
+ color: #fff;
+ background-color: transparent;
+}
+.navbar-inverse .navbar-text {
+ color: #777;
+}
+.navbar-inverse .navbar-nav > li > a {
+ color: #777;
+}
+.navbar-inverse .navbar-nav > li > a:hover,
+.navbar-inverse .navbar-nav > li > a:focus {
+ color: #fff;
+ background-color: transparent;
+}
+.navbar-inverse .navbar-nav > .active > a,
+.navbar-inverse .navbar-nav > .active > a:hover,
+.navbar-inverse .navbar-nav > .active > a:focus {
+ color: #fff;
+ background-color: #080808;
+}
+.navbar-inverse .navbar-nav > .disabled > a,
+.navbar-inverse .navbar-nav > .disabled > a:hover,
+.navbar-inverse .navbar-nav > .disabled > a:focus {
+ color: #444;
+ background-color: transparent;
+}
+.navbar-inverse .navbar-toggle {
+ border-color: #333;
+}
+.navbar-inverse .navbar-toggle:hover,
+.navbar-inverse .navbar-toggle:focus {
+ background-color: #333;
+}
+.navbar-inverse .navbar-toggle .icon-bar {
+ background-color: #fff;
+}
+.navbar-inverse .navbar-collapse,
+.navbar-inverse .navbar-form {
+ border-color: #101010;
+}
+.navbar-inverse .navbar-nav > .open > a,
+.navbar-inverse .navbar-nav > .open > a:hover,
+.navbar-inverse .navbar-nav > .open > a:focus {
+ color: #fff;
+ background-color: #080808;
+}
+@media (max-width: 861px) {
+ .navbar-inverse .navbar-nav .open .dropdown-menu > .dropdown-header {
+ border-color: #080808;
+ }
+ .navbar-inverse .navbar-nav .open .dropdown-menu .divider {
+ background-color: #080808;
+ }
+ .navbar-inverse .navbar-nav .open .dropdown-menu > li > a {
+ color: #777;
+ }
+ .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:hover,
+ .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:focus {
+ color: #fff;
+ background-color: transparent;
+ }
+ .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a,
+ .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:hover,
+ .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:focus {
+ color: #fff;
+ background-color: #080808;
+ }
+ .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a,
+ .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:hover,
+ .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:focus {
+ color: #444;
+ background-color: transparent;
+ }
+}
+.navbar-inverse .navbar-link {
+ color: #777;
+}
+.navbar-inverse .navbar-link:hover {
+ color: #fff;
+}
+.navbar-inverse .btn-link {
+ color: #777;
+}
+.navbar-inverse .btn-link:hover,
+.navbar-inverse .btn-link:focus {
+ color: #fff;
+}
+.navbar-inverse .btn-link[disabled]:hover,
+fieldset[disabled] .navbar-inverse .btn-link:hover,
+.navbar-inverse .btn-link[disabled]:focus,
+fieldset[disabled] .navbar-inverse .btn-link:focus {
+ color: #444;
+}
+.breadcrumb {
+ padding: 8px 15px;
+ margin-bottom: 20px;
+ list-style: none;
+ background-color: #f5f5f5;
+ border-radius: 4px;
+}
+.breadcrumb > li {
+ display: inline-block;
+}
+.breadcrumb > li + li:before {
+ padding: 0 5px;
+ color: #ccc;
+ content: "/\00a0";
+}
+.breadcrumb > .active {
+ color: #777;
+}
+.pagination {
+ display: inline-block;
+ padding-left: 0;
+ margin: 20px 0;
+ border-radius: 4px;
+}
+.pagination > li {
+ display: inline;
+}
+.pagination > li > a,
+.pagination > li > span {
+ position: relative;
+ float: left;
+ padding: 6px 12px;
+ margin-left: -1px;
+ line-height: 1.42857143;
+ color: #428bca;
+ text-decoration: none;
+ background-color: #fff;
+ border: 1px solid #ddd;
+}
+.pagination > li:first-child > a,
+.pagination > li:first-child > span {
+ margin-left: 0;
+ border-top-left-radius: 4px;
+ border-bottom-left-radius: 4px;
+}
+.pagination > li:last-child > a,
+.pagination > li:last-child > span {
+ border-top-right-radius: 4px;
+ border-bottom-right-radius: 4px;
+}
+.pagination > li > a:hover,
+.pagination > li > span:hover,
+.pagination > li > a:focus,
+.pagination > li > span:focus {
+ color: #2a6496;
+ background-color: #eee;
+ border-color: #ddd;
+}
+.pagination > .active > a,
+.pagination > .active > span,
+.pagination > .active > a:hover,
+.pagination > .active > span:hover,
+.pagination > .active > a:focus,
+.pagination > .active > span:focus {
+ z-index: 2;
+ color: #fff;
+ cursor: default;
+ background-color: #428bca;
+ border-color: #428bca;
+}
+.pagination > .disabled > span,
+.pagination > .disabled > span:hover,
+.pagination > .disabled > span:focus,
+.pagination > .disabled > a,
+.pagination > .disabled > a:hover,
+.pagination > .disabled > a:focus {
+ color: #777;
+ cursor: not-allowed;
+ background-color: #fff;
+ border-color: #ddd;
+}
+.pagination-lg > li > a,
+.pagination-lg > li > span {
+ padding: 10px 16px;
+ font-size: 18px;
+}
+.pagination-lg > li:first-child > a,
+.pagination-lg > li:first-child > span {
+ border-top-left-radius: 6px;
+ border-bottom-left-radius: 6px;
+}
+.pagination-lg > li:last-child > a,
+.pagination-lg > li:last-child > span {
+ border-top-right-radius: 6px;
+ border-bottom-right-radius: 6px;
+}
+.pagination-sm > li > a,
+.pagination-sm > li > span {
+ padding: 5px 10px;
+ font-size: 12px;
+}
+.pagination-sm > li:first-child > a,
+.pagination-sm > li:first-child > span {
+ border-top-left-radius: 3px;
+ border-bottom-left-radius: 3px;
+}
+.pagination-sm > li:last-child > a,
+.pagination-sm > li:last-child > span {
+ border-top-right-radius: 3px;
+ border-bottom-right-radius: 3px;
+}
+.pager {
+ padding-left: 0;
+ margin: 20px 0;
+ text-align: center;
+ list-style: none;
+}
+.pager li {
+ display: inline;
+}
+.pager li > a,
+.pager li > span {
+ display: inline-block;
+ padding: 5px 14px;
+ background-color: #fff;
+ border: 1px solid #ddd;
+ border-radius: 15px;
+}
+.pager li > a:hover,
+.pager li > a:focus {
+ text-decoration: none;
+ background-color: #eee;
+}
+.pager .next > a,
+.pager .next > span {
+ float: right;
+}
+.pager .previous > a,
+.pager .previous > span {
+ float: left;
+}
+.pager .disabled > a,
+.pager .disabled > a:hover,
+.pager .disabled > a:focus,
+.pager .disabled > span {
+ color: #777;
+ cursor: not-allowed;
+ background-color: #fff;
+}
+.label {
+ display: inline;
+ padding: .2em .6em .3em;
+ font-size: 75%;
+ font-weight: bold;
+ line-height: 1;
+ color: #fff;
+ text-align: center;
+ white-space: nowrap;
+ vertical-align: baseline;
+ border-radius: .25em;
+}
+a.label:hover,
+a.label:focus {
+ color: #fff;
+ text-decoration: none;
+ cursor: pointer;
+}
+.label:empty {
+ display: none;
+}
+.btn .label {
+ position: relative;
+ top: -1px;
+}
+.label-default {
+ background-color: #777;
+}
+.label-default[href]:hover,
+.label-default[href]:focus {
+ background-color: #5e5e5e;
+}
+.label-primary {
+ background-color: #428bca;
+}
+.label-primary[href]:hover,
+.label-primary[href]:focus {
+ background-color: #3071a9;
+}
+.label-success {
+ background-color: #5cb85c;
+}
+.label-success[href]:hover,
+.label-success[href]:focus {
+ background-color: #449d44;
+}
+.label-info {
+ background-color: #5bc0de;
+}
+.label-info[href]:hover,
+.label-info[href]:focus {
+ background-color: #31b0d5;
+}
+.label-warning {
+ background-color: #f0ad4e;
+}
+.label-warning[href]:hover,
+.label-warning[href]:focus {
+ background-color: #ec971f;
+}
+.label-danger {
+ background-color: #d9534f;
+}
+.label-danger[href]:hover,
+.label-danger[href]:focus {
+ background-color: #c9302c;
+}
+.badge {
+ display: inline-block;
+ min-width: 10px;
+ padding: 3px 7px;
+ font-size: 12px;
+ font-weight: bold;
+ line-height: 1;
+ color: #fff;
+ text-align: center;
+ white-space: nowrap;
+ vertical-align: baseline;
+ background-color: #777;
+ border-radius: 10px;
+}
+.badge:empty {
+ display: none;
+}
+.btn .badge {
+ position: relative;
+ top: -1px;
+}
+.btn-xs .badge {
+ top: 0;
+ padding: 1px 5px;
+}
+a.badge:hover,
+a.badge:focus {
+ color: #fff;
+ text-decoration: none;
+ cursor: pointer;
+}
+a.list-group-item.active > .badge,
+.nav-pills > .active > a > .badge {
+ color: #428bca;
+ background-color: #fff;
+}
+.nav-pills > li > a > .badge {
+ margin-left: 3px;
+}
+.jumbotron {
+ padding: 30px;
+ margin-bottom: 30px;
+ color: inherit;
+ background-color: #eee;
+}
+.jumbotron h1,
+.jumbotron .h1 {
+ color: inherit;
+}
+.jumbotron p {
+ margin-bottom: 15px;
+ font-size: 21px;
+ font-weight: 200;
+}
+.jumbotron > hr {
+ border-top-color: #d5d5d5;
+}
+.container .jumbotron {
+ border-radius: 6px;
+}
+.jumbotron .container {
+ max-width: 100%;
+}
+@media screen and (min-width: 768px) {
+ .jumbotron {
+ padding-top: 48px;
+ padding-bottom: 48px;
+ }
+ .container .jumbotron {
+ padding-right: 60px;
+ padding-left: 60px;
+ }
+ .jumbotron h1,
+ .jumbotron .h1 {
+ font-size: 63px;
+ }
+}
+.thumbnail {
+ display: block;
+ padding: 4px;
+ margin-bottom: 20px;
+ line-height: 1.42857143;
+ background-color: #fff;
+ border: 1px solid #ddd;
+ border-radius: 4px;
+ -webkit-transition: all .2s ease-in-out;
+ -o-transition: all .2s ease-in-out;
+ transition: all .2s ease-in-out;
+}
+.thumbnail > img,
+.thumbnail a > img {
+ margin-right: auto;
+ margin-left: auto;
+}
+a.thumbnail:hover,
+a.thumbnail:focus,
+a.thumbnail.active {
+ border-color: #428bca;
+}
+.thumbnail .caption {
+ padding: 9px;
+ color: #333;
+}
+.alert {
+ padding: 15px;
+ margin-bottom: 20px;
+ border: 1px solid transparent;
+ border-radius: 4px;
+}
+.alert h4 {
+ margin-top: 0;
+ color: inherit;
+}
+.alert .alert-link {
+ font-weight: bold;
+}
+.alert > p,
+.alert > ul {
+ margin-bottom: 0;
+}
+.alert > p + p {
+ margin-top: 5px;
+}
+.alert-dismissable,
+.alert-dismissible {
+ padding-right: 35px;
+}
+.alert-dismissable .close,
+.alert-dismissible .close {
+ position: relative;
+ top: -2px;
+ right: -21px;
+ color: inherit;
+}
+.alert-success {
+ color: #3c763d;
+ background-color: #dff0d8;
+ border-color: #d6e9c6;
+}
+.alert-success hr {
+ border-top-color: #c9e2b3;
+}
+.alert-success .alert-link {
+ color: #2b542c;
+}
+.alert-info {
+ color: #31708f;
+ background-color: #d9edf7;
+ border-color: #bce8f1;
+}
+.alert-info hr {
+ border-top-color: #a6e1ec;
+}
+.alert-info .alert-link {
+ color: #245269;
+}
+.alert-warning {
+ color: #8a6d3b;
+ background-color: #fcf8e3;
+ border-color: #faebcc;
+}
+.alert-warning hr {
+ border-top-color: #f7e1b5;
+}
+.alert-warning .alert-link {
+ color: #66512c;
+}
+.alert-danger {
+ color: #a94442;
+ background-color: #f2dede;
+ border-color: #ebccd1;
+}
+.alert-danger hr {
+ border-top-color: #e4b9c0;
+}
+.alert-danger .alert-link {
+ color: #843534;
+}
+@-webkit-keyframes progress-bar-stripes {
+ from {
+ background-position: 40px 0;
+ }
+ to {
+ background-position: 0 0;
+ }
+}
+@-o-keyframes progress-bar-stripes {
+ from {
+ background-position: 40px 0;
+ }
+ to {
+ background-position: 0 0;
+ }
+}
+@keyframes progress-bar-stripes {
+ from {
+ background-position: 40px 0;
+ }
+ to {
+ background-position: 0 0;
+ }
+}
+.progress {
+ height: 20px;
+ margin-bottom: 20px;
+ overflow: hidden;
+ background-color: #f5f5f5;
+ border-radius: 4px;
+ -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, .1);
+ box-shadow: inset 0 1px 2px rgba(0, 0, 0, .1);
+}
+.progress-bar {
+ float: left;
+ width: 0;
+ height: 100%;
+ font-size: 12px;
+ line-height: 20px;
+ color: #fff;
+ text-align: center;
+ background-color: #428bca;
+ -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, .15);
+ box-shadow: inset 0 -1px 0 rgba(0, 0, 0, .15);
+ -webkit-transition: width .6s ease;
+ -o-transition: width .6s ease;
+ transition: width .6s ease;
+}
+.progress-striped .progress-bar,
+.progress-bar-striped {
+ background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ background-image: linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ -webkit-background-size: 40px 40px;
+ background-size: 40px 40px;
+}
+.progress.active .progress-bar,
+.progress-bar.active {
+ -webkit-animation: progress-bar-stripes 2s linear infinite;
+ -o-animation: progress-bar-stripes 2s linear infinite;
+ animation: progress-bar-stripes 2s linear infinite;
+}
+.progress-bar[aria-valuenow="1"],
+.progress-bar[aria-valuenow="2"] {
+ min-width: 30px;
+}
+.progress-bar[aria-valuenow="0"] {
+ min-width: 30px;
+ color: #777;
+ background-color: transparent;
+ background-image: none;
+ -webkit-box-shadow: none;
+ box-shadow: none;
+}
+.progress-bar-success {
+ background-color: #5cb85c;
+}
+.progress-striped .progress-bar-success {
+ background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ background-image: linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+}
+.progress-bar-info {
+ background-color: #5bc0de;
+}
+.progress-striped .progress-bar-info {
+ background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ background-image: linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+}
+.progress-bar-warning {
+ background-color: #f0ad4e;
+}
+.progress-striped .progress-bar-warning {
+ background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ background-image: linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+}
+.progress-bar-danger {
+ background-color: #d9534f;
+}
+.progress-striped .progress-bar-danger {
+ background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+ background-image: linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent);
+}
+.media,
+.media-body {
+ overflow: hidden;
+ zoom: 1;
+}
+.media,
+.media .media {
+ margin-top: 15px;
+}
+.media:first-child {
+ margin-top: 0;
+}
+.media-object {
+ display: block;
+}
+.media-heading {
+ margin: 0 0 5px;
+}
+.media > .pull-left {
+ margin-right: 10px;
+}
+.media > .pull-right {
+ margin-left: 10px;
+}
+.media-list {
+ padding-left: 0;
+ list-style: none;
+}
+.list-group {
+ padding-left: 0;
+ margin-bottom: 20px;
+}
+.list-group-item {
+ position: relative;
+ display: block;
+ padding: 10px 15px;
+ margin-bottom: -1px;
+ background-color: #fff;
+ border: 1px solid #ddd;
+}
+.list-group-item:first-child {
+ border-top-left-radius: 4px;
+ border-top-right-radius: 4px;
+}
+.list-group-item:last-child {
+ margin-bottom: 0;
+ border-bottom-right-radius: 4px;
+ border-bottom-left-radius: 4px;
+}
+.list-group-item > .badge {
+ float: right;
+}
+.list-group-item > .badge + .badge {
+ margin-right: 5px;
+}
+a.list-group-item {
+ color: #555;
+}
+a.list-group-item .list-group-item-heading {
+ color: #333;
+}
+a.list-group-item:hover,
+a.list-group-item:focus {
+ color: #555;
+ text-decoration: none;
+ background-color: #f5f5f5;
+}
+.list-group-item.disabled,
+.list-group-item.disabled:hover,
+.list-group-item.disabled:focus {
+ color: #777;
+ background-color: #eee;
+}
+.list-group-item.disabled .list-group-item-heading,
+.list-group-item.disabled:hover .list-group-item-heading,
+.list-group-item.disabled:focus .list-group-item-heading {
+ color: inherit;
+}
+.list-group-item.disabled .list-group-item-text,
+.list-group-item.disabled:hover .list-group-item-text,
+.list-group-item.disabled:focus .list-group-item-text {
+ color: #777;
+}
+.list-group-item.active,
+.list-group-item.active:hover,
+.list-group-item.active:focus {
+ z-index: 2;
+ color: #fff;
+ background-color: #428bca;
+ border-color: #428bca;
+}
+.list-group-item.active .list-group-item-heading,
+.list-group-item.active:hover .list-group-item-heading,
+.list-group-item.active:focus .list-group-item-heading,
+.list-group-item.active .list-group-item-heading > small,
+.list-group-item.active:hover .list-group-item-heading > small,
+.list-group-item.active:focus .list-group-item-heading > small,
+.list-group-item.active .list-group-item-heading > .small,
+.list-group-item.active:hover .list-group-item-heading > .small,
+.list-group-item.active:focus .list-group-item-heading > .small {
+ color: inherit;
+}
+.list-group-item.active .list-group-item-text,
+.list-group-item.active:hover .list-group-item-text,
+.list-group-item.active:focus .list-group-item-text {
+ color: #e1edf7;
+}
+.list-group-item-success {
+ color: #3c763d;
+ background-color: #dff0d8;
+}
+a.list-group-item-success {
+ color: #3c763d;
+}
+a.list-group-item-success .list-group-item-heading {
+ color: inherit;
+}
+a.list-group-item-success:hover,
+a.list-group-item-success:focus {
+ color: #3c763d;
+ background-color: #d0e9c6;
+}
+a.list-group-item-success.active,
+a.list-group-item-success.active:hover,
+a.list-group-item-success.active:focus {
+ color: #fff;
+ background-color: #3c763d;
+ border-color: #3c763d;
+}
+.list-group-item-info {
+ color: #31708f;
+ background-color: #d9edf7;
+}
+a.list-group-item-info {
+ color: #31708f;
+}
+a.list-group-item-info .list-group-item-heading {
+ color: inherit;
+}
+a.list-group-item-info:hover,
+a.list-group-item-info:focus {
+ color: #31708f;
+ background-color: #c4e3f3;
+}
+a.list-group-item-info.active,
+a.list-group-item-info.active:hover,
+a.list-group-item-info.active:focus {
+ color: #fff;
+ background-color: #31708f;
+ border-color: #31708f;
+}
+.list-group-item-warning {
+ color: #8a6d3b;
+ background-color: #fcf8e3;
+}
+a.list-group-item-warning {
+ color: #8a6d3b;
+}
+a.list-group-item-warning .list-group-item-heading {
+ color: inherit;
+}
+a.list-group-item-warning:hover,
+a.list-group-item-warning:focus {
+ color: #8a6d3b;
+ background-color: #faf2cc;
+}
+a.list-group-item-warning.active,
+a.list-group-item-warning.active:hover,
+a.list-group-item-warning.active:focus {
+ color: #fff;
+ background-color: #8a6d3b;
+ border-color: #8a6d3b;
+}
+.list-group-item-danger {
+ color: #a94442;
+ background-color: #f2dede;
+}
+a.list-group-item-danger {
+ color: #a94442;
+}
+a.list-group-item-danger .list-group-item-heading {
+ color: inherit;
+}
+a.list-group-item-danger:hover,
+a.list-group-item-danger:focus {
+ color: #a94442;
+ background-color: #ebcccc;
+}
+a.list-group-item-danger.active,
+a.list-group-item-danger.active:hover,
+a.list-group-item-danger.active:focus {
+ color: #fff;
+ background-color: #a94442;
+ border-color: #a94442;
+}
+.list-group-item-heading {
+ margin-top: 0;
+ margin-bottom: 5px;
+}
+.list-group-item-text {
+ margin-bottom: 0;
+ line-height: 1.3;
+}
+.panel {
+ margin-bottom: 20px;
+ background-color: #fff;
+ border: 1px solid transparent;
+ border-radius: 4px;
+ -webkit-box-shadow: 0 1px 1px rgba(0, 0, 0, .05);
+ box-shadow: 0 1px 1px rgba(0, 0, 0, .05);
+}
+.panel-body {
+ padding: 15px;
+}
+.panel-heading {
+ padding: 10px 15px;
+ border-bottom: 1px solid transparent;
+ border-top-left-radius: 3px;
+ border-top-right-radius: 3px;
+}
+.panel-heading > .dropdown .dropdown-toggle {
+ color: inherit;
+}
+.panel-title {
+ margin-top: 0;
+ margin-bottom: 0;
+ font-size: 16px;
+ color: inherit;
+}
+.panel-title > a {
+ color: inherit;
+}
+.panel-footer {
+ padding: 10px 15px;
+ background-color: #f5f5f5;
+ border-top: 1px solid #ddd;
+ border-bottom-right-radius: 3px;
+ border-bottom-left-radius: 3px;
+}
+.panel > .list-group {
+ margin-bottom: 0;
+}
+.panel > .list-group .list-group-item {
+ border-width: 1px 0;
+ border-radius: 0;
+}
+.panel > .list-group:first-child .list-group-item:first-child {
+ border-top: 0;
+ border-top-left-radius: 3px;
+ border-top-right-radius: 3px;
+}
+.panel > .list-group:last-child .list-group-item:last-child {
+ border-bottom: 0;
+ border-bottom-right-radius: 3px;
+ border-bottom-left-radius: 3px;
+}
+.panel-heading + .list-group .list-group-item:first-child {
+ border-top-width: 0;
+}
+.list-group + .panel-footer {
+ border-top-width: 0;
+}
+.panel > .table,
+.panel > .table-responsive > .table,
+.panel > .panel-collapse > .table {
+ margin-bottom: 0;
+}
+.panel > .table:first-child,
+.panel > .table-responsive:first-child > .table:first-child {
+ border-top-left-radius: 3px;
+ border-top-right-radius: 3px;
+}
+.panel > .table:first-child > thead:first-child > tr:first-child td:first-child,
+.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:first-child,
+.panel > .table:first-child > tbody:first-child > tr:first-child td:first-child,
+.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:first-child,
+.panel > .table:first-child > thead:first-child > tr:first-child th:first-child,
+.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:first-child,
+.panel > .table:first-child > tbody:first-child > tr:first-child th:first-child,
+.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:first-child {
+ border-top-left-radius: 3px;
+}
+.panel > .table:first-child > thead:first-child > tr:first-child td:last-child,
+.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:last-child,
+.panel > .table:first-child > tbody:first-child > tr:first-child td:last-child,
+.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:last-child,
+.panel > .table:first-child > thead:first-child > tr:first-child th:last-child,
+.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:last-child,
+.panel > .table:first-child > tbody:first-child > tr:first-child th:last-child,
+.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:last-child {
+ border-top-right-radius: 3px;
+}
+.panel > .table:last-child,
+.panel > .table-responsive:last-child > .table:last-child {
+ border-bottom-right-radius: 3px;
+ border-bottom-left-radius: 3px;
+}
+.panel > .table:last-child > tbody:last-child > tr:last-child td:first-child,
+.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:first-child,
+.panel > .table:last-child > tfoot:last-child > tr:last-child td:first-child,
+.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:first-child,
+.panel > .table:last-child > tbody:last-child > tr:last-child th:first-child,
+.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:first-child,
+.panel > .table:last-child > tfoot:last-child > tr:last-child th:first-child,
+.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:first-child {
+ border-bottom-left-radius: 3px;
+}
+.panel > .table:last-child > tbody:last-child > tr:last-child td:last-child,
+.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:last-child,
+.panel > .table:last-child > tfoot:last-child > tr:last-child td:last-child,
+.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:last-child,
+.panel > .table:last-child > tbody:last-child > tr:last-child th:last-child,
+.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:last-child,
+.panel > .table:last-child > tfoot:last-child > tr:last-child th:last-child,
+.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:last-child {
+ border-bottom-right-radius: 3px;
+}
+.panel > .panel-body + .table,
+.panel > .panel-body + .table-responsive {
+ border-top: 1px solid #ddd;
+}
+.panel > .table > tbody:first-child > tr:first-child th,
+.panel > .table > tbody:first-child > tr:first-child td {
+ border-top: 0;
+}
+.panel > .table-bordered,
+.panel > .table-responsive > .table-bordered {
+ border: 0;
+}
+.panel > .table-bordered > thead > tr > th:first-child,
+.panel > .table-responsive > .table-bordered > thead > tr > th:first-child,
+.panel > .table-bordered > tbody > tr > th:first-child,
+.panel > .table-responsive > .table-bordered > tbody > tr > th:first-child,
+.panel > .table-bordered > tfoot > tr > th:first-child,
+.panel > .table-responsive > .table-bordered > tfoot > tr > th:first-child,
+.panel > .table-bordered > thead > tr > td:first-child,
+.panel > .table-responsive > .table-bordered > thead > tr > td:first-child,
+.panel > .table-bordered > tbody > tr > td:first-child,
+.panel > .table-responsive > .table-bordered > tbody > tr > td:first-child,
+.panel > .table-bordered > tfoot > tr > td:first-child,
+.panel > .table-responsive > .table-bordered > tfoot > tr > td:first-child {
+ border-left: 0;
+}
+.panel > .table-bordered > thead > tr > th:last-child,
+.panel > .table-responsive > .table-bordered > thead > tr > th:last-child,
+.panel > .table-bordered > tbody > tr > th:last-child,
+.panel > .table-responsive > .table-bordered > tbody > tr > th:last-child,
+.panel > .table-bordered > tfoot > tr > th:last-child,
+.panel > .table-responsive > .table-bordered > tfoot > tr > th:last-child,
+.panel > .table-bordered > thead > tr > td:last-child,
+.panel > .table-responsive > .table-bordered > thead > tr > td:last-child,
+.panel > .table-bordered > tbody > tr > td:last-child,
+.panel > .table-responsive > .table-bordered > tbody > tr > td:last-child,
+.panel > .table-bordered > tfoot > tr > td:last-child,
+.panel > .table-responsive > .table-bordered > tfoot > tr > td:last-child {
+ border-right: 0;
+}
+.panel > .table-bordered > thead > tr:first-child > td,
+.panel > .table-responsive > .table-bordered > thead > tr:first-child > td,
+.panel > .table-bordered > tbody > tr:first-child > td,
+.panel > .table-responsive > .table-bordered > tbody > tr:first-child > td,
+.panel > .table-bordered > thead > tr:first-child > th,
+.panel > .table-responsive > .table-bordered > thead > tr:first-child > th,
+.panel > .table-bordered > tbody > tr:first-child > th,
+.panel > .table-responsive > .table-bordered > tbody > tr:first-child > th {
+ border-bottom: 0;
+}
+.panel > .table-bordered > tbody > tr:last-child > td,
+.panel > .table-responsive > .table-bordered > tbody > tr:last-child > td,
+.panel > .table-bordered > tfoot > tr:last-child > td,
+.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > td,
+.panel > .table-bordered > tbody > tr:last-child > th,
+.panel > .table-responsive > .table-bordered > tbody > tr:last-child > th,
+.panel > .table-bordered > tfoot > tr:last-child > th,
+.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > th {
+ border-bottom: 0;
+}
+.panel > .table-responsive {
+ margin-bottom: 0;
+ border: 0;
+}
+.panel-group {
+ margin-bottom: 20px;
+}
+.panel-group .panel {
+ margin-bottom: 0;
+ border-radius: 4px;
+}
+.panel-group .panel + .panel {
+ margin-top: 5px;
+}
+.panel-group .panel-heading {
+ border-bottom: 0;
+}
+.panel-group .panel-heading + .panel-collapse > .panel-body {
+ border-top: 1px solid #ddd;
+}
+.panel-group .panel-footer {
+ border-top: 0;
+}
+.panel-group .panel-footer + .panel-collapse .panel-body {
+ border-bottom: 1px solid #ddd;
+}
+.panel-default {
+ border-color: #ddd;
+}
+.panel-default > .panel-heading {
+ color: #333;
+ background-color: #f5f5f5;
+ border-color: #ddd;
+}
+.panel-default > .panel-heading + .panel-collapse > .panel-body {
+ border-top-color: #ddd;
+}
+.panel-default > .panel-heading .badge {
+ color: #f5f5f5;
+ background-color: #333;
+}
+.panel-default > .panel-footer + .panel-collapse > .panel-body {
+ border-bottom-color: #ddd;
+}
+.panel-primary {
+ border-color: #428bca;
+}
+.panel-primary > .panel-heading {
+ color: #fff;
+ background-color: #428bca;
+ border-color: #428bca;
+}
+.panel-primary > .panel-heading + .panel-collapse > .panel-body {
+ border-top-color: #428bca;
+}
+.panel-primary > .panel-heading .badge {
+ color: #428bca;
+ background-color: #fff;
+}
+.panel-primary > .panel-footer + .panel-collapse > .panel-body {
+ border-bottom-color: #428bca;
+}
+.panel-success {
+ border-color: #d6e9c6;
+}
+.panel-success > .panel-heading {
+ color: #3c763d;
+ background-color: #dff0d8;
+ border-color: #d6e9c6;
+}
+.panel-success > .panel-heading + .panel-collapse > .panel-body {
+ border-top-color: #d6e9c6;
+}
+.panel-success > .panel-heading .badge {
+ color: #dff0d8;
+ background-color: #3c763d;
+}
+.panel-success > .panel-footer + .panel-collapse > .panel-body {
+ border-bottom-color: #d6e9c6;
+}
+.panel-info {
+ border-color: #bce8f1;
+}
+.panel-info > .panel-heading {
+ color: #31708f;
+ background-color: #d9edf7;
+ border-color: #bce8f1;
+}
+.panel-info > .panel-heading + .panel-collapse > .panel-body {
+ border-top-color: #bce8f1;
+}
+.panel-info > .panel-heading .badge {
+ color: #d9edf7;
+ background-color: #31708f;
+}
+.panel-info > .panel-footer + .panel-collapse > .panel-body {
+ border-bottom-color: #bce8f1;
+}
+.panel-warning {
+ border-color: #faebcc;
+}
+.panel-warning > .panel-heading {
+ color: #8a6d3b;
+ background-color: #fcf8e3;
+ border-color: #faebcc;
+}
+.panel-warning > .panel-heading + .panel-collapse > .panel-body {
+ border-top-color: #faebcc;
+}
+.panel-warning > .panel-heading .badge {
+ color: #fcf8e3;
+ background-color: #8a6d3b;
+}
+.panel-warning > .panel-footer + .panel-collapse > .panel-body {
+ border-bottom-color: #faebcc;
+}
+.panel-danger {
+ border-color: #ebccd1;
+}
+.panel-danger > .panel-heading {
+ color: #a94442;
+ background-color: #f2dede;
+ border-color: #ebccd1;
+}
+.panel-danger > .panel-heading + .panel-collapse > .panel-body {
+ border-top-color: #ebccd1;
+}
+.panel-danger > .panel-heading .badge {
+ color: #f2dede;
+ background-color: #a94442;
+}
+.panel-danger > .panel-footer + .panel-collapse > .panel-body {
+ border-bottom-color: #ebccd1;
+}
+.embed-responsive {
+ position: relative;
+ display: block;
+ height: 0;
+ padding: 0;
+ overflow: hidden;
+}
+.embed-responsive .embed-responsive-item,
+.embed-responsive iframe,
+.embed-responsive embed,
+.embed-responsive object {
+ position: absolute;
+ top: 0;
+ bottom: 0;
+ left: 0;
+ width: 100%;
+ height: 100%;
+ border: 0;
+}
+.embed-responsive.embed-responsive-16by9 {
+ padding-bottom: 56.25%;
+}
+.embed-responsive.embed-responsive-4by3 {
+ padding-bottom: 75%;
+}
+.well {
+ min-height: 20px;
+ padding: 19px;
+ margin-bottom: 20px;
+ background-color: #f5f5f5;
+ border: 1px solid #e3e3e3;
+ border-radius: 4px;
+ -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .05);
+ box-shadow: inset 0 1px 1px rgba(0, 0, 0, .05);
+}
+.well blockquote {
+ border-color: #ddd;
+ border-color: rgba(0, 0, 0, .15);
+}
+.well-lg {
+ padding: 24px;
+ border-radius: 6px;
+}
+.well-sm {
+ padding: 9px;
+ border-radius: 3px;
+}
+.close {
+ float: right;
+ font-size: 21px;
+ font-weight: bold;
+ line-height: 1;
+ color: #000;
+ text-shadow: 0 1px 0 #fff;
+ filter: alpha(opacity=20);
+ opacity: .2;
+}
+.close:hover,
+.close:focus {
+ color: #000;
+ text-decoration: none;
+ cursor: pointer;
+ filter: alpha(opacity=50);
+ opacity: .5;
+}
+button.close {
+ -webkit-appearance: none;
+ padding: 0;
+ cursor: pointer;
+ background: transparent;
+ border: 0;
+}
+.modal-open {
+ overflow: hidden;
+}
+.modal {
+ position: fixed;
+ top: 0;
+ right: 0;
+ bottom: 0;
+ left: 0;
+ z-index: 1050;
+ display: none;
+ overflow: hidden;
+ -webkit-overflow-scrolling: touch;
+ outline: 0;
+}
+.modal.fade .modal-dialog {
+ -webkit-transition: -webkit-transform .3s ease-out;
+ -o-transition: -o-transform .3s ease-out;
+ transition: transform .3s ease-out;
+ -webkit-transform: translate3d(0, -25%, 0);
+ -o-transform: translate3d(0, -25%, 0);
+ transform: translate3d(0, -25%, 0);
+}
+.modal.in .modal-dialog {
+ -webkit-transform: translate3d(0, 0, 0);
+ -o-transform: translate3d(0, 0, 0);
+ transform: translate3d(0, 0, 0);
+}
+.modal-open .modal {
+ overflow-x: hidden;
+ overflow-y: auto;
+}
+.modal-dialog {
+ position: relative;
+ width: auto;
+ margin: 10px;
+}
+.modal-content {
+ position: relative;
+ background-color: #fff;
+ -webkit-background-clip: padding-box;
+ background-clip: padding-box;
+ border: 1px solid #999;
+ border: 1px solid rgba(0, 0, 0, .2);
+ border-radius: 6px;
+ outline: 0;
+ -webkit-box-shadow: 0 3px 9px rgba(0, 0, 0, .5);
+ box-shadow: 0 3px 9px rgba(0, 0, 0, .5);
+}
+.modal-backdrop {
+ position: fixed;
+ top: 0;
+ right: 0;
+ bottom: 0;
+ left: 0;
+ z-index: 1040;
+ background-color: #000;
+}
+.modal-backdrop.fade {
+ filter: alpha(opacity=0);
+ opacity: 0;
+}
+.modal-backdrop.in {
+ filter: alpha(opacity=50);
+ opacity: .5;
+}
+.modal-header {
+ min-height: 16.42857143px;
+ padding: 15px;
+ border-bottom: 1px solid #e5e5e5;
+}
+.modal-header .close {
+ margin-top: -2px;
+}
+.modal-title {
+ margin: 0;
+ line-height: 1.42857143;
+}
+.modal-body {
+ position: relative;
+ padding: 15px;
+}
+.modal-footer {
+ padding: 15px;
+ text-align: right;
+ border-top: 1px solid #e5e5e5;
+}
+.modal-footer .btn + .btn {
+ margin-bottom: 0;
+ margin-left: 5px;
+}
+.modal-footer .btn-group .btn + .btn {
+ margin-left: -1px;
+}
+.modal-footer .btn-block + .btn-block {
+ margin-left: 0;
+}
+.modal-scrollbar-measure {
+ position: absolute;
+ top: -9999px;
+ width: 50px;
+ height: 50px;
+ overflow: scroll;
+}
+@media (min-width: 768px) {
+ .modal-dialog {
+ width: 600px;
+ margin: 30px auto;
+ }
+ .modal-content {
+ -webkit-box-shadow: 0 5px 15px rgba(0, 0, 0, .5);
+ box-shadow: 0 5px 15px rgba(0, 0, 0, .5);
+ }
+ .modal-sm {
+ width: 300px;
+ }
+}
+@media (min-width: 992px) {
+ .modal-lg {
+ width: 900px;
+ }
+}
+.tooltip {
+ position: absolute;
+ z-index: 1070;
+ display: block;
+ font-size: 12px;
+ line-height: 1.4;
+ visibility: visible;
+ filter: alpha(opacity=0);
+ opacity: 0;
+}
+.tooltip.in {
+ filter: alpha(opacity=90);
+ opacity: .9;
+}
+.tooltip.top {
+ padding: 5px 0;
+ margin-top: -3px;
+}
+.tooltip.right {
+ padding: 0 5px;
+ margin-left: 3px;
+}
+.tooltip.bottom {
+ padding: 5px 0;
+ margin-top: 3px;
+}
+.tooltip.left {
+ padding: 0 5px;
+ margin-left: -3px;
+}
+.tooltip-inner {
+ max-width: 200px;
+ padding: 3px 8px;
+ color: #fff;
+ text-align: center;
+ text-decoration: none;
+ background-color: #000;
+ border-radius: 4px;
+}
+.tooltip-arrow {
+ position: absolute;
+ width: 0;
+ height: 0;
+ border-color: transparent;
+ border-style: solid;
+}
+.tooltip.top .tooltip-arrow {
+ bottom: 0;
+ left: 50%;
+ margin-left: -5px;
+ border-width: 5px 5px 0;
+ border-top-color: #000;
+}
+.tooltip.top-left .tooltip-arrow {
+ bottom: 0;
+ left: 5px;
+ border-width: 5px 5px 0;
+ border-top-color: #000;
+}
+.tooltip.top-right .tooltip-arrow {
+ right: 5px;
+ bottom: 0;
+ border-width: 5px 5px 0;
+ border-top-color: #000;
+}
+.tooltip.right .tooltip-arrow {
+ top: 50%;
+ left: 0;
+ margin-top: -5px;
+ border-width: 5px 5px 5px 0;
+ border-right-color: #000;
+}
+.tooltip.left .tooltip-arrow {
+ top: 50%;
+ right: 0;
+ margin-top: -5px;
+ border-width: 5px 0 5px 5px;
+ border-left-color: #000;
+}
+.tooltip.bottom .tooltip-arrow {
+ top: 0;
+ left: 50%;
+ margin-left: -5px;
+ border-width: 0 5px 5px;
+ border-bottom-color: #000;
+}
+.tooltip.bottom-left .tooltip-arrow {
+ top: 0;
+ left: 5px;
+ border-width: 0 5px 5px;
+ border-bottom-color: #000;
+}
+.tooltip.bottom-right .tooltip-arrow {
+ top: 0;
+ right: 5px;
+ border-width: 0 5px 5px;
+ border-bottom-color: #000;
+}
+.popover {
+ position: absolute;
+ top: 0;
+ left: 0;
+ z-index: 1060;
+ display: none;
+ max-width: 276px;
+ padding: 1px;
+ text-align: left;
+ white-space: normal;
+ background-color: #fff;
+ -webkit-background-clip: padding-box;
+ background-clip: padding-box;
+ border: 1px solid #ccc;
+ border: 1px solid rgba(0, 0, 0, .2);
+ border-radius: 6px;
+ -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, .2);
+ box-shadow: 0 5px 10px rgba(0, 0, 0, .2);
+}
+.popover.top {
+ margin-top: -10px;
+}
+.popover.right {
+ margin-left: 10px;
+}
+.popover.bottom {
+ margin-top: 10px;
+}
+.popover.left {
+ margin-left: -10px;
+}
+.popover-title {
+ padding: 8px 14px;
+ margin: 0;
+ font-size: 14px;
+ font-weight: normal;
+ line-height: 18px;
+ background-color: #f7f7f7;
+ border-bottom: 1px solid #ebebeb;
+ border-radius: 5px 5px 0 0;
+}
+.popover-content {
+ padding: 9px 14px;
+}
+.popover > .arrow,
+.popover > .arrow:after {
+ position: absolute;
+ display: block;
+ width: 0;
+ height: 0;
+ border-color: transparent;
+ border-style: solid;
+}
+.popover > .arrow {
+ border-width: 11px;
+}
+.popover > .arrow:after {
+ content: "";
+ border-width: 10px;
+}
+.popover.top > .arrow {
+ bottom: -11px;
+ left: 50%;
+ margin-left: -11px;
+ border-top-color: #999;
+ border-top-color: rgba(0, 0, 0, .25);
+ border-bottom-width: 0;
+}
+.popover.top > .arrow:after {
+ bottom: 1px;
+ margin-left: -10px;
+ content: " ";
+ border-top-color: #fff;
+ border-bottom-width: 0;
+}
+.popover.right > .arrow {
+ top: 50%;
+ left: -11px;
+ margin-top: -11px;
+ border-right-color: #999;
+ border-right-color: rgba(0, 0, 0, .25);
+ border-left-width: 0;
+}
+.popover.right > .arrow:after {
+ bottom: -10px;
+ left: 1px;
+ content: " ";
+ border-right-color: #fff;
+ border-left-width: 0;
+}
+.popover.bottom > .arrow {
+ top: -11px;
+ left: 50%;
+ margin-left: -11px;
+ border-top-width: 0;
+ border-bottom-color: #999;
+ border-bottom-color: rgba(0, 0, 0, .25);
+}
+.popover.bottom > .arrow:after {
+ top: 1px;
+ margin-left: -10px;
+ content: " ";
+ border-top-width: 0;
+ border-bottom-color: #fff;
+}
+.popover.left > .arrow {
+ top: 50%;
+ right: -11px;
+ margin-top: -11px;
+ border-right-width: 0;
+ border-left-color: #999;
+ border-left-color: rgba(0, 0, 0, .25);
+}
+.popover.left > .arrow:after {
+ right: 1px;
+ bottom: -10px;
+ content: " ";
+ border-right-width: 0;
+ border-left-color: #fff;
+}
+.carousel {
+ position: relative;
+}
+.carousel-inner {
+ position: relative;
+ width: 100%;
+ overflow: hidden;
+}
+.carousel-inner > .item {
+ position: relative;
+ display: none;
+ -webkit-transition: .6s ease-in-out left;
+ -o-transition: .6s ease-in-out left;
+ transition: .6s ease-in-out left;
+}
+.carousel-inner > .item > img,
+.carousel-inner > .item > a > img {
+ line-height: 1;
+}
+.carousel-inner > .active,
+.carousel-inner > .next,
+.carousel-inner > .prev {
+ display: block;
+}
+.carousel-inner > .active {
+ left: 0;
+}
+.carousel-inner > .next,
+.carousel-inner > .prev {
+ position: absolute;
+ top: 0;
+ width: 100%;
+}
+.carousel-inner > .next {
+ left: 100%;
+}
+.carousel-inner > .prev {
+ left: -100%;
+}
+.carousel-inner > .next.left,
+.carousel-inner > .prev.right {
+ left: 0;
+}
+.carousel-inner > .active.left {
+ left: -100%;
+}
+.carousel-inner > .active.right {
+ left: 100%;
+}
+.carousel-control {
+ position: absolute;
+ top: 0;
+ bottom: 0;
+ left: 0;
+ width: 15%;
+ font-size: 20px;
+ color: #fff;
+ text-align: center;
+ text-shadow: 0 1px 2px rgba(0, 0, 0, .6);
+ filter: alpha(opacity=50);
+ opacity: .5;
+}
+.carousel-control.left {
+ background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, .5) 0%, rgba(0, 0, 0, .0001) 100%);
+ background-image: -o-linear-gradient(left, rgba(0, 0, 0, .5) 0%, rgba(0, 0, 0, .0001) 100%);
+ background-image: -webkit-gradient(linear, left top, right top, from(rgba(0, 0, 0, .5)), to(rgba(0, 0, 0, .0001)));
+ background-image: linear-gradient(to right, rgba(0, 0, 0, .5) 0%, rgba(0, 0, 0, .0001) 100%);
+ filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#80000000', endColorstr='#00000000', GradientType=1);
+ background-repeat: repeat-x;
+}
+.carousel-control.right {
+ right: 0;
+ left: auto;
+ background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, .0001) 0%, rgba(0, 0, 0, .5) 100%);
+ background-image: -o-linear-gradient(left, rgba(0, 0, 0, .0001) 0%, rgba(0, 0, 0, .5) 100%);
+ background-image: -webkit-gradient(linear, left top, right top, from(rgba(0, 0, 0, .0001)), to(rgba(0, 0, 0, .5)));
+ background-image: linear-gradient(to right, rgba(0, 0, 0, .0001) 0%, rgba(0, 0, 0, .5) 100%);
+ filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#00000000', endColorstr='#80000000', GradientType=1);
+ background-repeat: repeat-x;
+}
+.carousel-control:hover,
+.carousel-control:focus {
+ color: #fff;
+ text-decoration: none;
+ filter: alpha(opacity=90);
+ outline: 0;
+ opacity: .9;
+}
+.carousel-control .icon-prev,
+.carousel-control .icon-next,
+.carousel-control .glyphicon-chevron-left,
+.carousel-control .glyphicon-chevron-right {
+ position: absolute;
+ top: 50%;
+ z-index: 5;
+ display: inline-block;
+}
+.carousel-control .icon-prev,
+.carousel-control .glyphicon-chevron-left {
+ left: 50%;
+ margin-left: -10px;
+}
+.carousel-control .icon-next,
+.carousel-control .glyphicon-chevron-right {
+ right: 50%;
+ margin-right: -10px;
+}
+.carousel-control .icon-prev,
+.carousel-control .icon-next {
+ width: 20px;
+ height: 20px;
+ margin-top: -10px;
+ font-family: serif;
+}
+.carousel-control .icon-prev:before {
+ content: '\2039';
+}
+.carousel-control .icon-next:before {
+ content: '\203a';
+}
+.carousel-indicators {
+ position: absolute;
+ bottom: 10px;
+ left: 50%;
+ z-index: 15;
+ width: 60%;
+ padding-left: 0;
+ margin-left: -30%;
+ text-align: center;
+ list-style: none;
+}
+.carousel-indicators li {
+ display: inline-block;
+ width: 10px;
+ height: 10px;
+ margin: 1px;
+ text-indent: -999px;
+ cursor: pointer;
+ background-color: #000 \9;
+ background-color: rgba(0, 0, 0, 0);
+ border: 1px solid #fff;
+ border-radius: 10px;
+}
+.carousel-indicators .active {
+ width: 12px;
+ height: 12px;
+ margin: 0;
+ background-color: #fff;
+}
+.carousel-caption {
+ position: absolute;
+ right: 15%;
+ bottom: 20px;
+ left: 15%;
+ z-index: 10;
+ padding-top: 20px;
+ padding-bottom: 20px;
+ color: #fff;
+ text-align: center;
+ text-shadow: 0 1px 2px rgba(0, 0, 0, .6);
+}
+.carousel-caption .btn {
+ text-shadow: none;
+}
+@media screen and (min-width: 768px) {
+ .carousel-control .glyphicon-chevron-left,
+ .carousel-control .glyphicon-chevron-right,
+ .carousel-control .icon-prev,
+ .carousel-control .icon-next {
+ width: 30px;
+ height: 30px;
+ margin-top: -15px;
+ font-size: 30px;
+ }
+ .carousel-control .glyphicon-chevron-left,
+ .carousel-control .icon-prev {
+ margin-left: -15px;
+ }
+ .carousel-control .glyphicon-chevron-right,
+ .carousel-control .icon-next {
+ margin-right: -15px;
+ }
+ .carousel-caption {
+ right: 20%;
+ left: 20%;
+ padding-bottom: 30px;
+ }
+ .carousel-indicators {
+ bottom: 20px;
+ }
+}
+.clearfix:before,
+.clearfix:after,
+.dl-horizontal dd:before,
+.dl-horizontal dd:after,
+.container:before,
+.container:after,
+.container-fluid:before,
+.container-fluid:after,
+.row:before,
+.row:after,
+.form-horizontal .form-group:before,
+.form-horizontal .form-group:after,
+.btn-toolbar:before,
+.btn-toolbar:after,
+.btn-group-vertical > .btn-group:before,
+.btn-group-vertical > .btn-group:after,
+.nav:before,
+.nav:after,
+.navbar:before,
+.navbar:after,
+.navbar-header:before,
+.navbar-header:after,
+.navbar-collapse:before,
+.navbar-collapse:after,
+.pager:before,
+.pager:after,
+.panel-body:before,
+.panel-body:after,
+.modal-footer:before,
+.modal-footer:after {
+ display: table;
+ content: " ";
+}
+.clearfix:after,
+.dl-horizontal dd:after,
+.container:after,
+.container-fluid:after,
+.row:after,
+.form-horizontal .form-group:after,
+.btn-toolbar:after,
+.btn-group-vertical > .btn-group:after,
+.nav:after,
+.navbar:after,
+.navbar-header:after,
+.navbar-collapse:after,
+.pager:after,
+.panel-body:after,
+.modal-footer:after {
+ clear: both;
+}
+.center-block {
+ display: block;
+ margin-right: auto;
+ margin-left: auto;
+}
+.pull-right {
+ float: right !important;
+}
+.pull-left {
+ float: left !important;
+}
+.hide {
+ display: none !important;
+}
+.show {
+ display: block !important;
+}
+.invisible {
+ visibility: hidden;
+}
+.text-hide {
+ font: 0/0 a;
+ color: transparent;
+ text-shadow: none;
+ background-color: transparent;
+ border: 0;
+}
+.hidden {
+ display: none !important;
+ visibility: hidden !important;
+}
+.affix {
+ position: fixed;
+ -webkit-transform: translate3d(0, 0, 0);
+ -o-transform: translate3d(0, 0, 0);
+ transform: translate3d(0, 0, 0);
+}
+@-ms-viewport {
+ width: device-width;
+}
+.visible-xs,
+.visible-sm,
+.visible-md,
+.visible-lg {
+ display: none !important;
+}
+.visible-xs-block,
+.visible-xs-inline,
+.visible-xs-inline-block,
+.visible-sm-block,
+.visible-sm-inline,
+.visible-sm-inline-block,
+.visible-md-block,
+.visible-md-inline,
+.visible-md-inline-block,
+.visible-lg-block,
+.visible-lg-inline,
+.visible-lg-inline-block {
+ display: none !important;
+}
+@media (max-width: 767px) {
+ .visible-xs {
+ display: block !important;
+ }
+ table.visible-xs {
+ display: table;
+ }
+ tr.visible-xs {
+ display: table-row !important;
+ }
+ th.visible-xs,
+ td.visible-xs {
+ display: table-cell !important;
+ }
+}
+@media (max-width: 767px) {
+ .visible-xs-block {
+ display: block !important;
+ }
+}
+@media (max-width: 767px) {
+ .visible-xs-inline {
+ display: inline !important;
+ }
+}
+@media (max-width: 767px) {
+ .visible-xs-inline-block {
+ display: inline-block !important;
+ }
+}
+@media (min-width: 768px) and (max-width: 991px) {
+ .visible-sm {
+ display: block !important;
+ }
+ table.visible-sm {
+ display: table;
+ }
+ tr.visible-sm {
+ display: table-row !important;
+ }
+ th.visible-sm,
+ td.visible-sm {
+ display: table-cell !important;
+ }
+}
+@media (min-width: 768px) and (max-width: 991px) {
+ .visible-sm-block {
+ display: block !important;
+ }
+}
+@media (min-width: 768px) and (max-width: 991px) {
+ .visible-sm-inline {
+ display: inline !important;
+ }
+}
+@media (min-width: 768px) and (max-width: 991px) {
+ .visible-sm-inline-block {
+ display: inline-block !important;
+ }
+}
+@media (min-width: 992px) and (max-width: 1199px) {
+ .visible-md {
+ display: block !important;
+ }
+ table.visible-md {
+ display: table;
+ }
+ tr.visible-md {
+ display: table-row !important;
+ }
+ th.visible-md,
+ td.visible-md {
+ display: table-cell !important;
+ }
+}
+@media (min-width: 992px) and (max-width: 1199px) {
+ .visible-md-block {
+ display: block !important;
+ }
+}
+@media (min-width: 992px) and (max-width: 1199px) {
+ .visible-md-inline {
+ display: inline !important;
+ }
+}
+@media (min-width: 992px) and (max-width: 1199px) {
+ .visible-md-inline-block {
+ display: inline-block !important;
+ }
+}
+@media (min-width: 1200px) {
+ .visible-lg {
+ display: block !important;
+ }
+ table.visible-lg {
+ display: table;
+ }
+ tr.visible-lg {
+ display: table-row !important;
+ }
+ th.visible-lg,
+ td.visible-lg {
+ display: table-cell !important;
+ }
+}
+@media (min-width: 1200px) {
+ .visible-lg-block {
+ display: block !important;
+ }
+}
+@media (min-width: 1200px) {
+ .visible-lg-inline {
+ display: inline !important;
+ }
+}
+@media (min-width: 1200px) {
+ .visible-lg-inline-block {
+ display: inline-block !important;
+ }
+}
+@media (max-width: 767px) {
+ .hidden-xs {
+ display: none !important;
+ }
+}
+@media (min-width: 768px) and (max-width: 991px) {
+ .hidden-sm {
+ display: none !important;
+ }
+}
+@media (min-width: 992px) and (max-width: 1199px) {
+ .hidden-md {
+ display: none !important;
+ }
+}
+@media (min-width: 1200px) {
+ .hidden-lg {
+ display: none !important;
+ }
+}
+.visible-print {
+ display: none !important;
+}
+@media print {
+ .visible-print {
+ display: block !important;
+ }
+ table.visible-print {
+ display: table;
+ }
+ tr.visible-print {
+ display: table-row !important;
+ }
+ th.visible-print,
+ td.visible-print {
+ display: table-cell !important;
+ }
+}
+.visible-print-block {
+ display: none !important;
+}
+@media print {
+ .visible-print-block {
+ display: block !important;
+ }
+}
+.visible-print-inline {
+ display: none !important;
+}
+@media print {
+ .visible-print-inline {
+ display: inline !important;
+ }
+}
+.visible-print-inline-block {
+ display: none !important;
+}
+@media print {
+ .visible-print-inline-block {
+ display: inline-block !important;
+ }
+}
+@media print {
+ .hidden-print {
+ display: none !important;
+ }
+}
+/*# sourceMappingURL=bootstrap.css.map */
diff --git a/mutalyzer/website/templates/static/css/bootstrap.min.css b/mutalyzer/website/templates/static/css/bootstrap.min.css
new file mode 100644
index 0000000000000000000000000000000000000000..11ece3129f9da7dfc173be9a85c26064fc955b9d
--- /dev/null
+++ b/mutalyzer/website/templates/static/css/bootstrap.min.css
@@ -0,0 +1,5 @@
+/*!
+ * Bootstrap v3.2.0 (http://getbootstrap.com)
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ *//*! normalize.css v3.0.1 | MIT License | git.io/normalize */html{font-family:sans-serif;-webkit-text-size-adjust:100%;-ms-text-size-adjust:100%}body{margin:0}article,aside,details,figcaption,figure,footer,header,hgroup,main,nav,section,summary{display:block}audio,canvas,progress,video{display:inline-block;vertical-align:baseline}audio:not([controls]){display:none;height:0}[hidden],template{display:none}a{background:transparent}a:active,a:hover{outline:0}abbr[title]{border-bottom:1px dotted}b,strong{font-weight:700}dfn{font-style:italic}h1{margin:.67em 0;font-size:2em}mark{color:#000;background:#ff0}small{font-size:80%}sub,sup{position:relative;font-size:75%;line-height:0;vertical-align:baseline}sup{top:-.5em}sub{bottom:-.25em}img{border:0}svg:not(:root){overflow:hidden}figure{margin:1em 40px}hr{height:0;-webkit-box-sizing:content-box;-moz-box-sizing:content-box;box-sizing:content-box}pre{overflow:auto}code,kbd,pre,samp{font-family:monospace,monospace;font-size:1em}button,input,optgroup,select,textarea{margin:0;font:inherit;color:inherit}button{overflow:visible}button,select{text-transform:none}button,html input[type=button],input[type=reset],input[type=submit]{-webkit-appearance:button;cursor:pointer}button[disabled],html input[disabled]{cursor:default}button::-moz-focus-inner,input::-moz-focus-inner{padding:0;border:0}input{line-height:normal}input[type=checkbox],input[type=radio]{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box;padding:0}input[type=number]::-webkit-inner-spin-button,input[type=number]::-webkit-outer-spin-button{height:auto}input[type=search]{-webkit-box-sizing:content-box;-moz-box-sizing:content-box;box-sizing:content-box;-webkit-appearance:textfield}input[type=search]::-webkit-search-cancel-button,input[type=search]::-webkit-search-decoration{-webkit-appearance:none}fieldset{padding:.35em .625em .75em;margin:0 2px;border:1px solid silver}legend{padding:0;border:0}textarea{overflow:auto}optgroup{font-weight:700}table{border-spacing:0;border-collapse:collapse}td,th{padding:0}@media print{*{color:#000!important;text-shadow:none!important;background:transparent!important;-webkit-box-shadow:none!important;box-shadow:none!important}a,a:visited{text-decoration:underline}a[href]:after{content:" (" attr(href) ")"}abbr[title]:after{content:" (" attr(title) ")"}a[href^="javascript:"]:after,a[href^="#"]:after{content:""}pre,blockquote{border:1px solid #999;page-break-inside:avoid}thead{display:table-header-group}tr,img{page-break-inside:avoid}img{max-width:100%!important}p,h2,h3{orphans:3;widows:3}h2,h3{page-break-after:avoid}select{background:#fff!important}.navbar{display:none}.table td,.table th{background-color:#fff!important}.btn>.caret,.dropup>.btn>.caret{border-top-color:#000!important}.label{border:1px solid #000}.table{border-collapse:collapse!important}.table-bordered th,.table-bordered td{border:1px solid #ddd!important}}@font-face{font-family:'Glyphicons Halflings';src:url(../fonts/glyphicons-halflings-regular.eot);src:url(../fonts/glyphicons-halflings-regular.eot?#iefix) format('embedded-opentype'),url(../fonts/glyphicons-halflings-regular.woff) format('woff'),url(../fonts/glyphicons-halflings-regular.ttf) format('truetype'),url(../fonts/glyphicons-halflings-regular.svg#glyphicons_halflingsregular) format('svg')}.glyphicon{position:relative;top:1px;display:inline-block;font-family:'Glyphicons Halflings';font-style:normal;font-weight:400;line-height:1;-webkit-font-smoothing:antialiased;-moz-osx-font-smoothing:grayscale}.glyphicon-asterisk:before{content:"\2a"}.glyphicon-plus:before{content:"\2b"}.glyphicon-euro:before{content:"\20ac"}.glyphicon-minus:before{content:"\2212"}.glyphicon-cloud:before{content:"\2601"}.glyphicon-envelope:before{content:"\2709"}.glyphicon-pencil:before{content:"\270f"}.glyphicon-glass:before{content:"\e001"}.glyphicon-music:before{content:"\e002"}.glyphicon-search:before{content:"\e003"}.glyphicon-heart:before{content:"\e005"}.glyphicon-star:before{content:"\e006"}.glyphicon-star-empty:before{content:"\e007"}.glyphicon-user:before{content:"\e008"}.glyphicon-film:before{content:"\e009"}.glyphicon-th-large:before{content:"\e010"}.glyphicon-th:before{content:"\e011"}.glyphicon-th-list:before{content:"\e012"}.glyphicon-ok:before{content:"\e013"}.glyphicon-remove:before{content:"\e014"}.glyphicon-zoom-in:before{content:"\e015"}.glyphicon-zoom-out:before{content:"\e016"}.glyphicon-off:before{content:"\e017"}.glyphicon-signal:before{content:"\e018"}.glyphicon-cog:before{content:"\e019"}.glyphicon-trash:before{content:"\e020"}.glyphicon-home:before{content:"\e021"}.glyphicon-file:before{content:"\e022"}.glyphicon-time:before{content:"\e023"}.glyphicon-road:before{content:"\e024"}.glyphicon-download-alt:before{content:"\e025"}.glyphicon-download:before{content:"\e026"}.glyphicon-upload:before{content:"\e027"}.glyphicon-inbox:before{content:"\e028"}.glyphicon-play-circle:before{content:"\e029"}.glyphicon-repeat:before{content:"\e030"}.glyphicon-refresh:before{content:"\e031"}.glyphicon-list-alt:before{content:"\e032"}.glyphicon-lock:before{content:"\e033"}.glyphicon-flag:before{content:"\e034"}.glyphicon-headphones:before{content:"\e035"}.glyphicon-volume-off:before{content:"\e036"}.glyphicon-volume-down:before{content:"\e037"}.glyphicon-volume-up:before{content:"\e038"}.glyphicon-qrcode:before{content:"\e039"}.glyphicon-barcode:before{content:"\e040"}.glyphicon-tag:before{content:"\e041"}.glyphicon-tags:before{content:"\e042"}.glyphicon-book:before{content:"\e043"}.glyphicon-bookmark:before{content:"\e044"}.glyphicon-print:before{content:"\e045"}.glyphicon-camera:before{content:"\e046"}.glyphicon-font:before{content:"\e047"}.glyphicon-bold:before{content:"\e048"}.glyphicon-italic:before{content:"\e049"}.glyphicon-text-height:before{content:"\e050"}.glyphicon-text-width:before{content:"\e051"}.glyphicon-align-left:before{content:"\e052"}.glyphicon-align-center:before{content:"\e053"}.glyphicon-align-right:before{content:"\e054"}.glyphicon-align-justify:before{content:"\e055"}.glyphicon-list:before{content:"\e056"}.glyphicon-indent-left:before{content:"\e057"}.glyphicon-indent-right:before{content:"\e058"}.glyphicon-facetime-video:before{content:"\e059"}.glyphicon-picture:before{content:"\e060"}.glyphicon-map-marker:before{content:"\e062"}.glyphicon-adjust:before{content:"\e063"}.glyphicon-tint:before{content:"\e064"}.glyphicon-edit:before{content:"\e065"}.glyphicon-share:before{content:"\e066"}.glyphicon-check:before{content:"\e067"}.glyphicon-move:before{content:"\e068"}.glyphicon-step-backward:before{content:"\e069"}.glyphicon-fast-backward:before{content:"\e070"}.glyphicon-backward:before{content:"\e071"}.glyphicon-play:before{content:"\e072"}.glyphicon-pause:before{content:"\e073"}.glyphicon-stop:before{content:"\e074"}.glyphicon-forward:before{content:"\e075"}.glyphicon-fast-forward:before{content:"\e076"}.glyphicon-step-forward:before{content:"\e077"}.glyphicon-eject:before{content:"\e078"}.glyphicon-chevron-left:before{content:"\e079"}.glyphicon-chevron-right:before{content:"\e080"}.glyphicon-plus-sign:before{content:"\e081"}.glyphicon-minus-sign:before{content:"\e082"}.glyphicon-remove-sign:before{content:"\e083"}.glyphicon-ok-sign:before{content:"\e084"}.glyphicon-question-sign:before{content:"\e085"}.glyphicon-info-sign:before{content:"\e086"}.glyphicon-screenshot:before{content:"\e087"}.glyphicon-remove-circle:before{content:"\e088"}.glyphicon-ok-circle:before{content:"\e089"}.glyphicon-ban-circle:before{content:"\e090"}.glyphicon-arrow-left:before{content:"\e091"}.glyphicon-arrow-right:before{content:"\e092"}.glyphicon-arrow-up:before{content:"\e093"}.glyphicon-arrow-down:before{content:"\e094"}.glyphicon-share-alt:before{content:"\e095"}.glyphicon-resize-full:before{content:"\e096"}.glyphicon-resize-small:before{content:"\e097"}.glyphicon-exclamation-sign:before{content:"\e101"}.glyphicon-gift:before{content:"\e102"}.glyphicon-leaf:before{content:"\e103"}.glyphicon-fire:before{content:"\e104"}.glyphicon-eye-open:before{content:"\e105"}.glyphicon-eye-close:before{content:"\e106"}.glyphicon-warning-sign:before{content:"\e107"}.glyphicon-plane:before{content:"\e108"}.glyphicon-calendar:before{content:"\e109"}.glyphicon-random:before{content:"\e110"}.glyphicon-comment:before{content:"\e111"}.glyphicon-magnet:before{content:"\e112"}.glyphicon-chevron-up:before{content:"\e113"}.glyphicon-chevron-down:before{content:"\e114"}.glyphicon-retweet:before{content:"\e115"}.glyphicon-shopping-cart:before{content:"\e116"}.glyphicon-folder-close:before{content:"\e117"}.glyphicon-folder-open:before{content:"\e118"}.glyphicon-resize-vertical:before{content:"\e119"}.glyphicon-resize-horizontal:before{content:"\e120"}.glyphicon-hdd:before{content:"\e121"}.glyphicon-bullhorn:before{content:"\e122"}.glyphicon-bell:before{content:"\e123"}.glyphicon-certificate:before{content:"\e124"}.glyphicon-thumbs-up:before{content:"\e125"}.glyphicon-thumbs-down:before{content:"\e126"}.glyphicon-hand-right:before{content:"\e127"}.glyphicon-hand-left:before{content:"\e128"}.glyphicon-hand-up:before{content:"\e129"}.glyphicon-hand-down:before{content:"\e130"}.glyphicon-circle-arrow-right:before{content:"\e131"}.glyphicon-circle-arrow-left:before{content:"\e132"}.glyphicon-circle-arrow-up:before{content:"\e133"}.glyphicon-circle-arrow-down:before{content:"\e134"}.glyphicon-globe:before{content:"\e135"}.glyphicon-wrench:before{content:"\e136"}.glyphicon-tasks:before{content:"\e137"}.glyphicon-filter:before{content:"\e138"}.glyphicon-briefcase:before{content:"\e139"}.glyphicon-fullscreen:before{content:"\e140"}.glyphicon-dashboard:before{content:"\e141"}.glyphicon-paperclip:before{content:"\e142"}.glyphicon-heart-empty:before{content:"\e143"}.glyphicon-link:before{content:"\e144"}.glyphicon-phone:before{content:"\e145"}.glyphicon-pushpin:before{content:"\e146"}.glyphicon-usd:before{content:"\e148"}.glyphicon-gbp:before{content:"\e149"}.glyphicon-sort:before{content:"\e150"}.glyphicon-sort-by-alphabet:before{content:"\e151"}.glyphicon-sort-by-alphabet-alt:before{content:"\e152"}.glyphicon-sort-by-order:before{content:"\e153"}.glyphicon-sort-by-order-alt:before{content:"\e154"}.glyphicon-sort-by-attributes:before{content:"\e155"}.glyphicon-sort-by-attributes-alt:before{content:"\e156"}.glyphicon-unchecked:before{content:"\e157"}.glyphicon-expand:before{content:"\e158"}.glyphicon-collapse-down:before{content:"\e159"}.glyphicon-collapse-up:before{content:"\e160"}.glyphicon-log-in:before{content:"\e161"}.glyphicon-flash:before{content:"\e162"}.glyphicon-log-out:before{content:"\e163"}.glyphicon-new-window:before{content:"\e164"}.glyphicon-record:before{content:"\e165"}.glyphicon-save:before{content:"\e166"}.glyphicon-open:before{content:"\e167"}.glyphicon-saved:before{content:"\e168"}.glyphicon-import:before{content:"\e169"}.glyphicon-export:before{content:"\e170"}.glyphicon-send:before{content:"\e171"}.glyphicon-floppy-disk:before{content:"\e172"}.glyphicon-floppy-saved:before{content:"\e173"}.glyphicon-floppy-remove:before{content:"\e174"}.glyphicon-floppy-save:before{content:"\e175"}.glyphicon-floppy-open:before{content:"\e176"}.glyphicon-credit-card:before{content:"\e177"}.glyphicon-transfer:before{content:"\e178"}.glyphicon-cutlery:before{content:"\e179"}.glyphicon-header:before{content:"\e180"}.glyphicon-compressed:before{content:"\e181"}.glyphicon-earphone:before{content:"\e182"}.glyphicon-phone-alt:before{content:"\e183"}.glyphicon-tower:before{content:"\e184"}.glyphicon-stats:before{content:"\e185"}.glyphicon-sd-video:before{content:"\e186"}.glyphicon-hd-video:before{content:"\e187"}.glyphicon-subtitles:before{content:"\e188"}.glyphicon-sound-stereo:before{content:"\e189"}.glyphicon-sound-dolby:before{content:"\e190"}.glyphicon-sound-5-1:before{content:"\e191"}.glyphicon-sound-6-1:before{content:"\e192"}.glyphicon-sound-7-1:before{content:"\e193"}.glyphicon-copyright-mark:before{content:"\e194"}.glyphicon-registration-mark:before{content:"\e195"}.glyphicon-cloud-download:before{content:"\e197"}.glyphicon-cloud-upload:before{content:"\e198"}.glyphicon-tree-conifer:before{content:"\e199"}.glyphicon-tree-deciduous:before{content:"\e200"}*{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}:before,:after{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}html{font-size:10px;-webkit-tap-highlight-color:rgba(0,0,0,0)}body{font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;font-size:14px;line-height:1.42857143;color:#333;background-color:#fff}input,button,select,textarea{font-family:inherit;font-size:inherit;line-height:inherit}a{color:#428bca;text-decoration:none}a:hover,a:focus{color:#2a6496;text-decoration:underline}a:focus{outline:thin dotted;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}figure{margin:0}img{vertical-align:middle}.img-responsive,.thumbnail>img,.thumbnail a>img,.carousel-inner>.item>img,.carousel-inner>.item>a>img{display:block;width:100% \9;max-width:100%;height:auto}.img-rounded{border-radius:6px}.img-thumbnail{display:inline-block;width:100% \9;max-width:100%;height:auto;padding:4px;line-height:1.42857143;background-color:#fff;border:1px solid #ddd;border-radius:4px;-webkit-transition:all .2s ease-in-out;-o-transition:all .2s ease-in-out;transition:all .2s ease-in-out}.img-circle{border-radius:50%}hr{margin-top:20px;margin-bottom:20px;border:0;border-top:1px solid #eee}.sr-only{position:absolute;width:1px;height:1px;padding:0;margin:-1px;overflow:hidden;clip:rect(0,0,0,0);border:0}.sr-only-focusable:active,.sr-only-focusable:focus{position:static;width:auto;height:auto;margin:0;overflow:visible;clip:auto}h1,h2,h3,h4,h5,h6,.h1,.h2,.h3,.h4,.h5,.h6{font-family:inherit;font-weight:500;line-height:1.1;color:inherit}h1 small,h2 small,h3 small,h4 small,h5 small,h6 small,.h1 small,.h2 small,.h3 small,.h4 small,.h5 small,.h6 small,h1 .small,h2 .small,h3 .small,h4 .small,h5 .small,h6 .small,.h1 .small,.h2 .small,.h3 .small,.h4 .small,.h5 .small,.h6 .small{font-weight:400;line-height:1;color:#777}h1,.h1,h2,.h2,h3,.h3{margin-top:20px;margin-bottom:10px}h1 small,.h1 small,h2 small,.h2 small,h3 small,.h3 small,h1 .small,.h1 .small,h2 .small,.h2 .small,h3 .small,.h3 .small{font-size:65%}h4,.h4,h5,.h5,h6,.h6{margin-top:10px;margin-bottom:10px}h4 small,.h4 small,h5 small,.h5 small,h6 small,.h6 small,h4 .small,.h4 .small,h5 .small,.h5 .small,h6 .small,.h6 .small{font-size:75%}h1,.h1{font-size:36px}h2,.h2{font-size:30px}h3,.h3{font-size:24px}h4,.h4{font-size:18px}h5,.h5{font-size:14px}h6,.h6{font-size:12px}p{margin:0 0 10px}.lead{margin-bottom:20px;font-size:16px;font-weight:300;line-height:1.4}@media (min-width:768px){.lead{font-size:21px}}small,.small{font-size:85%}cite{font-style:normal}mark,.mark{padding:.2em;background-color:#fcf8e3}.text-left{text-align:left}.text-right{text-align:right}.text-center{text-align:center}.text-justify{text-align:justify}.text-nowrap{white-space:nowrap}.text-lowercase{text-transform:lowercase}.text-uppercase{text-transform:uppercase}.text-capitalize{text-transform:capitalize}.text-muted{color:#777}.text-primary{color:#428bca}a.text-primary:hover{color:#3071a9}.text-success{color:#3c763d}a.text-success:hover{color:#2b542c}.text-info{color:#31708f}a.text-info:hover{color:#245269}.text-warning{color:#8a6d3b}a.text-warning:hover{color:#66512c}.text-danger{color:#a94442}a.text-danger:hover{color:#843534}.bg-primary{color:#fff;background-color:#428bca}a.bg-primary:hover{background-color:#3071a9}.bg-success{background-color:#dff0d8}a.bg-success:hover{background-color:#c1e2b3}.bg-info{background-color:#d9edf7}a.bg-info:hover{background-color:#afd9ee}.bg-warning{background-color:#fcf8e3}a.bg-warning:hover{background-color:#f7ecb5}.bg-danger{background-color:#f2dede}a.bg-danger:hover{background-color:#e4b9b9}.page-header{padding-bottom:9px;margin:40px 0 20px;border-bottom:1px solid #eee}ul,ol{margin-top:0;margin-bottom:10px}ul ul,ol ul,ul ol,ol ol{margin-bottom:0}.list-unstyled{padding-left:0;list-style:none}.list-inline{padding-left:0;margin-left:-5px;list-style:none}.list-inline>li{display:inline-block;padding-right:5px;padding-left:5px}dl{margin-top:0;margin-bottom:20px}dt,dd{line-height:1.42857143}dt{font-weight:700}dd{margin-left:0}@media (min-width:862px){.dl-horizontal dt{float:left;width:160px;overflow:hidden;clear:left;text-align:right;text-overflow:ellipsis;white-space:nowrap}.dl-horizontal dd{margin-left:180px}}abbr[title],abbr[data-original-title]{cursor:help;border-bottom:1px dotted #777}.initialism{font-size:90%;text-transform:uppercase}blockquote{padding:10px 20px;margin:0 0 20px;font-size:17.5px;border-left:5px solid #eee}blockquote p:last-child,blockquote ul:last-child,blockquote ol:last-child{margin-bottom:0}blockquote footer,blockquote small,blockquote .small{display:block;font-size:80%;line-height:1.42857143;color:#777}blockquote footer:before,blockquote small:before,blockquote .small:before{content:'\2014 \00A0'}.blockquote-reverse,blockquote.pull-right{padding-right:15px;padding-left:0;text-align:right;border-right:5px solid #eee;border-left:0}.blockquote-reverse footer:before,blockquote.pull-right footer:before,.blockquote-reverse small:before,blockquote.pull-right small:before,.blockquote-reverse .small:before,blockquote.pull-right .small:before{content:''}.blockquote-reverse footer:after,blockquote.pull-right footer:after,.blockquote-reverse small:after,blockquote.pull-right small:after,.blockquote-reverse .small:after,blockquote.pull-right .small:after{content:'\00A0 \2014'}blockquote:before,blockquote:after{content:""}address{margin-bottom:20px;font-style:normal;line-height:1.42857143}code,kbd,pre,samp{font-family:Menlo,Monaco,Consolas,"Courier New",monospace}code{padding:2px 4px;font-size:90%;color:#c7254e;background-color:#f9f2f4;border-radius:4px}kbd{padding:2px 4px;font-size:90%;color:#fff;background-color:#333;border-radius:3px;-webkit-box-shadow:inset 0 -1px 0 rgba(0,0,0,.25);box-shadow:inset 0 -1px 0 rgba(0,0,0,.25)}kbd kbd{padding:0;font-size:100%;-webkit-box-shadow:none;box-shadow:none}pre{display:block;padding:9.5px;margin:0 0 10px;font-size:13px;line-height:1.42857143;color:#333;word-break:break-all;word-wrap:break-word;background-color:#f5f5f5;border:1px solid #ccc;border-radius:4px}pre code{padding:0;font-size:inherit;color:inherit;white-space:pre-wrap;background-color:transparent;border-radius:0}.pre-scrollable{max-height:340px;overflow-y:scroll}.container{padding-right:15px;padding-left:15px;margin-right:auto;margin-left:auto}@media (min-width:768px){.container{width:750px}}@media (min-width:992px){.container{width:970px}}@media (min-width:1200px){.container{width:1170px}}.container-fluid{padding-right:15px;padding-left:15px;margin-right:auto;margin-left:auto}.row{margin-right:-15px;margin-left:-15px}.col-xs-1,.col-sm-1,.col-md-1,.col-lg-1,.col-xs-2,.col-sm-2,.col-md-2,.col-lg-2,.col-xs-3,.col-sm-3,.col-md-3,.col-lg-3,.col-xs-4,.col-sm-4,.col-md-4,.col-lg-4,.col-xs-5,.col-sm-5,.col-md-5,.col-lg-5,.col-xs-6,.col-sm-6,.col-md-6,.col-lg-6,.col-xs-7,.col-sm-7,.col-md-7,.col-lg-7,.col-xs-8,.col-sm-8,.col-md-8,.col-lg-8,.col-xs-9,.col-sm-9,.col-md-9,.col-lg-9,.col-xs-10,.col-sm-10,.col-md-10,.col-lg-10,.col-xs-11,.col-sm-11,.col-md-11,.col-lg-11,.col-xs-12,.col-sm-12,.col-md-12,.col-lg-12{position:relative;min-height:1px;padding-right:15px;padding-left:15px}.col-xs-1,.col-xs-2,.col-xs-3,.col-xs-4,.col-xs-5,.col-xs-6,.col-xs-7,.col-xs-8,.col-xs-9,.col-xs-10,.col-xs-11,.col-xs-12{float:left}.col-xs-12{width:100%}.col-xs-11{width:91.66666667%}.col-xs-10{width:83.33333333%}.col-xs-9{width:75%}.col-xs-8{width:66.66666667%}.col-xs-7{width:58.33333333%}.col-xs-6{width:50%}.col-xs-5{width:41.66666667%}.col-xs-4{width:33.33333333%}.col-xs-3{width:25%}.col-xs-2{width:16.66666667%}.col-xs-1{width:8.33333333%}.col-xs-pull-12{right:100%}.col-xs-pull-11{right:91.66666667%}.col-xs-pull-10{right:83.33333333%}.col-xs-pull-9{right:75%}.col-xs-pull-8{right:66.66666667%}.col-xs-pull-7{right:58.33333333%}.col-xs-pull-6{right:50%}.col-xs-pull-5{right:41.66666667%}.col-xs-pull-4{right:33.33333333%}.col-xs-pull-3{right:25%}.col-xs-pull-2{right:16.66666667%}.col-xs-pull-1{right:8.33333333%}.col-xs-pull-0{right:auto}.col-xs-push-12{left:100%}.col-xs-push-11{left:91.66666667%}.col-xs-push-10{left:83.33333333%}.col-xs-push-9{left:75%}.col-xs-push-8{left:66.66666667%}.col-xs-push-7{left:58.33333333%}.col-xs-push-6{left:50%}.col-xs-push-5{left:41.66666667%}.col-xs-push-4{left:33.33333333%}.col-xs-push-3{left:25%}.col-xs-push-2{left:16.66666667%}.col-xs-push-1{left:8.33333333%}.col-xs-push-0{left:auto}.col-xs-offset-12{margin-left:100%}.col-xs-offset-11{margin-left:91.66666667%}.col-xs-offset-10{margin-left:83.33333333%}.col-xs-offset-9{margin-left:75%}.col-xs-offset-8{margin-left:66.66666667%}.col-xs-offset-7{margin-left:58.33333333%}.col-xs-offset-6{margin-left:50%}.col-xs-offset-5{margin-left:41.66666667%}.col-xs-offset-4{margin-left:33.33333333%}.col-xs-offset-3{margin-left:25%}.col-xs-offset-2{margin-left:16.66666667%}.col-xs-offset-1{margin-left:8.33333333%}.col-xs-offset-0{margin-left:0}@media (min-width:768px){.col-sm-1,.col-sm-2,.col-sm-3,.col-sm-4,.col-sm-5,.col-sm-6,.col-sm-7,.col-sm-8,.col-sm-9,.col-sm-10,.col-sm-11,.col-sm-12{float:left}.col-sm-12{width:100%}.col-sm-11{width:91.66666667%}.col-sm-10{width:83.33333333%}.col-sm-9{width:75%}.col-sm-8{width:66.66666667%}.col-sm-7{width:58.33333333%}.col-sm-6{width:50%}.col-sm-5{width:41.66666667%}.col-sm-4{width:33.33333333%}.col-sm-3{width:25%}.col-sm-2{width:16.66666667%}.col-sm-1{width:8.33333333%}.col-sm-pull-12{right:100%}.col-sm-pull-11{right:91.66666667%}.col-sm-pull-10{right:83.33333333%}.col-sm-pull-9{right:75%}.col-sm-pull-8{right:66.66666667%}.col-sm-pull-7{right:58.33333333%}.col-sm-pull-6{right:50%}.col-sm-pull-5{right:41.66666667%}.col-sm-pull-4{right:33.33333333%}.col-sm-pull-3{right:25%}.col-sm-pull-2{right:16.66666667%}.col-sm-pull-1{right:8.33333333%}.col-sm-pull-0{right:auto}.col-sm-push-12{left:100%}.col-sm-push-11{left:91.66666667%}.col-sm-push-10{left:83.33333333%}.col-sm-push-9{left:75%}.col-sm-push-8{left:66.66666667%}.col-sm-push-7{left:58.33333333%}.col-sm-push-6{left:50%}.col-sm-push-5{left:41.66666667%}.col-sm-push-4{left:33.33333333%}.col-sm-push-3{left:25%}.col-sm-push-2{left:16.66666667%}.col-sm-push-1{left:8.33333333%}.col-sm-push-0{left:auto}.col-sm-offset-12{margin-left:100%}.col-sm-offset-11{margin-left:91.66666667%}.col-sm-offset-10{margin-left:83.33333333%}.col-sm-offset-9{margin-left:75%}.col-sm-offset-8{margin-left:66.66666667%}.col-sm-offset-7{margin-left:58.33333333%}.col-sm-offset-6{margin-left:50%}.col-sm-offset-5{margin-left:41.66666667%}.col-sm-offset-4{margin-left:33.33333333%}.col-sm-offset-3{margin-left:25%}.col-sm-offset-2{margin-left:16.66666667%}.col-sm-offset-1{margin-left:8.33333333%}.col-sm-offset-0{margin-left:0}}@media (min-width:992px){.col-md-1,.col-md-2,.col-md-3,.col-md-4,.col-md-5,.col-md-6,.col-md-7,.col-md-8,.col-md-9,.col-md-10,.col-md-11,.col-md-12{float:left}.col-md-12{width:100%}.col-md-11{width:91.66666667%}.col-md-10{width:83.33333333%}.col-md-9{width:75%}.col-md-8{width:66.66666667%}.col-md-7{width:58.33333333%}.col-md-6{width:50%}.col-md-5{width:41.66666667%}.col-md-4{width:33.33333333%}.col-md-3{width:25%}.col-md-2{width:16.66666667%}.col-md-1{width:8.33333333%}.col-md-pull-12{right:100%}.col-md-pull-11{right:91.66666667%}.col-md-pull-10{right:83.33333333%}.col-md-pull-9{right:75%}.col-md-pull-8{right:66.66666667%}.col-md-pull-7{right:58.33333333%}.col-md-pull-6{right:50%}.col-md-pull-5{right:41.66666667%}.col-md-pull-4{right:33.33333333%}.col-md-pull-3{right:25%}.col-md-pull-2{right:16.66666667%}.col-md-pull-1{right:8.33333333%}.col-md-pull-0{right:auto}.col-md-push-12{left:100%}.col-md-push-11{left:91.66666667%}.col-md-push-10{left:83.33333333%}.col-md-push-9{left:75%}.col-md-push-8{left:66.66666667%}.col-md-push-7{left:58.33333333%}.col-md-push-6{left:50%}.col-md-push-5{left:41.66666667%}.col-md-push-4{left:33.33333333%}.col-md-push-3{left:25%}.col-md-push-2{left:16.66666667%}.col-md-push-1{left:8.33333333%}.col-md-push-0{left:auto}.col-md-offset-12{margin-left:100%}.col-md-offset-11{margin-left:91.66666667%}.col-md-offset-10{margin-left:83.33333333%}.col-md-offset-9{margin-left:75%}.col-md-offset-8{margin-left:66.66666667%}.col-md-offset-7{margin-left:58.33333333%}.col-md-offset-6{margin-left:50%}.col-md-offset-5{margin-left:41.66666667%}.col-md-offset-4{margin-left:33.33333333%}.col-md-offset-3{margin-left:25%}.col-md-offset-2{margin-left:16.66666667%}.col-md-offset-1{margin-left:8.33333333%}.col-md-offset-0{margin-left:0}}@media (min-width:1200px){.col-lg-1,.col-lg-2,.col-lg-3,.col-lg-4,.col-lg-5,.col-lg-6,.col-lg-7,.col-lg-8,.col-lg-9,.col-lg-10,.col-lg-11,.col-lg-12{float:left}.col-lg-12{width:100%}.col-lg-11{width:91.66666667%}.col-lg-10{width:83.33333333%}.col-lg-9{width:75%}.col-lg-8{width:66.66666667%}.col-lg-7{width:58.33333333%}.col-lg-6{width:50%}.col-lg-5{width:41.66666667%}.col-lg-4{width:33.33333333%}.col-lg-3{width:25%}.col-lg-2{width:16.66666667%}.col-lg-1{width:8.33333333%}.col-lg-pull-12{right:100%}.col-lg-pull-11{right:91.66666667%}.col-lg-pull-10{right:83.33333333%}.col-lg-pull-9{right:75%}.col-lg-pull-8{right:66.66666667%}.col-lg-pull-7{right:58.33333333%}.col-lg-pull-6{right:50%}.col-lg-pull-5{right:41.66666667%}.col-lg-pull-4{right:33.33333333%}.col-lg-pull-3{right:25%}.col-lg-pull-2{right:16.66666667%}.col-lg-pull-1{right:8.33333333%}.col-lg-pull-0{right:auto}.col-lg-push-12{left:100%}.col-lg-push-11{left:91.66666667%}.col-lg-push-10{left:83.33333333%}.col-lg-push-9{left:75%}.col-lg-push-8{left:66.66666667%}.col-lg-push-7{left:58.33333333%}.col-lg-push-6{left:50%}.col-lg-push-5{left:41.66666667%}.col-lg-push-4{left:33.33333333%}.col-lg-push-3{left:25%}.col-lg-push-2{left:16.66666667%}.col-lg-push-1{left:8.33333333%}.col-lg-push-0{left:auto}.col-lg-offset-12{margin-left:100%}.col-lg-offset-11{margin-left:91.66666667%}.col-lg-offset-10{margin-left:83.33333333%}.col-lg-offset-9{margin-left:75%}.col-lg-offset-8{margin-left:66.66666667%}.col-lg-offset-7{margin-left:58.33333333%}.col-lg-offset-6{margin-left:50%}.col-lg-offset-5{margin-left:41.66666667%}.col-lg-offset-4{margin-left:33.33333333%}.col-lg-offset-3{margin-left:25%}.col-lg-offset-2{margin-left:16.66666667%}.col-lg-offset-1{margin-left:8.33333333%}.col-lg-offset-0{margin-left:0}}table{background-color:transparent}th{text-align:left}.table{width:100%;max-width:100%;margin-bottom:20px}.table>thead>tr>th,.table>tbody>tr>th,.table>tfoot>tr>th,.table>thead>tr>td,.table>tbody>tr>td,.table>tfoot>tr>td{padding:8px;line-height:1.42857143;vertical-align:top;border-top:1px solid #ddd}.table>thead>tr>th{vertical-align:bottom;border-bottom:2px solid #ddd}.table>caption+thead>tr:first-child>th,.table>colgroup+thead>tr:first-child>th,.table>thead:first-child>tr:first-child>th,.table>caption+thead>tr:first-child>td,.table>colgroup+thead>tr:first-child>td,.table>thead:first-child>tr:first-child>td{border-top:0}.table>tbody+tbody{border-top:2px solid #ddd}.table .table{background-color:#fff}.table-condensed>thead>tr>th,.table-condensed>tbody>tr>th,.table-condensed>tfoot>tr>th,.table-condensed>thead>tr>td,.table-condensed>tbody>tr>td,.table-condensed>tfoot>tr>td{padding:5px}.table-bordered{border:1px solid #ddd}.table-bordered>thead>tr>th,.table-bordered>tbody>tr>th,.table-bordered>tfoot>tr>th,.table-bordered>thead>tr>td,.table-bordered>tbody>tr>td,.table-bordered>tfoot>tr>td{border:1px solid #ddd}.table-bordered>thead>tr>th,.table-bordered>thead>tr>td{border-bottom-width:2px}.table-striped>tbody>tr:nth-child(odd)>td,.table-striped>tbody>tr:nth-child(odd)>th{background-color:#f9f9f9}.table-hover>tbody>tr:hover>td,.table-hover>tbody>tr:hover>th{background-color:#f5f5f5}table col[class*=col-]{position:static;display:table-column;float:none}table td[class*=col-],table th[class*=col-]{position:static;display:table-cell;float:none}.table>thead>tr>td.active,.table>tbody>tr>td.active,.table>tfoot>tr>td.active,.table>thead>tr>th.active,.table>tbody>tr>th.active,.table>tfoot>tr>th.active,.table>thead>tr.active>td,.table>tbody>tr.active>td,.table>tfoot>tr.active>td,.table>thead>tr.active>th,.table>tbody>tr.active>th,.table>tfoot>tr.active>th{background-color:#f5f5f5}.table-hover>tbody>tr>td.active:hover,.table-hover>tbody>tr>th.active:hover,.table-hover>tbody>tr.active:hover>td,.table-hover>tbody>tr:hover>.active,.table-hover>tbody>tr.active:hover>th{background-color:#e8e8e8}.table>thead>tr>td.success,.table>tbody>tr>td.success,.table>tfoot>tr>td.success,.table>thead>tr>th.success,.table>tbody>tr>th.success,.table>tfoot>tr>th.success,.table>thead>tr.success>td,.table>tbody>tr.success>td,.table>tfoot>tr.success>td,.table>thead>tr.success>th,.table>tbody>tr.success>th,.table>tfoot>tr.success>th{background-color:#dff0d8}.table-hover>tbody>tr>td.success:hover,.table-hover>tbody>tr>th.success:hover,.table-hover>tbody>tr.success:hover>td,.table-hover>tbody>tr:hover>.success,.table-hover>tbody>tr.success:hover>th{background-color:#d0e9c6}.table>thead>tr>td.info,.table>tbody>tr>td.info,.table>tfoot>tr>td.info,.table>thead>tr>th.info,.table>tbody>tr>th.info,.table>tfoot>tr>th.info,.table>thead>tr.info>td,.table>tbody>tr.info>td,.table>tfoot>tr.info>td,.table>thead>tr.info>th,.table>tbody>tr.info>th,.table>tfoot>tr.info>th{background-color:#d9edf7}.table-hover>tbody>tr>td.info:hover,.table-hover>tbody>tr>th.info:hover,.table-hover>tbody>tr.info:hover>td,.table-hover>tbody>tr:hover>.info,.table-hover>tbody>tr.info:hover>th{background-color:#c4e3f3}.table>thead>tr>td.warning,.table>tbody>tr>td.warning,.table>tfoot>tr>td.warning,.table>thead>tr>th.warning,.table>tbody>tr>th.warning,.table>tfoot>tr>th.warning,.table>thead>tr.warning>td,.table>tbody>tr.warning>td,.table>tfoot>tr.warning>td,.table>thead>tr.warning>th,.table>tbody>tr.warning>th,.table>tfoot>tr.warning>th{background-color:#fcf8e3}.table-hover>tbody>tr>td.warning:hover,.table-hover>tbody>tr>th.warning:hover,.table-hover>tbody>tr.warning:hover>td,.table-hover>tbody>tr:hover>.warning,.table-hover>tbody>tr.warning:hover>th{background-color:#faf2cc}.table>thead>tr>td.danger,.table>tbody>tr>td.danger,.table>tfoot>tr>td.danger,.table>thead>tr>th.danger,.table>tbody>tr>th.danger,.table>tfoot>tr>th.danger,.table>thead>tr.danger>td,.table>tbody>tr.danger>td,.table>tfoot>tr.danger>td,.table>thead>tr.danger>th,.table>tbody>tr.danger>th,.table>tfoot>tr.danger>th{background-color:#f2dede}.table-hover>tbody>tr>td.danger:hover,.table-hover>tbody>tr>th.danger:hover,.table-hover>tbody>tr.danger:hover>td,.table-hover>tbody>tr:hover>.danger,.table-hover>tbody>tr.danger:hover>th{background-color:#ebcccc}@media screen and (max-width:767px){.table-responsive{width:100%;margin-bottom:15px;overflow-x:auto;overflow-y:hidden;-webkit-overflow-scrolling:touch;-ms-overflow-style:-ms-autohiding-scrollbar;border:1px solid #ddd}.table-responsive>.table{margin-bottom:0}.table-responsive>.table>thead>tr>th,.table-responsive>.table>tbody>tr>th,.table-responsive>.table>tfoot>tr>th,.table-responsive>.table>thead>tr>td,.table-responsive>.table>tbody>tr>td,.table-responsive>.table>tfoot>tr>td{white-space:nowrap}.table-responsive>.table-bordered{border:0}.table-responsive>.table-bordered>thead>tr>th:first-child,.table-responsive>.table-bordered>tbody>tr>th:first-child,.table-responsive>.table-bordered>tfoot>tr>th:first-child,.table-responsive>.table-bordered>thead>tr>td:first-child,.table-responsive>.table-bordered>tbody>tr>td:first-child,.table-responsive>.table-bordered>tfoot>tr>td:first-child{border-left:0}.table-responsive>.table-bordered>thead>tr>th:last-child,.table-responsive>.table-bordered>tbody>tr>th:last-child,.table-responsive>.table-bordered>tfoot>tr>th:last-child,.table-responsive>.table-bordered>thead>tr>td:last-child,.table-responsive>.table-bordered>tbody>tr>td:last-child,.table-responsive>.table-bordered>tfoot>tr>td:last-child{border-right:0}.table-responsive>.table-bordered>tbody>tr:last-child>th,.table-responsive>.table-bordered>tfoot>tr:last-child>th,.table-responsive>.table-bordered>tbody>tr:last-child>td,.table-responsive>.table-bordered>tfoot>tr:last-child>td{border-bottom:0}}fieldset{min-width:0;padding:0;margin:0;border:0}legend{display:block;width:100%;padding:0;margin-bottom:20px;font-size:21px;line-height:inherit;color:#333;border:0;border-bottom:1px solid #e5e5e5}label{display:inline-block;max-width:100%;margin-bottom:5px;font-weight:700}input[type=search]{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}input[type=radio],input[type=checkbox]{margin:4px 0 0;margin-top:1px \9;line-height:normal}input[type=file]{display:block}input[type=range]{display:block;width:100%}select[multiple],select[size]{height:auto}input[type=file]:focus,input[type=radio]:focus,input[type=checkbox]:focus{outline:thin dotted;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}output{display:block;padding-top:7px;font-size:14px;line-height:1.42857143;color:#555}.form-control{display:block;width:100%;height:34px;padding:6px 12px;font-size:14px;line-height:1.42857143;color:#555;background-color:#fff;background-image:none;border:1px solid #ccc;border-radius:4px;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075);-webkit-transition:border-color ease-in-out .15s,-webkit-box-shadow ease-in-out .15s;-o-transition:border-color ease-in-out .15s,box-shadow ease-in-out .15s;transition:border-color ease-in-out .15s,box-shadow ease-in-out .15s}.form-control:focus{border-color:#66afe9;outline:0;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 8px rgba(102,175,233,.6);box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 8px rgba(102,175,233,.6)}.form-control::-moz-placeholder{color:#777;opacity:1}.form-control:-ms-input-placeholder{color:#777}.form-control::-webkit-input-placeholder{color:#777}.form-control[disabled],.form-control[readonly],fieldset[disabled] .form-control{cursor:not-allowed;background-color:#eee;opacity:1}textarea.form-control{height:auto}input[type=search]{-webkit-appearance:none}input[type=date],input[type=time],input[type=datetime-local],input[type=month]{line-height:34px;line-height:1.42857143 \0}input[type=date].input-sm,input[type=time].input-sm,input[type=datetime-local].input-sm,input[type=month].input-sm{line-height:30px}input[type=date].input-lg,input[type=time].input-lg,input[type=datetime-local].input-lg,input[type=month].input-lg{line-height:46px}.form-group{margin-bottom:15px}.radio,.checkbox{position:relative;display:block;min-height:20px;margin-top:10px;margin-bottom:10px}.radio label,.checkbox label{padding-left:20px;margin-bottom:0;font-weight:400;cursor:pointer}.radio input[type=radio],.radio-inline input[type=radio],.checkbox input[type=checkbox],.checkbox-inline input[type=checkbox]{position:absolute;margin-top:4px \9;margin-left:-20px}.radio+.radio,.checkbox+.checkbox{margin-top:-5px}.radio-inline,.checkbox-inline{display:inline-block;padding-left:20px;margin-bottom:0;font-weight:400;vertical-align:middle;cursor:pointer}.radio-inline+.radio-inline,.checkbox-inline+.checkbox-inline{margin-top:0;margin-left:10px}input[type=radio][disabled],input[type=checkbox][disabled],input[type=radio].disabled,input[type=checkbox].disabled,fieldset[disabled] input[type=radio],fieldset[disabled] input[type=checkbox]{cursor:not-allowed}.radio-inline.disabled,.checkbox-inline.disabled,fieldset[disabled] .radio-inline,fieldset[disabled] .checkbox-inline{cursor:not-allowed}.radio.disabled label,.checkbox.disabled label,fieldset[disabled] .radio label,fieldset[disabled] .checkbox label{cursor:not-allowed}.form-control-static{padding-top:7px;padding-bottom:7px;margin-bottom:0}.form-control-static.input-lg,.form-control-static.input-sm{padding-right:0;padding-left:0}.input-sm,.form-horizontal .form-group-sm .form-control{height:30px;padding:5px 10px;font-size:12px;line-height:1.5;border-radius:3px}select.input-sm{height:30px;line-height:30px}textarea.input-sm,select[multiple].input-sm{height:auto}.input-lg,.form-horizontal .form-group-lg .form-control{height:46px;padding:10px 16px;font-size:18px;line-height:1.33;border-radius:6px}select.input-lg{height:46px;line-height:46px}textarea.input-lg,select[multiple].input-lg{height:auto}.has-feedback{position:relative}.has-feedback .form-control{padding-right:42.5px}.form-control-feedback{position:absolute;top:25px;right:0;z-index:2;display:block;width:34px;height:34px;line-height:34px;text-align:center}.input-lg+.form-control-feedback{width:46px;height:46px;line-height:46px}.input-sm+.form-control-feedback{width:30px;height:30px;line-height:30px}.has-success .help-block,.has-success .control-label,.has-success .radio,.has-success .checkbox,.has-success .radio-inline,.has-success .checkbox-inline{color:#3c763d}.has-success .form-control{border-color:#3c763d;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075)}.has-success .form-control:focus{border-color:#2b542c;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #67b168;box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #67b168}.has-success .input-group-addon{color:#3c763d;background-color:#dff0d8;border-color:#3c763d}.has-success .form-control-feedback{color:#3c763d}.has-warning .help-block,.has-warning .control-label,.has-warning .radio,.has-warning .checkbox,.has-warning .radio-inline,.has-warning .checkbox-inline{color:#8a6d3b}.has-warning .form-control{border-color:#8a6d3b;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075)}.has-warning .form-control:focus{border-color:#66512c;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #c0a16b;box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #c0a16b}.has-warning .input-group-addon{color:#8a6d3b;background-color:#fcf8e3;border-color:#8a6d3b}.has-warning .form-control-feedback{color:#8a6d3b}.has-error .help-block,.has-error .control-label,.has-error .radio,.has-error .checkbox,.has-error .radio-inline,.has-error .checkbox-inline{color:#a94442}.has-error .form-control{border-color:#a94442;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075)}.has-error .form-control:focus{border-color:#843534;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #ce8483;box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #ce8483}.has-error .input-group-addon{color:#a94442;background-color:#f2dede;border-color:#a94442}.has-error .form-control-feedback{color:#a94442}.has-feedback label.sr-only~.form-control-feedback{top:0}.help-block{display:block;margin-top:5px;margin-bottom:10px;color:#737373}@media (min-width:768px){.form-inline .form-group{display:inline-block;margin-bottom:0;vertical-align:middle}.form-inline .form-control{display:inline-block;width:auto;vertical-align:middle}.form-inline .input-group{display:inline-table;vertical-align:middle}.form-inline .input-group .input-group-addon,.form-inline .input-group .input-group-btn,.form-inline .input-group .form-control{width:auto}.form-inline .input-group>.form-control{width:100%}.form-inline .control-label{margin-bottom:0;vertical-align:middle}.form-inline .radio,.form-inline .checkbox{display:inline-block;margin-top:0;margin-bottom:0;vertical-align:middle}.form-inline .radio label,.form-inline .checkbox label{padding-left:0}.form-inline .radio input[type=radio],.form-inline .checkbox input[type=checkbox]{position:relative;margin-left:0}.form-inline .has-feedback .form-control-feedback{top:0}}.form-horizontal .radio,.form-horizontal .checkbox,.form-horizontal .radio-inline,.form-horizontal .checkbox-inline{padding-top:7px;margin-top:0;margin-bottom:0}.form-horizontal .radio,.form-horizontal .checkbox{min-height:27px}.form-horizontal .form-group{margin-right:-15px;margin-left:-15px}@media (min-width:768px){.form-horizontal .control-label{padding-top:7px;margin-bottom:0;text-align:right}}.form-horizontal .has-feedback .form-control-feedback{top:0;right:15px}@media (min-width:768px){.form-horizontal .form-group-lg .control-label{padding-top:14.3px}}@media (min-width:768px){.form-horizontal .form-group-sm .control-label{padding-top:6px}}.btn{display:inline-block;padding:6px 12px;margin-bottom:0;font-size:14px;font-weight:400;line-height:1.42857143;text-align:center;white-space:nowrap;vertical-align:middle;cursor:pointer;-webkit-user-select:none;-moz-user-select:none;-ms-user-select:none;user-select:none;background-image:none;border:1px solid transparent;border-radius:4px}.btn:focus,.btn:active:focus,.btn.active:focus{outline:thin dotted;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}.btn:hover,.btn:focus{color:#333;text-decoration:none}.btn:active,.btn.active{background-image:none;outline:0;-webkit-box-shadow:inset 0 3px 5px rgba(0,0,0,.125);box-shadow:inset 0 3px 5px rgba(0,0,0,.125)}.btn.disabled,.btn[disabled],fieldset[disabled] .btn{pointer-events:none;cursor:not-allowed;filter:alpha(opacity=65);-webkit-box-shadow:none;box-shadow:none;opacity:.65}.btn-default{color:#333;background-color:#fff;border-color:#ccc}.btn-default:hover,.btn-default:focus,.btn-default:active,.btn-default.active,.open>.dropdown-toggle.btn-default{color:#333;background-color:#e6e6e6;border-color:#adadad}.btn-default:active,.btn-default.active,.open>.dropdown-toggle.btn-default{background-image:none}.btn-default.disabled,.btn-default[disabled],fieldset[disabled] .btn-default,.btn-default.disabled:hover,.btn-default[disabled]:hover,fieldset[disabled] .btn-default:hover,.btn-default.disabled:focus,.btn-default[disabled]:focus,fieldset[disabled] .btn-default:focus,.btn-default.disabled:active,.btn-default[disabled]:active,fieldset[disabled] .btn-default:active,.btn-default.disabled.active,.btn-default[disabled].active,fieldset[disabled] .btn-default.active{background-color:#fff;border-color:#ccc}.btn-default .badge{color:#fff;background-color:#333}.btn-primary{color:#fff;background-color:#428bca;border-color:#357ebd}.btn-primary:hover,.btn-primary:focus,.btn-primary:active,.btn-primary.active,.open>.dropdown-toggle.btn-primary{color:#fff;background-color:#3071a9;border-color:#285e8e}.btn-primary:active,.btn-primary.active,.open>.dropdown-toggle.btn-primary{background-image:none}.btn-primary.disabled,.btn-primary[disabled],fieldset[disabled] .btn-primary,.btn-primary.disabled:hover,.btn-primary[disabled]:hover,fieldset[disabled] .btn-primary:hover,.btn-primary.disabled:focus,.btn-primary[disabled]:focus,fieldset[disabled] .btn-primary:focus,.btn-primary.disabled:active,.btn-primary[disabled]:active,fieldset[disabled] .btn-primary:active,.btn-primary.disabled.active,.btn-primary[disabled].active,fieldset[disabled] .btn-primary.active{background-color:#428bca;border-color:#357ebd}.btn-primary .badge{color:#428bca;background-color:#fff}.btn-success{color:#fff;background-color:#5cb85c;border-color:#4cae4c}.btn-success:hover,.btn-success:focus,.btn-success:active,.btn-success.active,.open>.dropdown-toggle.btn-success{color:#fff;background-color:#449d44;border-color:#398439}.btn-success:active,.btn-success.active,.open>.dropdown-toggle.btn-success{background-image:none}.btn-success.disabled,.btn-success[disabled],fieldset[disabled] .btn-success,.btn-success.disabled:hover,.btn-success[disabled]:hover,fieldset[disabled] .btn-success:hover,.btn-success.disabled:focus,.btn-success[disabled]:focus,fieldset[disabled] .btn-success:focus,.btn-success.disabled:active,.btn-success[disabled]:active,fieldset[disabled] .btn-success:active,.btn-success.disabled.active,.btn-success[disabled].active,fieldset[disabled] .btn-success.active{background-color:#5cb85c;border-color:#4cae4c}.btn-success .badge{color:#5cb85c;background-color:#fff}.btn-info{color:#fff;background-color:#5bc0de;border-color:#46b8da}.btn-info:hover,.btn-info:focus,.btn-info:active,.btn-info.active,.open>.dropdown-toggle.btn-info{color:#fff;background-color:#31b0d5;border-color:#269abc}.btn-info:active,.btn-info.active,.open>.dropdown-toggle.btn-info{background-image:none}.btn-info.disabled,.btn-info[disabled],fieldset[disabled] .btn-info,.btn-info.disabled:hover,.btn-info[disabled]:hover,fieldset[disabled] .btn-info:hover,.btn-info.disabled:focus,.btn-info[disabled]:focus,fieldset[disabled] .btn-info:focus,.btn-info.disabled:active,.btn-info[disabled]:active,fieldset[disabled] .btn-info:active,.btn-info.disabled.active,.btn-info[disabled].active,fieldset[disabled] .btn-info.active{background-color:#5bc0de;border-color:#46b8da}.btn-info .badge{color:#5bc0de;background-color:#fff}.btn-warning{color:#fff;background-color:#f0ad4e;border-color:#eea236}.btn-warning:hover,.btn-warning:focus,.btn-warning:active,.btn-warning.active,.open>.dropdown-toggle.btn-warning{color:#fff;background-color:#ec971f;border-color:#d58512}.btn-warning:active,.btn-warning.active,.open>.dropdown-toggle.btn-warning{background-image:none}.btn-warning.disabled,.btn-warning[disabled],fieldset[disabled] .btn-warning,.btn-warning.disabled:hover,.btn-warning[disabled]:hover,fieldset[disabled] .btn-warning:hover,.btn-warning.disabled:focus,.btn-warning[disabled]:focus,fieldset[disabled] .btn-warning:focus,.btn-warning.disabled:active,.btn-warning[disabled]:active,fieldset[disabled] .btn-warning:active,.btn-warning.disabled.active,.btn-warning[disabled].active,fieldset[disabled] .btn-warning.active{background-color:#f0ad4e;border-color:#eea236}.btn-warning .badge{color:#f0ad4e;background-color:#fff}.btn-danger{color:#fff;background-color:#d9534f;border-color:#d43f3a}.btn-danger:hover,.btn-danger:focus,.btn-danger:active,.btn-danger.active,.open>.dropdown-toggle.btn-danger{color:#fff;background-color:#c9302c;border-color:#ac2925}.btn-danger:active,.btn-danger.active,.open>.dropdown-toggle.btn-danger{background-image:none}.btn-danger.disabled,.btn-danger[disabled],fieldset[disabled] .btn-danger,.btn-danger.disabled:hover,.btn-danger[disabled]:hover,fieldset[disabled] .btn-danger:hover,.btn-danger.disabled:focus,.btn-danger[disabled]:focus,fieldset[disabled] .btn-danger:focus,.btn-danger.disabled:active,.btn-danger[disabled]:active,fieldset[disabled] .btn-danger:active,.btn-danger.disabled.active,.btn-danger[disabled].active,fieldset[disabled] .btn-danger.active{background-color:#d9534f;border-color:#d43f3a}.btn-danger .badge{color:#d9534f;background-color:#fff}.btn-link{font-weight:400;color:#428bca;cursor:pointer;border-radius:0}.btn-link,.btn-link:active,.btn-link[disabled],fieldset[disabled] .btn-link{background-color:transparent;-webkit-box-shadow:none;box-shadow:none}.btn-link,.btn-link:hover,.btn-link:focus,.btn-link:active{border-color:transparent}.btn-link:hover,.btn-link:focus{color:#2a6496;text-decoration:underline;background-color:transparent}.btn-link[disabled]:hover,fieldset[disabled] .btn-link:hover,.btn-link[disabled]:focus,fieldset[disabled] .btn-link:focus{color:#777;text-decoration:none}.btn-lg,.btn-group-lg>.btn{padding:10px 16px;font-size:18px;line-height:1.33;border-radius:6px}.btn-sm,.btn-group-sm>.btn{padding:5px 10px;font-size:12px;line-height:1.5;border-radius:3px}.btn-xs,.btn-group-xs>.btn{padding:1px 5px;font-size:12px;line-height:1.5;border-radius:3px}.btn-block{display:block;width:100%}.btn-block+.btn-block{margin-top:5px}input[type=submit].btn-block,input[type=reset].btn-block,input[type=button].btn-block{width:100%}.fade{opacity:0;-webkit-transition:opacity .15s linear;-o-transition:opacity .15s linear;transition:opacity .15s linear}.fade.in{opacity:1}.collapse{display:none}.collapse.in{display:block}tr.collapse.in{display:table-row}tbody.collapse.in{display:table-row-group}.collapsing{position:relative;height:0;overflow:hidden;-webkit-transition:height .35s ease;-o-transition:height .35s ease;transition:height .35s ease}.caret{display:inline-block;width:0;height:0;margin-left:2px;vertical-align:middle;border-top:4px solid;border-right:4px solid transparent;border-left:4px solid transparent}.dropdown{position:relative}.dropdown-toggle:focus{outline:0}.dropdown-menu{position:absolute;top:100%;left:0;z-index:1000;display:none;float:left;min-width:160px;padding:5px 0;margin:2px 0 0;font-size:14px;text-align:left;list-style:none;background-color:#fff;-webkit-background-clip:padding-box;background-clip:padding-box;border:1px solid #ccc;border:1px solid rgba(0,0,0,.15);border-radius:4px;-webkit-box-shadow:0 6px 12px rgba(0,0,0,.175);box-shadow:0 6px 12px rgba(0,0,0,.175)}.dropdown-menu.pull-right{right:0;left:auto}.dropdown-menu .divider{height:1px;margin:9px 0;overflow:hidden;background-color:#e5e5e5}.dropdown-menu>li>a{display:block;padding:3px 20px;clear:both;font-weight:400;line-height:1.42857143;color:#333;white-space:nowrap}.dropdown-menu>li>a:hover,.dropdown-menu>li>a:focus{color:#262626;text-decoration:none;background-color:#f5f5f5}.dropdown-menu>.active>a,.dropdown-menu>.active>a:hover,.dropdown-menu>.active>a:focus{color:#fff;text-decoration:none;background-color:#428bca;outline:0}.dropdown-menu>.disabled>a,.dropdown-menu>.disabled>a:hover,.dropdown-menu>.disabled>a:focus{color:#777}.dropdown-menu>.disabled>a:hover,.dropdown-menu>.disabled>a:focus{text-decoration:none;cursor:not-allowed;background-color:transparent;background-image:none;filter:progid:DXImageTransform.Microsoft.gradient(enabled=false)}.open>.dropdown-menu{display:block}.open>a{outline:0}.dropdown-menu-right{right:0;left:auto}.dropdown-menu-left{right:auto;left:0}.dropdown-header{display:block;padding:3px 20px;font-size:12px;line-height:1.42857143;color:#777;white-space:nowrap}.dropdown-backdrop{position:fixed;top:0;right:0;bottom:0;left:0;z-index:990}.pull-right>.dropdown-menu{right:0;left:auto}.dropup .caret,.navbar-fixed-bottom .dropdown .caret{content:"";border-top:0;border-bottom:4px solid}.dropup .dropdown-menu,.navbar-fixed-bottom .dropdown .dropdown-menu{top:auto;bottom:100%;margin-bottom:1px}@media (min-width:862px){.navbar-right .dropdown-menu{right:0;left:auto}.navbar-right .dropdown-menu-left{right:auto;left:0}}.btn-group,.btn-group-vertical{position:relative;display:inline-block;vertical-align:middle}.btn-group>.btn,.btn-group-vertical>.btn{position:relative;float:left}.btn-group>.btn:hover,.btn-group-vertical>.btn:hover,.btn-group>.btn:focus,.btn-group-vertical>.btn:focus,.btn-group>.btn:active,.btn-group-vertical>.btn:active,.btn-group>.btn.active,.btn-group-vertical>.btn.active{z-index:2}.btn-group>.btn:focus,.btn-group-vertical>.btn:focus{outline:0}.btn-group .btn+.btn,.btn-group .btn+.btn-group,.btn-group .btn-group+.btn,.btn-group .btn-group+.btn-group{margin-left:-1px}.btn-toolbar{margin-left:-5px}.btn-toolbar .btn-group,.btn-toolbar .input-group{float:left}.btn-toolbar>.btn,.btn-toolbar>.btn-group,.btn-toolbar>.input-group{margin-left:5px}.btn-group>.btn:not(:first-child):not(:last-child):not(.dropdown-toggle){border-radius:0}.btn-group>.btn:first-child{margin-left:0}.btn-group>.btn:first-child:not(:last-child):not(.dropdown-toggle){border-top-right-radius:0;border-bottom-right-radius:0}.btn-group>.btn:last-child:not(:first-child),.btn-group>.dropdown-toggle:not(:first-child){border-top-left-radius:0;border-bottom-left-radius:0}.btn-group>.btn-group{float:left}.btn-group>.btn-group:not(:first-child):not(:last-child)>.btn{border-radius:0}.btn-group>.btn-group:first-child>.btn:last-child,.btn-group>.btn-group:first-child>.dropdown-toggle{border-top-right-radius:0;border-bottom-right-radius:0}.btn-group>.btn-group:last-child>.btn:first-child{border-top-left-radius:0;border-bottom-left-radius:0}.btn-group .dropdown-toggle:active,.btn-group.open .dropdown-toggle{outline:0}.btn-group>.btn+.dropdown-toggle{padding-right:8px;padding-left:8px}.btn-group>.btn-lg+.dropdown-toggle{padding-right:12px;padding-left:12px}.btn-group.open .dropdown-toggle{-webkit-box-shadow:inset 0 3px 5px rgba(0,0,0,.125);box-shadow:inset 0 3px 5px rgba(0,0,0,.125)}.btn-group.open .dropdown-toggle.btn-link{-webkit-box-shadow:none;box-shadow:none}.btn .caret{margin-left:0}.btn-lg .caret{border-width:5px 5px 0;border-bottom-width:0}.dropup .btn-lg .caret{border-width:0 5px 5px}.btn-group-vertical>.btn,.btn-group-vertical>.btn-group,.btn-group-vertical>.btn-group>.btn{display:block;float:none;width:100%;max-width:100%}.btn-group-vertical>.btn-group>.btn{float:none}.btn-group-vertical>.btn+.btn,.btn-group-vertical>.btn+.btn-group,.btn-group-vertical>.btn-group+.btn,.btn-group-vertical>.btn-group+.btn-group{margin-top:-1px;margin-left:0}.btn-group-vertical>.btn:not(:first-child):not(:last-child){border-radius:0}.btn-group-vertical>.btn:first-child:not(:last-child){border-top-right-radius:4px;border-bottom-right-radius:0;border-bottom-left-radius:0}.btn-group-vertical>.btn:last-child:not(:first-child){border-top-left-radius:0;border-top-right-radius:0;border-bottom-left-radius:4px}.btn-group-vertical>.btn-group:not(:first-child):not(:last-child)>.btn{border-radius:0}.btn-group-vertical>.btn-group:first-child:not(:last-child)>.btn:last-child,.btn-group-vertical>.btn-group:first-child:not(:last-child)>.dropdown-toggle{border-bottom-right-radius:0;border-bottom-left-radius:0}.btn-group-vertical>.btn-group:last-child:not(:first-child)>.btn:first-child{border-top-left-radius:0;border-top-right-radius:0}.btn-group-justified{display:table;width:100%;table-layout:fixed;border-collapse:separate}.btn-group-justified>.btn,.btn-group-justified>.btn-group{display:table-cell;float:none;width:1%}.btn-group-justified>.btn-group .btn{width:100%}.btn-group-justified>.btn-group .dropdown-menu{left:auto}[data-toggle=buttons]>.btn>input[type=radio],[data-toggle=buttons]>.btn>input[type=checkbox]{position:absolute;z-index:-1;filter:alpha(opacity=0);opacity:0}.input-group{position:relative;display:table;border-collapse:separate}.input-group[class*=col-]{float:none;padding-right:0;padding-left:0}.input-group .form-control{position:relative;z-index:2;float:left;width:100%;margin-bottom:0}.input-group-lg>.form-control,.input-group-lg>.input-group-addon,.input-group-lg>.input-group-btn>.btn{height:46px;padding:10px 16px;font-size:18px;line-height:1.33;border-radius:6px}select.input-group-lg>.form-control,select.input-group-lg>.input-group-addon,select.input-group-lg>.input-group-btn>.btn{height:46px;line-height:46px}textarea.input-group-lg>.form-control,textarea.input-group-lg>.input-group-addon,textarea.input-group-lg>.input-group-btn>.btn,select[multiple].input-group-lg>.form-control,select[multiple].input-group-lg>.input-group-addon,select[multiple].input-group-lg>.input-group-btn>.btn{height:auto}.input-group-sm>.form-control,.input-group-sm>.input-group-addon,.input-group-sm>.input-group-btn>.btn{height:30px;padding:5px 10px;font-size:12px;line-height:1.5;border-radius:3px}select.input-group-sm>.form-control,select.input-group-sm>.input-group-addon,select.input-group-sm>.input-group-btn>.btn{height:30px;line-height:30px}textarea.input-group-sm>.form-control,textarea.input-group-sm>.input-group-addon,textarea.input-group-sm>.input-group-btn>.btn,select[multiple].input-group-sm>.form-control,select[multiple].input-group-sm>.input-group-addon,select[multiple].input-group-sm>.input-group-btn>.btn{height:auto}.input-group-addon,.input-group-btn,.input-group .form-control{display:table-cell}.input-group-addon:not(:first-child):not(:last-child),.input-group-btn:not(:first-child):not(:last-child),.input-group .form-control:not(:first-child):not(:last-child){border-radius:0}.input-group-addon,.input-group-btn{width:1%;white-space:nowrap;vertical-align:middle}.input-group-addon{padding:6px 12px;font-size:14px;font-weight:400;line-height:1;color:#555;text-align:center;background-color:#eee;border:1px solid #ccc;border-radius:4px}.input-group-addon.input-sm{padding:5px 10px;font-size:12px;border-radius:3px}.input-group-addon.input-lg{padding:10px 16px;font-size:18px;border-radius:6px}.input-group-addon input[type=radio],.input-group-addon input[type=checkbox]{margin-top:0}.input-group .form-control:first-child,.input-group-addon:first-child,.input-group-btn:first-child>.btn,.input-group-btn:first-child>.btn-group>.btn,.input-group-btn:first-child>.dropdown-toggle,.input-group-btn:last-child>.btn:not(:last-child):not(.dropdown-toggle),.input-group-btn:last-child>.btn-group:not(:last-child)>.btn{border-top-right-radius:0;border-bottom-right-radius:0}.input-group-addon:first-child{border-right:0}.input-group .form-control:last-child,.input-group-addon:last-child,.input-group-btn:last-child>.btn,.input-group-btn:last-child>.btn-group>.btn,.input-group-btn:last-child>.dropdown-toggle,.input-group-btn:first-child>.btn:not(:first-child),.input-group-btn:first-child>.btn-group:not(:first-child)>.btn{border-top-left-radius:0;border-bottom-left-radius:0}.input-group-addon:last-child{border-left:0}.input-group-btn{position:relative;font-size:0;white-space:nowrap}.input-group-btn>.btn{position:relative}.input-group-btn>.btn+.btn{margin-left:-1px}.input-group-btn>.btn:hover,.input-group-btn>.btn:focus,.input-group-btn>.btn:active{z-index:2}.input-group-btn:first-child>.btn,.input-group-btn:first-child>.btn-group{margin-right:-1px}.input-group-btn:last-child>.btn,.input-group-btn:last-child>.btn-group{margin-left:-1px}.nav{padding-left:0;margin-bottom:0;list-style:none}.nav>li{position:relative;display:block}.nav>li>a{position:relative;display:block;padding:10px 15px}.nav>li>a:hover,.nav>li>a:focus{text-decoration:none;background-color:#eee}.nav>li.disabled>a{color:#777}.nav>li.disabled>a:hover,.nav>li.disabled>a:focus{color:#777;text-decoration:none;cursor:not-allowed;background-color:transparent}.nav .open>a,.nav .open>a:hover,.nav .open>a:focus{background-color:#eee;border-color:#428bca}.nav .nav-divider{height:1px;margin:9px 0;overflow:hidden;background-color:#e5e5e5}.nav>li>a>img{max-width:none}.nav-tabs{border-bottom:1px solid #ddd}.nav-tabs>li{float:left;margin-bottom:-1px}.nav-tabs>li>a{margin-right:2px;line-height:1.42857143;border:1px solid transparent;border-radius:4px 4px 0 0}.nav-tabs>li>a:hover{border-color:#eee #eee #ddd}.nav-tabs>li.active>a,.nav-tabs>li.active>a:hover,.nav-tabs>li.active>a:focus{color:#555;cursor:default;background-color:#fff;border:1px solid #ddd;border-bottom-color:transparent}.nav-tabs.nav-justified{width:100%;border-bottom:0}.nav-tabs.nav-justified>li{float:none}.nav-tabs.nav-justified>li>a{margin-bottom:5px;text-align:center}.nav-tabs.nav-justified>.dropdown .dropdown-menu{top:auto;left:auto}@media (min-width:768px){.nav-tabs.nav-justified>li{display:table-cell;width:1%}.nav-tabs.nav-justified>li>a{margin-bottom:0}}.nav-tabs.nav-justified>li>a{margin-right:0;border-radius:4px}.nav-tabs.nav-justified>.active>a,.nav-tabs.nav-justified>.active>a:hover,.nav-tabs.nav-justified>.active>a:focus{border:1px solid #ddd}@media (min-width:768px){.nav-tabs.nav-justified>li>a{border-bottom:1px solid #ddd;border-radius:4px 4px 0 0}.nav-tabs.nav-justified>.active>a,.nav-tabs.nav-justified>.active>a:hover,.nav-tabs.nav-justified>.active>a:focus{border-bottom-color:#fff}}.nav-pills>li{float:left}.nav-pills>li>a{border-radius:4px}.nav-pills>li+li{margin-left:2px}.nav-pills>li.active>a,.nav-pills>li.active>a:hover,.nav-pills>li.active>a:focus{color:#fff;background-color:#428bca}.nav-stacked>li{float:none}.nav-stacked>li+li{margin-top:2px;margin-left:0}.nav-justified{width:100%}.nav-justified>li{float:none}.nav-justified>li>a{margin-bottom:5px;text-align:center}.nav-justified>.dropdown .dropdown-menu{top:auto;left:auto}@media (min-width:768px){.nav-justified>li{display:table-cell;width:1%}.nav-justified>li>a{margin-bottom:0}}.nav-tabs-justified{border-bottom:0}.nav-tabs-justified>li>a{margin-right:0;border-radius:4px}.nav-tabs-justified>.active>a,.nav-tabs-justified>.active>a:hover,.nav-tabs-justified>.active>a:focus{border:1px solid #ddd}@media (min-width:768px){.nav-tabs-justified>li>a{border-bottom:1px solid #ddd;border-radius:4px 4px 0 0}.nav-tabs-justified>.active>a,.nav-tabs-justified>.active>a:hover,.nav-tabs-justified>.active>a:focus{border-bottom-color:#fff}}.tab-content>.tab-pane{display:none}.tab-content>.active{display:block}.nav-tabs .dropdown-menu{margin-top:-1px;border-top-left-radius:0;border-top-right-radius:0}.navbar{position:relative;min-height:50px;margin-bottom:20px;border:1px solid transparent}@media (min-width:862px){.navbar{border-radius:4px}}@media (min-width:862px){.navbar-header{float:left}}.navbar-collapse{padding-right:15px;padding-left:15px;overflow-x:visible;-webkit-overflow-scrolling:touch;border-top:1px solid transparent;-webkit-box-shadow:inset 0 1px 0 rgba(255,255,255,.1);box-shadow:inset 0 1px 0 rgba(255,255,255,.1)}.navbar-collapse.in{overflow-y:auto}@media (min-width:862px){.navbar-collapse{width:auto;border-top:0;-webkit-box-shadow:none;box-shadow:none}.navbar-collapse.collapse{display:block!important;height:auto!important;padding-bottom:0;overflow:visible!important}.navbar-collapse.in{overflow-y:visible}.navbar-fixed-top .navbar-collapse,.navbar-static-top .navbar-collapse,.navbar-fixed-bottom .navbar-collapse{padding-right:0;padding-left:0}}.navbar-fixed-top .navbar-collapse,.navbar-fixed-bottom .navbar-collapse{max-height:340px}@media (max-width:480px) and (orientation:landscape){.navbar-fixed-top .navbar-collapse,.navbar-fixed-bottom .navbar-collapse{max-height:200px}}.container>.navbar-header,.container-fluid>.navbar-header,.container>.navbar-collapse,.container-fluid>.navbar-collapse{margin-right:-15px;margin-left:-15px}@media (min-width:862px){.container>.navbar-header,.container-fluid>.navbar-header,.container>.navbar-collapse,.container-fluid>.navbar-collapse{margin-right:0;margin-left:0}}.navbar-static-top{z-index:1000;border-width:0 0 1px}@media (min-width:862px){.navbar-static-top{border-radius:0}}.navbar-fixed-top,.navbar-fixed-bottom{position:fixed;right:0;left:0;z-index:1030;-webkit-transform:translate3d(0,0,0);-o-transform:translate3d(0,0,0);transform:translate3d(0,0,0)}@media (min-width:862px){.navbar-fixed-top,.navbar-fixed-bottom{border-radius:0}}.navbar-fixed-top{top:0;border-width:0 0 1px}.navbar-fixed-bottom{bottom:0;margin-bottom:0;border-width:1px 0 0}.navbar-brand{float:left;height:50px;padding:15px;font-size:18px;line-height:20px}.navbar-brand:hover,.navbar-brand:focus{text-decoration:none}@media (min-width:862px){.navbar>.container .navbar-brand,.navbar>.container-fluid .navbar-brand{margin-left:-15px}}.navbar-toggle{position:relative;float:right;padding:9px 10px;margin-top:8px;margin-right:15px;margin-bottom:8px;background-color:transparent;background-image:none;border:1px solid transparent;border-radius:4px}.navbar-toggle:focus{outline:0}.navbar-toggle .icon-bar{display:block;width:22px;height:2px;border-radius:1px}.navbar-toggle .icon-bar+.icon-bar{margin-top:4px}@media (min-width:862px){.navbar-toggle{display:none}}.navbar-nav{margin:7.5px -15px}.navbar-nav>li>a{padding-top:10px;padding-bottom:10px;line-height:20px}@media (max-width:861px){.navbar-nav .open .dropdown-menu{position:static;float:none;width:auto;margin-top:0;background-color:transparent;border:0;-webkit-box-shadow:none;box-shadow:none}.navbar-nav .open .dropdown-menu>li>a,.navbar-nav .open .dropdown-menu .dropdown-header{padding:5px 15px 5px 25px}.navbar-nav .open .dropdown-menu>li>a{line-height:20px}.navbar-nav .open .dropdown-menu>li>a:hover,.navbar-nav .open .dropdown-menu>li>a:focus{background-image:none}}@media (min-width:862px){.navbar-nav{float:left;margin:0}.navbar-nav>li{float:left}.navbar-nav>li>a{padding-top:15px;padding-bottom:15px}.navbar-nav.navbar-right:last-child{margin-right:-15px}}@media (min-width:862px){.navbar-left{float:left!important}.navbar-right{float:right!important}}.navbar-form{padding:10px 15px;margin-top:8px;margin-right:-15px;margin-bottom:8px;margin-left:-15px;border-top:1px solid transparent;border-bottom:1px solid transparent;-webkit-box-shadow:inset 0 1px 0 rgba(255,255,255,.1),0 1px 0 rgba(255,255,255,.1);box-shadow:inset 0 1px 0 rgba(255,255,255,.1),0 1px 0 rgba(255,255,255,.1)}@media (min-width:768px){.navbar-form .form-group{display:inline-block;margin-bottom:0;vertical-align:middle}.navbar-form .form-control{display:inline-block;width:auto;vertical-align:middle}.navbar-form .input-group{display:inline-table;vertical-align:middle}.navbar-form .input-group .input-group-addon,.navbar-form .input-group .input-group-btn,.navbar-form .input-group .form-control{width:auto}.navbar-form .input-group>.form-control{width:100%}.navbar-form .control-label{margin-bottom:0;vertical-align:middle}.navbar-form .radio,.navbar-form .checkbox{display:inline-block;margin-top:0;margin-bottom:0;vertical-align:middle}.navbar-form .radio label,.navbar-form .checkbox label{padding-left:0}.navbar-form .radio input[type=radio],.navbar-form .checkbox input[type=checkbox]{position:relative;margin-left:0}.navbar-form .has-feedback .form-control-feedback{top:0}}@media (max-width:861px){.navbar-form .form-group{margin-bottom:5px}}@media (min-width:862px){.navbar-form{width:auto;padding-top:0;padding-bottom:0;margin-right:0;margin-left:0;border:0;-webkit-box-shadow:none;box-shadow:none}.navbar-form.navbar-right:last-child{margin-right:-15px}}.navbar-nav>li>.dropdown-menu{margin-top:0;border-top-left-radius:0;border-top-right-radius:0}.navbar-fixed-bottom .navbar-nav>li>.dropdown-menu{border-bottom-right-radius:0;border-bottom-left-radius:0}.navbar-btn{margin-top:8px;margin-bottom:8px}.navbar-btn.btn-sm{margin-top:10px;margin-bottom:10px}.navbar-btn.btn-xs{margin-top:14px;margin-bottom:14px}.navbar-text{margin-top:15px;margin-bottom:15px}@media (min-width:862px){.navbar-text{float:left;margin-right:15px;margin-left:15px}.navbar-text.navbar-right:last-child{margin-right:0}}.navbar-default{background-color:#f8f8f8;border-color:#e7e7e7}.navbar-default .navbar-brand{color:#777}.navbar-default .navbar-brand:hover,.navbar-default .navbar-brand:focus{color:#5e5e5e;background-color:transparent}.navbar-default .navbar-text{color:#777}.navbar-default .navbar-nav>li>a{color:#777}.navbar-default .navbar-nav>li>a:hover,.navbar-default .navbar-nav>li>a:focus{color:#333;background-color:transparent}.navbar-default .navbar-nav>.active>a,.navbar-default .navbar-nav>.active>a:hover,.navbar-default .navbar-nav>.active>a:focus{color:#555;background-color:#e7e7e7}.navbar-default .navbar-nav>.disabled>a,.navbar-default .navbar-nav>.disabled>a:hover,.navbar-default .navbar-nav>.disabled>a:focus{color:#ccc;background-color:transparent}.navbar-default .navbar-toggle{border-color:#ddd}.navbar-default .navbar-toggle:hover,.navbar-default .navbar-toggle:focus{background-color:#ddd}.navbar-default .navbar-toggle .icon-bar{background-color:#888}.navbar-default .navbar-collapse,.navbar-default .navbar-form{border-color:#e7e7e7}.navbar-default .navbar-nav>.open>a,.navbar-default .navbar-nav>.open>a:hover,.navbar-default .navbar-nav>.open>a:focus{color:#555;background-color:#e7e7e7}@media (max-width:861px){.navbar-default .navbar-nav .open .dropdown-menu>li>a{color:#777}.navbar-default .navbar-nav .open .dropdown-menu>li>a:hover,.navbar-default .navbar-nav .open .dropdown-menu>li>a:focus{color:#333;background-color:transparent}.navbar-default .navbar-nav .open .dropdown-menu>.active>a,.navbar-default .navbar-nav .open .dropdown-menu>.active>a:hover,.navbar-default .navbar-nav .open .dropdown-menu>.active>a:focus{color:#555;background-color:#e7e7e7}.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a,.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a:hover,.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a:focus{color:#ccc;background-color:transparent}}.navbar-default .navbar-link{color:#777}.navbar-default .navbar-link:hover{color:#333}.navbar-default .btn-link{color:#777}.navbar-default .btn-link:hover,.navbar-default .btn-link:focus{color:#333}.navbar-default .btn-link[disabled]:hover,fieldset[disabled] .navbar-default .btn-link:hover,.navbar-default .btn-link[disabled]:focus,fieldset[disabled] .navbar-default .btn-link:focus{color:#ccc}.navbar-inverse{background-color:#222;border-color:#080808}.navbar-inverse .navbar-brand{color:#777}.navbar-inverse .navbar-brand:hover,.navbar-inverse .navbar-brand:focus{color:#fff;background-color:transparent}.navbar-inverse .navbar-text{color:#777}.navbar-inverse .navbar-nav>li>a{color:#777}.navbar-inverse .navbar-nav>li>a:hover,.navbar-inverse .navbar-nav>li>a:focus{color:#fff;background-color:transparent}.navbar-inverse .navbar-nav>.active>a,.navbar-inverse .navbar-nav>.active>a:hover,.navbar-inverse .navbar-nav>.active>a:focus{color:#fff;background-color:#080808}.navbar-inverse .navbar-nav>.disabled>a,.navbar-inverse .navbar-nav>.disabled>a:hover,.navbar-inverse .navbar-nav>.disabled>a:focus{color:#444;background-color:transparent}.navbar-inverse .navbar-toggle{border-color:#333}.navbar-inverse .navbar-toggle:hover,.navbar-inverse .navbar-toggle:focus{background-color:#333}.navbar-inverse .navbar-toggle .icon-bar{background-color:#fff}.navbar-inverse .navbar-collapse,.navbar-inverse .navbar-form{border-color:#101010}.navbar-inverse .navbar-nav>.open>a,.navbar-inverse .navbar-nav>.open>a:hover,.navbar-inverse .navbar-nav>.open>a:focus{color:#fff;background-color:#080808}@media (max-width:861px){.navbar-inverse .navbar-nav .open .dropdown-menu>.dropdown-header{border-color:#080808}.navbar-inverse .navbar-nav .open .dropdown-menu .divider{background-color:#080808}.navbar-inverse .navbar-nav .open .dropdown-menu>li>a{color:#777}.navbar-inverse .navbar-nav .open .dropdown-menu>li>a:hover,.navbar-inverse .navbar-nav .open .dropdown-menu>li>a:focus{color:#fff;background-color:transparent}.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a,.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a:hover,.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a:focus{color:#fff;background-color:#080808}.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a,.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a:hover,.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a:focus{color:#444;background-color:transparent}}.navbar-inverse .navbar-link{color:#777}.navbar-inverse .navbar-link:hover{color:#fff}.navbar-inverse .btn-link{color:#777}.navbar-inverse .btn-link:hover,.navbar-inverse .btn-link:focus{color:#fff}.navbar-inverse .btn-link[disabled]:hover,fieldset[disabled] .navbar-inverse .btn-link:hover,.navbar-inverse .btn-link[disabled]:focus,fieldset[disabled] .navbar-inverse .btn-link:focus{color:#444}.breadcrumb{padding:8px 15px;margin-bottom:20px;list-style:none;background-color:#f5f5f5;border-radius:4px}.breadcrumb>li{display:inline-block}.breadcrumb>li+li:before{padding:0 5px;color:#ccc;content:"/\00a0"}.breadcrumb>.active{color:#777}.pagination{display:inline-block;padding-left:0;margin:20px 0;border-radius:4px}.pagination>li{display:inline}.pagination>li>a,.pagination>li>span{position:relative;float:left;padding:6px 12px;margin-left:-1px;line-height:1.42857143;color:#428bca;text-decoration:none;background-color:#fff;border:1px solid #ddd}.pagination>li:first-child>a,.pagination>li:first-child>span{margin-left:0;border-top-left-radius:4px;border-bottom-left-radius:4px}.pagination>li:last-child>a,.pagination>li:last-child>span{border-top-right-radius:4px;border-bottom-right-radius:4px}.pagination>li>a:hover,.pagination>li>span:hover,.pagination>li>a:focus,.pagination>li>span:focus{color:#2a6496;background-color:#eee;border-color:#ddd}.pagination>.active>a,.pagination>.active>span,.pagination>.active>a:hover,.pagination>.active>span:hover,.pagination>.active>a:focus,.pagination>.active>span:focus{z-index:2;color:#fff;cursor:default;background-color:#428bca;border-color:#428bca}.pagination>.disabled>span,.pagination>.disabled>span:hover,.pagination>.disabled>span:focus,.pagination>.disabled>a,.pagination>.disabled>a:hover,.pagination>.disabled>a:focus{color:#777;cursor:not-allowed;background-color:#fff;border-color:#ddd}.pagination-lg>li>a,.pagination-lg>li>span{padding:10px 16px;font-size:18px}.pagination-lg>li:first-child>a,.pagination-lg>li:first-child>span{border-top-left-radius:6px;border-bottom-left-radius:6px}.pagination-lg>li:last-child>a,.pagination-lg>li:last-child>span{border-top-right-radius:6px;border-bottom-right-radius:6px}.pagination-sm>li>a,.pagination-sm>li>span{padding:5px 10px;font-size:12px}.pagination-sm>li:first-child>a,.pagination-sm>li:first-child>span{border-top-left-radius:3px;border-bottom-left-radius:3px}.pagination-sm>li:last-child>a,.pagination-sm>li:last-child>span{border-top-right-radius:3px;border-bottom-right-radius:3px}.pager{padding-left:0;margin:20px 0;text-align:center;list-style:none}.pager li{display:inline}.pager li>a,.pager li>span{display:inline-block;padding:5px 14px;background-color:#fff;border:1px solid #ddd;border-radius:15px}.pager li>a:hover,.pager li>a:focus{text-decoration:none;background-color:#eee}.pager .next>a,.pager .next>span{float:right}.pager .previous>a,.pager .previous>span{float:left}.pager .disabled>a,.pager .disabled>a:hover,.pager .disabled>a:focus,.pager .disabled>span{color:#777;cursor:not-allowed;background-color:#fff}.label{display:inline;padding:.2em .6em .3em;font-size:75%;font-weight:700;line-height:1;color:#fff;text-align:center;white-space:nowrap;vertical-align:baseline;border-radius:.25em}a.label:hover,a.label:focus{color:#fff;text-decoration:none;cursor:pointer}.label:empty{display:none}.btn .label{position:relative;top:-1px}.label-default{background-color:#777}.label-default[href]:hover,.label-default[href]:focus{background-color:#5e5e5e}.label-primary{background-color:#428bca}.label-primary[href]:hover,.label-primary[href]:focus{background-color:#3071a9}.label-success{background-color:#5cb85c}.label-success[href]:hover,.label-success[href]:focus{background-color:#449d44}.label-info{background-color:#5bc0de}.label-info[href]:hover,.label-info[href]:focus{background-color:#31b0d5}.label-warning{background-color:#f0ad4e}.label-warning[href]:hover,.label-warning[href]:focus{background-color:#ec971f}.label-danger{background-color:#d9534f}.label-danger[href]:hover,.label-danger[href]:focus{background-color:#c9302c}.badge{display:inline-block;min-width:10px;padding:3px 7px;font-size:12px;font-weight:700;line-height:1;color:#fff;text-align:center;white-space:nowrap;vertical-align:baseline;background-color:#777;border-radius:10px}.badge:empty{display:none}.btn .badge{position:relative;top:-1px}.btn-xs .badge{top:0;padding:1px 5px}a.badge:hover,a.badge:focus{color:#fff;text-decoration:none;cursor:pointer}a.list-group-item.active>.badge,.nav-pills>.active>a>.badge{color:#428bca;background-color:#fff}.nav-pills>li>a>.badge{margin-left:3px}.jumbotron{padding:30px;margin-bottom:30px;color:inherit;background-color:#eee}.jumbotron h1,.jumbotron .h1{color:inherit}.jumbotron p{margin-bottom:15px;font-size:21px;font-weight:200}.jumbotron>hr{border-top-color:#d5d5d5}.container .jumbotron{border-radius:6px}.jumbotron .container{max-width:100%}@media screen and (min-width:768px){.jumbotron{padding-top:48px;padding-bottom:48px}.container .jumbotron{padding-right:60px;padding-left:60px}.jumbotron h1,.jumbotron .h1{font-size:63px}}.thumbnail{display:block;padding:4px;margin-bottom:20px;line-height:1.42857143;background-color:#fff;border:1px solid #ddd;border-radius:4px;-webkit-transition:all .2s ease-in-out;-o-transition:all .2s ease-in-out;transition:all .2s ease-in-out}.thumbnail>img,.thumbnail a>img{margin-right:auto;margin-left:auto}a.thumbnail:hover,a.thumbnail:focus,a.thumbnail.active{border-color:#428bca}.thumbnail .caption{padding:9px;color:#333}.alert{padding:15px;margin-bottom:20px;border:1px solid transparent;border-radius:4px}.alert h4{margin-top:0;color:inherit}.alert .alert-link{font-weight:700}.alert>p,.alert>ul{margin-bottom:0}.alert>p+p{margin-top:5px}.alert-dismissable,.alert-dismissible{padding-right:35px}.alert-dismissable .close,.alert-dismissible .close{position:relative;top:-2px;right:-21px;color:inherit}.alert-success{color:#3c763d;background-color:#dff0d8;border-color:#d6e9c6}.alert-success hr{border-top-color:#c9e2b3}.alert-success .alert-link{color:#2b542c}.alert-info{color:#31708f;background-color:#d9edf7;border-color:#bce8f1}.alert-info hr{border-top-color:#a6e1ec}.alert-info .alert-link{color:#245269}.alert-warning{color:#8a6d3b;background-color:#fcf8e3;border-color:#faebcc}.alert-warning hr{border-top-color:#f7e1b5}.alert-warning .alert-link{color:#66512c}.alert-danger{color:#a94442;background-color:#f2dede;border-color:#ebccd1}.alert-danger hr{border-top-color:#e4b9c0}.alert-danger .alert-link{color:#843534}@-webkit-keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}@-o-keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}@keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}.progress{height:20px;margin-bottom:20px;overflow:hidden;background-color:#f5f5f5;border-radius:4px;-webkit-box-shadow:inset 0 1px 2px rgba(0,0,0,.1);box-shadow:inset 0 1px 2px rgba(0,0,0,.1)}.progress-bar{float:left;width:0;height:100%;font-size:12px;line-height:20px;color:#fff;text-align:center;background-color:#428bca;-webkit-box-shadow:inset 0 -1px 0 rgba(0,0,0,.15);box-shadow:inset 0 -1px 0 rgba(0,0,0,.15);-webkit-transition:width .6s ease;-o-transition:width .6s ease;transition:width .6s ease}.progress-striped .progress-bar,.progress-bar-striped{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);-webkit-background-size:40px 40px;background-size:40px 40px}.progress.active .progress-bar,.progress-bar.active{-webkit-animation:progress-bar-stripes 2s linear infinite;-o-animation:progress-bar-stripes 2s linear infinite;animation:progress-bar-stripes 2s linear infinite}.progress-bar[aria-valuenow="1"],.progress-bar[aria-valuenow="2"]{min-width:30px}.progress-bar[aria-valuenow="0"]{min-width:30px;color:#777;background-color:transparent;background-image:none;-webkit-box-shadow:none;box-shadow:none}.progress-bar-success{background-color:#5cb85c}.progress-striped .progress-bar-success{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.progress-bar-info{background-color:#5bc0de}.progress-striped .progress-bar-info{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.progress-bar-warning{background-color:#f0ad4e}.progress-striped .progress-bar-warning{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.progress-bar-danger{background-color:#d9534f}.progress-striped .progress-bar-danger{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.media,.media-body{overflow:hidden;zoom:1}.media,.media .media{margin-top:15px}.media:first-child{margin-top:0}.media-object{display:block}.media-heading{margin:0 0 5px}.media>.pull-left{margin-right:10px}.media>.pull-right{margin-left:10px}.media-list{padding-left:0;list-style:none}.list-group{padding-left:0;margin-bottom:20px}.list-group-item{position:relative;display:block;padding:10px 15px;margin-bottom:-1px;background-color:#fff;border:1px solid #ddd}.list-group-item:first-child{border-top-left-radius:4px;border-top-right-radius:4px}.list-group-item:last-child{margin-bottom:0;border-bottom-right-radius:4px;border-bottom-left-radius:4px}.list-group-item>.badge{float:right}.list-group-item>.badge+.badge{margin-right:5px}a.list-group-item{color:#555}a.list-group-item .list-group-item-heading{color:#333}a.list-group-item:hover,a.list-group-item:focus{color:#555;text-decoration:none;background-color:#f5f5f5}.list-group-item.disabled,.list-group-item.disabled:hover,.list-group-item.disabled:focus{color:#777;background-color:#eee}.list-group-item.disabled .list-group-item-heading,.list-group-item.disabled:hover .list-group-item-heading,.list-group-item.disabled:focus .list-group-item-heading{color:inherit}.list-group-item.disabled .list-group-item-text,.list-group-item.disabled:hover .list-group-item-text,.list-group-item.disabled:focus .list-group-item-text{color:#777}.list-group-item.active,.list-group-item.active:hover,.list-group-item.active:focus{z-index:2;color:#fff;background-color:#428bca;border-color:#428bca}.list-group-item.active .list-group-item-heading,.list-group-item.active:hover .list-group-item-heading,.list-group-item.active:focus .list-group-item-heading,.list-group-item.active .list-group-item-heading>small,.list-group-item.active:hover .list-group-item-heading>small,.list-group-item.active:focus .list-group-item-heading>small,.list-group-item.active .list-group-item-heading>.small,.list-group-item.active:hover .list-group-item-heading>.small,.list-group-item.active:focus .list-group-item-heading>.small{color:inherit}.list-group-item.active .list-group-item-text,.list-group-item.active:hover .list-group-item-text,.list-group-item.active:focus .list-group-item-text{color:#e1edf7}.list-group-item-success{color:#3c763d;background-color:#dff0d8}a.list-group-item-success{color:#3c763d}a.list-group-item-success .list-group-item-heading{color:inherit}a.list-group-item-success:hover,a.list-group-item-success:focus{color:#3c763d;background-color:#d0e9c6}a.list-group-item-success.active,a.list-group-item-success.active:hover,a.list-group-item-success.active:focus{color:#fff;background-color:#3c763d;border-color:#3c763d}.list-group-item-info{color:#31708f;background-color:#d9edf7}a.list-group-item-info{color:#31708f}a.list-group-item-info .list-group-item-heading{color:inherit}a.list-group-item-info:hover,a.list-group-item-info:focus{color:#31708f;background-color:#c4e3f3}a.list-group-item-info.active,a.list-group-item-info.active:hover,a.list-group-item-info.active:focus{color:#fff;background-color:#31708f;border-color:#31708f}.list-group-item-warning{color:#8a6d3b;background-color:#fcf8e3}a.list-group-item-warning{color:#8a6d3b}a.list-group-item-warning .list-group-item-heading{color:inherit}a.list-group-item-warning:hover,a.list-group-item-warning:focus{color:#8a6d3b;background-color:#faf2cc}a.list-group-item-warning.active,a.list-group-item-warning.active:hover,a.list-group-item-warning.active:focus{color:#fff;background-color:#8a6d3b;border-color:#8a6d3b}.list-group-item-danger{color:#a94442;background-color:#f2dede}a.list-group-item-danger{color:#a94442}a.list-group-item-danger .list-group-item-heading{color:inherit}a.list-group-item-danger:hover,a.list-group-item-danger:focus{color:#a94442;background-color:#ebcccc}a.list-group-item-danger.active,a.list-group-item-danger.active:hover,a.list-group-item-danger.active:focus{color:#fff;background-color:#a94442;border-color:#a94442}.list-group-item-heading{margin-top:0;margin-bottom:5px}.list-group-item-text{margin-bottom:0;line-height:1.3}.panel{margin-bottom:20px;background-color:#fff;border:1px solid transparent;border-radius:4px;-webkit-box-shadow:0 1px 1px rgba(0,0,0,.05);box-shadow:0 1px 1px rgba(0,0,0,.05)}.panel-body{padding:15px}.panel-heading{padding:10px 15px;border-bottom:1px solid transparent;border-top-left-radius:3px;border-top-right-radius:3px}.panel-heading>.dropdown .dropdown-toggle{color:inherit}.panel-title{margin-top:0;margin-bottom:0;font-size:16px;color:inherit}.panel-title>a{color:inherit}.panel-footer{padding:10px 15px;background-color:#f5f5f5;border-top:1px solid #ddd;border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel>.list-group{margin-bottom:0}.panel>.list-group .list-group-item{border-width:1px 0;border-radius:0}.panel>.list-group:first-child .list-group-item:first-child{border-top:0;border-top-left-radius:3px;border-top-right-radius:3px}.panel>.list-group:last-child .list-group-item:last-child{border-bottom:0;border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel-heading+.list-group .list-group-item:first-child{border-top-width:0}.list-group+.panel-footer{border-top-width:0}.panel>.table,.panel>.table-responsive>.table,.panel>.panel-collapse>.table{margin-bottom:0}.panel>.table:first-child,.panel>.table-responsive:first-child>.table:first-child{border-top-left-radius:3px;border-top-right-radius:3px}.panel>.table:first-child>thead:first-child>tr:first-child td:first-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child td:first-child,.panel>.table:first-child>tbody:first-child>tr:first-child td:first-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child td:first-child,.panel>.table:first-child>thead:first-child>tr:first-child th:first-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child th:first-child,.panel>.table:first-child>tbody:first-child>tr:first-child th:first-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child th:first-child{border-top-left-radius:3px}.panel>.table:first-child>thead:first-child>tr:first-child td:last-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child td:last-child,.panel>.table:first-child>tbody:first-child>tr:first-child td:last-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child td:last-child,.panel>.table:first-child>thead:first-child>tr:first-child th:last-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child th:last-child,.panel>.table:first-child>tbody:first-child>tr:first-child th:last-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child th:last-child{border-top-right-radius:3px}.panel>.table:last-child,.panel>.table-responsive:last-child>.table:last-child{border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel>.table:last-child>tbody:last-child>tr:last-child td:first-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child td:first-child,.panel>.table:last-child>tfoot:last-child>tr:last-child td:first-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child td:first-child,.panel>.table:last-child>tbody:last-child>tr:last-child th:first-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child th:first-child,.panel>.table:last-child>tfoot:last-child>tr:last-child th:first-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child th:first-child{border-bottom-left-radius:3px}.panel>.table:last-child>tbody:last-child>tr:last-child td:last-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child td:last-child,.panel>.table:last-child>tfoot:last-child>tr:last-child td:last-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child td:last-child,.panel>.table:last-child>tbody:last-child>tr:last-child th:last-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child th:last-child,.panel>.table:last-child>tfoot:last-child>tr:last-child th:last-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child th:last-child{border-bottom-right-radius:3px}.panel>.panel-body+.table,.panel>.panel-body+.table-responsive{border-top:1px solid #ddd}.panel>.table>tbody:first-child>tr:first-child th,.panel>.table>tbody:first-child>tr:first-child td{border-top:0}.panel>.table-bordered,.panel>.table-responsive>.table-bordered{border:0}.panel>.table-bordered>thead>tr>th:first-child,.panel>.table-responsive>.table-bordered>thead>tr>th:first-child,.panel>.table-bordered>tbody>tr>th:first-child,.panel>.table-responsive>.table-bordered>tbody>tr>th:first-child,.panel>.table-bordered>tfoot>tr>th:first-child,.panel>.table-responsive>.table-bordered>tfoot>tr>th:first-child,.panel>.table-bordered>thead>tr>td:first-child,.panel>.table-responsive>.table-bordered>thead>tr>td:first-child,.panel>.table-bordered>tbody>tr>td:first-child,.panel>.table-responsive>.table-bordered>tbody>tr>td:first-child,.panel>.table-bordered>tfoot>tr>td:first-child,.panel>.table-responsive>.table-bordered>tfoot>tr>td:first-child{border-left:0}.panel>.table-bordered>thead>tr>th:last-child,.panel>.table-responsive>.table-bordered>thead>tr>th:last-child,.panel>.table-bordered>tbody>tr>th:last-child,.panel>.table-responsive>.table-bordered>tbody>tr>th:last-child,.panel>.table-bordered>tfoot>tr>th:last-child,.panel>.table-responsive>.table-bordered>tfoot>tr>th:last-child,.panel>.table-bordered>thead>tr>td:last-child,.panel>.table-responsive>.table-bordered>thead>tr>td:last-child,.panel>.table-bordered>tbody>tr>td:last-child,.panel>.table-responsive>.table-bordered>tbody>tr>td:last-child,.panel>.table-bordered>tfoot>tr>td:last-child,.panel>.table-responsive>.table-bordered>tfoot>tr>td:last-child{border-right:0}.panel>.table-bordered>thead>tr:first-child>td,.panel>.table-responsive>.table-bordered>thead>tr:first-child>td,.panel>.table-bordered>tbody>tr:first-child>td,.panel>.table-responsive>.table-bordered>tbody>tr:first-child>td,.panel>.table-bordered>thead>tr:first-child>th,.panel>.table-responsive>.table-bordered>thead>tr:first-child>th,.panel>.table-bordered>tbody>tr:first-child>th,.panel>.table-responsive>.table-bordered>tbody>tr:first-child>th{border-bottom:0}.panel>.table-bordered>tbody>tr:last-child>td,.panel>.table-responsive>.table-bordered>tbody>tr:last-child>td,.panel>.table-bordered>tfoot>tr:last-child>td,.panel>.table-responsive>.table-bordered>tfoot>tr:last-child>td,.panel>.table-bordered>tbody>tr:last-child>th,.panel>.table-responsive>.table-bordered>tbody>tr:last-child>th,.panel>.table-bordered>tfoot>tr:last-child>th,.panel>.table-responsive>.table-bordered>tfoot>tr:last-child>th{border-bottom:0}.panel>.table-responsive{margin-bottom:0;border:0}.panel-group{margin-bottom:20px}.panel-group .panel{margin-bottom:0;border-radius:4px}.panel-group .panel+.panel{margin-top:5px}.panel-group .panel-heading{border-bottom:0}.panel-group .panel-heading+.panel-collapse>.panel-body{border-top:1px solid #ddd}.panel-group .panel-footer{border-top:0}.panel-group .panel-footer+.panel-collapse .panel-body{border-bottom:1px solid #ddd}.panel-default{border-color:#ddd}.panel-default>.panel-heading{color:#333;background-color:#f5f5f5;border-color:#ddd}.panel-default>.panel-heading+.panel-collapse>.panel-body{border-top-color:#ddd}.panel-default>.panel-heading .badge{color:#f5f5f5;background-color:#333}.panel-default>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#ddd}.panel-primary{border-color:#428bca}.panel-primary>.panel-heading{color:#fff;background-color:#428bca;border-color:#428bca}.panel-primary>.panel-heading+.panel-collapse>.panel-body{border-top-color:#428bca}.panel-primary>.panel-heading .badge{color:#428bca;background-color:#fff}.panel-primary>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#428bca}.panel-success{border-color:#d6e9c6}.panel-success>.panel-heading{color:#3c763d;background-color:#dff0d8;border-color:#d6e9c6}.panel-success>.panel-heading+.panel-collapse>.panel-body{border-top-color:#d6e9c6}.panel-success>.panel-heading .badge{color:#dff0d8;background-color:#3c763d}.panel-success>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#d6e9c6}.panel-info{border-color:#bce8f1}.panel-info>.panel-heading{color:#31708f;background-color:#d9edf7;border-color:#bce8f1}.panel-info>.panel-heading+.panel-collapse>.panel-body{border-top-color:#bce8f1}.panel-info>.panel-heading .badge{color:#d9edf7;background-color:#31708f}.panel-info>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#bce8f1}.panel-warning{border-color:#faebcc}.panel-warning>.panel-heading{color:#8a6d3b;background-color:#fcf8e3;border-color:#faebcc}.panel-warning>.panel-heading+.panel-collapse>.panel-body{border-top-color:#faebcc}.panel-warning>.panel-heading .badge{color:#fcf8e3;background-color:#8a6d3b}.panel-warning>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#faebcc}.panel-danger{border-color:#ebccd1}.panel-danger>.panel-heading{color:#a94442;background-color:#f2dede;border-color:#ebccd1}.panel-danger>.panel-heading+.panel-collapse>.panel-body{border-top-color:#ebccd1}.panel-danger>.panel-heading .badge{color:#f2dede;background-color:#a94442}.panel-danger>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#ebccd1}.embed-responsive{position:relative;display:block;height:0;padding:0;overflow:hidden}.embed-responsive .embed-responsive-item,.embed-responsive iframe,.embed-responsive embed,.embed-responsive object{position:absolute;top:0;bottom:0;left:0;width:100%;height:100%;border:0}.embed-responsive.embed-responsive-16by9{padding-bottom:56.25%}.embed-responsive.embed-responsive-4by3{padding-bottom:75%}.well{min-height:20px;padding:19px;margin-bottom:20px;background-color:#f5f5f5;border:1px solid #e3e3e3;border-radius:4px;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.05);box-shadow:inset 0 1px 1px rgba(0,0,0,.05)}.well blockquote{border-color:#ddd;border-color:rgba(0,0,0,.15)}.well-lg{padding:24px;border-radius:6px}.well-sm{padding:9px;border-radius:3px}.close{float:right;font-size:21px;font-weight:700;line-height:1;color:#000;text-shadow:0 1px 0 #fff;filter:alpha(opacity=20);opacity:.2}.close:hover,.close:focus{color:#000;text-decoration:none;cursor:pointer;filter:alpha(opacity=50);opacity:.5}button.close{-webkit-appearance:none;padding:0;cursor:pointer;background:transparent;border:0}.modal-open{overflow:hidden}.modal{position:fixed;top:0;right:0;bottom:0;left:0;z-index:1050;display:none;overflow:hidden;-webkit-overflow-scrolling:touch;outline:0}.modal.fade .modal-dialog{-webkit-transition:-webkit-transform .3s ease-out;-o-transition:-o-transform .3s ease-out;transition:transform .3s ease-out;-webkit-transform:translate3d(0,-25%,0);-o-transform:translate3d(0,-25%,0);transform:translate3d(0,-25%,0)}.modal.in .modal-dialog{-webkit-transform:translate3d(0,0,0);-o-transform:translate3d(0,0,0);transform:translate3d(0,0,0)}.modal-open .modal{overflow-x:hidden;overflow-y:auto}.modal-dialog{position:relative;width:auto;margin:10px}.modal-content{position:relative;background-color:#fff;-webkit-background-clip:padding-box;background-clip:padding-box;border:1px solid #999;border:1px solid rgba(0,0,0,.2);border-radius:6px;outline:0;-webkit-box-shadow:0 3px 9px rgba(0,0,0,.5);box-shadow:0 3px 9px rgba(0,0,0,.5)}.modal-backdrop{position:fixed;top:0;right:0;bottom:0;left:0;z-index:1040;background-color:#000}.modal-backdrop.fade{filter:alpha(opacity=0);opacity:0}.modal-backdrop.in{filter:alpha(opacity=50);opacity:.5}.modal-header{min-height:16.42857143px;padding:15px;border-bottom:1px solid #e5e5e5}.modal-header .close{margin-top:-2px}.modal-title{margin:0;line-height:1.42857143}.modal-body{position:relative;padding:15px}.modal-footer{padding:15px;text-align:right;border-top:1px solid #e5e5e5}.modal-footer .btn+.btn{margin-bottom:0;margin-left:5px}.modal-footer .btn-group .btn+.btn{margin-left:-1px}.modal-footer .btn-block+.btn-block{margin-left:0}.modal-scrollbar-measure{position:absolute;top:-9999px;width:50px;height:50px;overflow:scroll}@media (min-width:768px){.modal-dialog{width:600px;margin:30px auto}.modal-content{-webkit-box-shadow:0 5px 15px rgba(0,0,0,.5);box-shadow:0 5px 15px rgba(0,0,0,.5)}.modal-sm{width:300px}}@media (min-width:992px){.modal-lg{width:900px}}.tooltip{position:absolute;z-index:1070;display:block;font-size:12px;line-height:1.4;visibility:visible;filter:alpha(opacity=0);opacity:0}.tooltip.in{filter:alpha(opacity=90);opacity:.9}.tooltip.top{padding:5px 0;margin-top:-3px}.tooltip.right{padding:0 5px;margin-left:3px}.tooltip.bottom{padding:5px 0;margin-top:3px}.tooltip.left{padding:0 5px;margin-left:-3px}.tooltip-inner{max-width:200px;padding:3px 8px;color:#fff;text-align:center;text-decoration:none;background-color:#000;border-radius:4px}.tooltip-arrow{position:absolute;width:0;height:0;border-color:transparent;border-style:solid}.tooltip.top .tooltip-arrow{bottom:0;left:50%;margin-left:-5px;border-width:5px 5px 0;border-top-color:#000}.tooltip.top-left .tooltip-arrow{bottom:0;left:5px;border-width:5px 5px 0;border-top-color:#000}.tooltip.top-right .tooltip-arrow{right:5px;bottom:0;border-width:5px 5px 0;border-top-color:#000}.tooltip.right .tooltip-arrow{top:50%;left:0;margin-top:-5px;border-width:5px 5px 5px 0;border-right-color:#000}.tooltip.left .tooltip-arrow{top:50%;right:0;margin-top:-5px;border-width:5px 0 5px 5px;border-left-color:#000}.tooltip.bottom .tooltip-arrow{top:0;left:50%;margin-left:-5px;border-width:0 5px 5px;border-bottom-color:#000}.tooltip.bottom-left .tooltip-arrow{top:0;left:5px;border-width:0 5px 5px;border-bottom-color:#000}.tooltip.bottom-right .tooltip-arrow{top:0;right:5px;border-width:0 5px 5px;border-bottom-color:#000}.popover{position:absolute;top:0;left:0;z-index:1060;display:none;max-width:276px;padding:1px;text-align:left;white-space:normal;background-color:#fff;-webkit-background-clip:padding-box;background-clip:padding-box;border:1px solid #ccc;border:1px solid rgba(0,0,0,.2);border-radius:6px;-webkit-box-shadow:0 5px 10px rgba(0,0,0,.2);box-shadow:0 5px 10px rgba(0,0,0,.2)}.popover.top{margin-top:-10px}.popover.right{margin-left:10px}.popover.bottom{margin-top:10px}.popover.left{margin-left:-10px}.popover-title{padding:8px 14px;margin:0;font-size:14px;font-weight:400;line-height:18px;background-color:#f7f7f7;border-bottom:1px solid #ebebeb;border-radius:5px 5px 0 0}.popover-content{padding:9px 14px}.popover>.arrow,.popover>.arrow:after{position:absolute;display:block;width:0;height:0;border-color:transparent;border-style:solid}.popover>.arrow{border-width:11px}.popover>.arrow:after{content:"";border-width:10px}.popover.top>.arrow{bottom:-11px;left:50%;margin-left:-11px;border-top-color:#999;border-top-color:rgba(0,0,0,.25);border-bottom-width:0}.popover.top>.arrow:after{bottom:1px;margin-left:-10px;content:" ";border-top-color:#fff;border-bottom-width:0}.popover.right>.arrow{top:50%;left:-11px;margin-top:-11px;border-right-color:#999;border-right-color:rgba(0,0,0,.25);border-left-width:0}.popover.right>.arrow:after{bottom:-10px;left:1px;content:" ";border-right-color:#fff;border-left-width:0}.popover.bottom>.arrow{top:-11px;left:50%;margin-left:-11px;border-top-width:0;border-bottom-color:#999;border-bottom-color:rgba(0,0,0,.25)}.popover.bottom>.arrow:after{top:1px;margin-left:-10px;content:" ";border-top-width:0;border-bottom-color:#fff}.popover.left>.arrow{top:50%;right:-11px;margin-top:-11px;border-right-width:0;border-left-color:#999;border-left-color:rgba(0,0,0,.25)}.popover.left>.arrow:after{right:1px;bottom:-10px;content:" ";border-right-width:0;border-left-color:#fff}.carousel{position:relative}.carousel-inner{position:relative;width:100%;overflow:hidden}.carousel-inner>.item{position:relative;display:none;-webkit-transition:.6s ease-in-out left;-o-transition:.6s ease-in-out left;transition:.6s ease-in-out left}.carousel-inner>.item>img,.carousel-inner>.item>a>img{line-height:1}.carousel-inner>.active,.carousel-inner>.next,.carousel-inner>.prev{display:block}.carousel-inner>.active{left:0}.carousel-inner>.next,.carousel-inner>.prev{position:absolute;top:0;width:100%}.carousel-inner>.next{left:100%}.carousel-inner>.prev{left:-100%}.carousel-inner>.next.left,.carousel-inner>.prev.right{left:0}.carousel-inner>.active.left{left:-100%}.carousel-inner>.active.right{left:100%}.carousel-control{position:absolute;top:0;bottom:0;left:0;width:15%;font-size:20px;color:#fff;text-align:center;text-shadow:0 1px 2px rgba(0,0,0,.6);filter:alpha(opacity=50);opacity:.5}.carousel-control.left{background-image:-webkit-linear-gradient(left,rgba(0,0,0,.5) 0,rgba(0,0,0,.0001) 100%);background-image:-o-linear-gradient(left,rgba(0,0,0,.5) 0,rgba(0,0,0,.0001) 100%);background-image:-webkit-gradient(linear,left top,right top,from(rgba(0,0,0,.5)),to(rgba(0,0,0,.0001)));background-image:linear-gradient(to right,rgba(0,0,0,.5) 0,rgba(0,0,0,.0001) 100%);filter:progid:DXImageTransform.Microsoft.gradient(startColorstr='#80000000', endColorstr='#00000000', GradientType=1);background-repeat:repeat-x}.carousel-control.right{right:0;left:auto;background-image:-webkit-linear-gradient(left,rgba(0,0,0,.0001) 0,rgba(0,0,0,.5) 100%);background-image:-o-linear-gradient(left,rgba(0,0,0,.0001) 0,rgba(0,0,0,.5) 100%);background-image:-webkit-gradient(linear,left top,right top,from(rgba(0,0,0,.0001)),to(rgba(0,0,0,.5)));background-image:linear-gradient(to right,rgba(0,0,0,.0001) 0,rgba(0,0,0,.5) 100%);filter:progid:DXImageTransform.Microsoft.gradient(startColorstr='#00000000', endColorstr='#80000000', GradientType=1);background-repeat:repeat-x}.carousel-control:hover,.carousel-control:focus{color:#fff;text-decoration:none;filter:alpha(opacity=90);outline:0;opacity:.9}.carousel-control .icon-prev,.carousel-control .icon-next,.carousel-control .glyphicon-chevron-left,.carousel-control .glyphicon-chevron-right{position:absolute;top:50%;z-index:5;display:inline-block}.carousel-control .icon-prev,.carousel-control .glyphicon-chevron-left{left:50%;margin-left:-10px}.carousel-control .icon-next,.carousel-control .glyphicon-chevron-right{right:50%;margin-right:-10px}.carousel-control .icon-prev,.carousel-control .icon-next{width:20px;height:20px;margin-top:-10px;font-family:serif}.carousel-control .icon-prev:before{content:'\2039'}.carousel-control .icon-next:before{content:'\203a'}.carousel-indicators{position:absolute;bottom:10px;left:50%;z-index:15;width:60%;padding-left:0;margin-left:-30%;text-align:center;list-style:none}.carousel-indicators li{display:inline-block;width:10px;height:10px;margin:1px;text-indent:-999px;cursor:pointer;background-color:#000 \9;background-color:rgba(0,0,0,0);border:1px solid #fff;border-radius:10px}.carousel-indicators .active{width:12px;height:12px;margin:0;background-color:#fff}.carousel-caption{position:absolute;right:15%;bottom:20px;left:15%;z-index:10;padding-top:20px;padding-bottom:20px;color:#fff;text-align:center;text-shadow:0 1px 2px rgba(0,0,0,.6)}.carousel-caption .btn{text-shadow:none}@media screen and (min-width:768px){.carousel-control .glyphicon-chevron-left,.carousel-control .glyphicon-chevron-right,.carousel-control .icon-prev,.carousel-control .icon-next{width:30px;height:30px;margin-top:-15px;font-size:30px}.carousel-control .glyphicon-chevron-left,.carousel-control .icon-prev{margin-left:-15px}.carousel-control .glyphicon-chevron-right,.carousel-control .icon-next{margin-right:-15px}.carousel-caption{right:20%;left:20%;padding-bottom:30px}.carousel-indicators{bottom:20px}}.clearfix:before,.clearfix:after,.dl-horizontal dd:before,.dl-horizontal dd:after,.container:before,.container:after,.container-fluid:before,.container-fluid:after,.row:before,.row:after,.form-horizontal .form-group:before,.form-horizontal .form-group:after,.btn-toolbar:before,.btn-toolbar:after,.btn-group-vertical>.btn-group:before,.btn-group-vertical>.btn-group:after,.nav:before,.nav:after,.navbar:before,.navbar:after,.navbar-header:before,.navbar-header:after,.navbar-collapse:before,.navbar-collapse:after,.pager:before,.pager:after,.panel-body:before,.panel-body:after,.modal-footer:before,.modal-footer:after{display:table;content:" "}.clearfix:after,.dl-horizontal dd:after,.container:after,.container-fluid:after,.row:after,.form-horizontal .form-group:after,.btn-toolbar:after,.btn-group-vertical>.btn-group:after,.nav:after,.navbar:after,.navbar-header:after,.navbar-collapse:after,.pager:after,.panel-body:after,.modal-footer:after{clear:both}.center-block{display:block;margin-right:auto;margin-left:auto}.pull-right{float:right!important}.pull-left{float:left!important}.hide{display:none!important}.show{display:block!important}.invisible{visibility:hidden}.text-hide{font:0/0 a;color:transparent;text-shadow:none;background-color:transparent;border:0}.hidden{display:none!important;visibility:hidden!important}.affix{position:fixed;-webkit-transform:translate3d(0,0,0);-o-transform:translate3d(0,0,0);transform:translate3d(0,0,0)}@-ms-viewport{width:device-width}.visible-xs,.visible-sm,.visible-md,.visible-lg{display:none!important}.visible-xs-block,.visible-xs-inline,.visible-xs-inline-block,.visible-sm-block,.visible-sm-inline,.visible-sm-inline-block,.visible-md-block,.visible-md-inline,.visible-md-inline-block,.visible-lg-block,.visible-lg-inline,.visible-lg-inline-block{display:none!important}@media (max-width:767px){.visible-xs{display:block!important}table.visible-xs{display:table}tr.visible-xs{display:table-row!important}th.visible-xs,td.visible-xs{display:table-cell!important}}@media (max-width:767px){.visible-xs-block{display:block!important}}@media (max-width:767px){.visible-xs-inline{display:inline!important}}@media (max-width:767px){.visible-xs-inline-block{display:inline-block!important}}@media (min-width:768px) and (max-width:991px){.visible-sm{display:block!important}table.visible-sm{display:table}tr.visible-sm{display:table-row!important}th.visible-sm,td.visible-sm{display:table-cell!important}}@media (min-width:768px) and (max-width:991px){.visible-sm-block{display:block!important}}@media (min-width:768px) and (max-width:991px){.visible-sm-inline{display:inline!important}}@media (min-width:768px) and (max-width:991px){.visible-sm-inline-block{display:inline-block!important}}@media (min-width:992px) and (max-width:1199px){.visible-md{display:block!important}table.visible-md{display:table}tr.visible-md{display:table-row!important}th.visible-md,td.visible-md{display:table-cell!important}}@media (min-width:992px) and (max-width:1199px){.visible-md-block{display:block!important}}@media (min-width:992px) and (max-width:1199px){.visible-md-inline{display:inline!important}}@media (min-width:992px) and (max-width:1199px){.visible-md-inline-block{display:inline-block!important}}@media (min-width:1200px){.visible-lg{display:block!important}table.visible-lg{display:table}tr.visible-lg{display:table-row!important}th.visible-lg,td.visible-lg{display:table-cell!important}}@media (min-width:1200px){.visible-lg-block{display:block!important}}@media (min-width:1200px){.visible-lg-inline{display:inline!important}}@media (min-width:1200px){.visible-lg-inline-block{display:inline-block!important}}@media (max-width:767px){.hidden-xs{display:none!important}}@media (min-width:768px) and (max-width:991px){.hidden-sm{display:none!important}}@media (min-width:992px) and (max-width:1199px){.hidden-md{display:none!important}}@media (min-width:1200px){.hidden-lg{display:none!important}}.visible-print{display:none!important}@media print{.visible-print{display:block!important}table.visible-print{display:table}tr.visible-print{display:table-row!important}th.visible-print,td.visible-print{display:table-cell!important}}.visible-print-block{display:none!important}@media print{.visible-print-block{display:block!important}}.visible-print-inline{display:none!important}@media print{.visible-print-inline{display:inline!important}}.visible-print-inline-block{display:none!important}@media print{.visible-print-inline-block{display:inline-block!important}}@media print{.hidden-print{display:none!important}}
\ No newline at end of file
diff --git a/mutalyzer/website/templates/static/css/style.css b/mutalyzer/website/templates/static/css/style.css
index 23e5c2b0158ed326ddf594dbb4ee1b857f4547a0..5bd961bbe30186dec9c6d1d72a9c92ffbff746a6 100644
--- a/mutalyzer/website/templates/static/css/style.css
+++ b/mutalyzer/website/templates/static/css/style.css
@@ -1,311 +1,469 @@
-.tablehead {
- font-family : Arial, Helvetica, sans-serif;
- font-size : 11px;
- font-weight : bold;
- background-color : #002E65;
- color: #ffffff;
+body{
+/* width: 900px;*/
+/* margin: 0 10px;*/
+ padding-top: 70px;
+/* padding-top: 110px;*/
+
+ font-family: Roboto;
+ -webkit-font-smoothing: antialiased;
}
-.tabletext {
- font-family : Arial, Helvetica, sans-serif;
- font-size : 11px;
+.block {
+ background: white;
+ max-width: 1024px;
+ margin-left: auto;
+ margin-right: auto;
+ padding: 40px;
+ margin-bottom: 25px;
+
+ border-radius: 2px;
+
+ font-size: 14px;
+ font-weight: 400;
+
+}
+.block-shadow {
+/* box-shadow: 0 -1px 2.5px rgba(0,0,0,0.12), 0 1px 2px rgba(0, 0,0,0.24);*/
+ box-shadow: 1px 2px 2px rgba(50,50,50,.16), -1px -1px 3px rgba(50, 50, 50,.23);
+
+}
+
+
+.block h1 {
+ font-size: 45px;
+ color: rgb(0, 0, 0, 0.46);
+ line-height: 48px;
+ font-weight: 400;
+ margin: 0;
+ margin-bottom: 16px;
+}
+
+.block-in-block{
+/* max-width: 944px;*/
+ padding: 0;
+ margin-bottom: 40px;
+}
+
+
+@media (max-width: 767px) {
+ .block {
+ padding: 15px;
+ }
+
+ .block-shadow {
+ box-shadow: none;
+ }
+
+ .block h1 {
+ font-size: 32px;
+ line-height: 1em;
+ }
}
-.tableitalic {
- font-family : Arial, Helvetica, sans-serif;
- font-size : 11px;
- font-style : italic;
+footer{
+ text-align: center;
+ padding-top: 5px;
+ clear: both;
}
-a {
- color : #002E65;
+footer.row {
+ max-width: 1024px;
+ margin: 0 auto;
}
-a:hover {
- color : #8096B2;
+.navbar {
+/* padding-top:20px;
+ padding-bottom: 20px;*/
+}
+.navbar-header {
+ z-index: 3;
+ position: relative;
}
-.importanthead {
- font-family : Arial, Helvetica, sans-serif;
- font-size : 10pt;
- font-weight : bold;
- text-decoration : none;
+@media (min-width: 1380px) {
+ .navbar > .container-fluid > .navbar-collapse {
+ max-width: 1024px;
+ margin: 0 auto;
}
+}
-.importanttext {
- border : 1px solid black;
- background-color : #717B9D;
- font-family : Arial, Helvetica, sans-serif;
- font-size : 10pt;
- font-weight : normal;
- text-decoration : none;
+.navbar-header > .navbar-toggle {
+ border-color: #888;
}
-body, div, span, font, td {
- font-family : Arial, Helvetica, sans-serif;
- font-size : 10pt;
- font-weight : normal;
- text-decoration : none;
+.background {
+ background: url('../images/mutalyzer_logo.png');
+ background-size: 100%;
+ opacity: 0.3;
+ position: absolute;
+ width: 100%;
+/* height: 100%;*/
+ top: 0;
+ left: 0;
+ bottom: 0;
+ right: 0;
+ z-index: 0;
}
-.raTable tr td {
- text-align : right;
- border : 1px solid grey;
- padding : 0px 4px;
+@media (max-width: 648px) {
+ .background {
+ height: 51px;
+ }
}
-.raTable {
- border : 1px solid grey;
- border-collapse : collapse;
+
+h1{
+/* text-align: center;*/
}
-.laTable tr td {
- border : 1px solid grey;
- padding : 0px 4px;
+h2,h3,h4,h5{
+ text-align: left;
}
-.laTable {
- border : 1px solid grey;
- border-collapse : collapse;
+input[type="text"].form-pre{
+ font-family: Menlo, Monaco, Consolas, "Courier New", monospace;
}
-.helper {
- border : 1px dotted grey;
- background-color : #ffffcc;
- display: inline-block;
- vertical-align: baseline;
- line-height: 12px;
+code {
+ color: #0B9B33;
+ background-color: #F2F9F3;
+ white-space: normal;
}
-ol, li, p {
- font-family : Arial, Helvetica, sans-serif;
- font-size : 10pt;
- font-weight : normal;
- text-decoration : none;
+pre{
+/* margin: 15px 30px;*/
+}
+header.main-header {
+ height: 80px;
+/* width: 649px;*/
}
-ul {
- list-style-image : url(../images/bullit.gif);
- left : -25px;
- position : relative;
+.details{
+ background-color: aliceblue;
+ padding: 20px;
+ border: 1px solid #eee;
}
-.inverted {
- background-color: #002E65;
- color: white;
+.table2 > td {
+ padding: 3px;
+ }
+
+.table2{
+ margin-bottom: 0px;
+}
+
+.pre {
+ padding: 0 9.5px;
+ margin: 0 30px 10px 30px;
+ font-size: 13px;
+ line-height: 1.42857143;
+ color: #333;
+ background-color: #f5f5f5;
+ border: 1px solid #ccc;
+ border-radius: 4px;
}
-.faculteitsonderdeel {
- color : #002E65;
- font-size : 18px;
- font-weight : bold;
- padding-bottom : 18px;
- padding-top : 2px;
+.helper{
+ border-bottom: 1px dotted grey;
+ cursor: default;
}
-.hoofdstuk {
- font-size : 12pt;
- font-weight : bold;
- padding-bottom : 5px;
+.btn-right{
+ width: 177px;
+ margin-left: 375px;
}
-.hoofdstuknopad {
- font-size : 12pt;
- font-weight : bold;
- padding-bottom : 1px;
+.btn-submit{
+ margin-top: 15px;
}
-.hornav {
- color : #002E65;
- font-weight : bold;
- text-decoration : none;
+.summary{
+ text-align: left;
}
-.hornav:hover {
- color : #8096B2;
+#output{
+ width: 100%;
+ /*background-color: green;*/
}
-.navhoofdstuk {
- color : #C2C6D5;
+#outputhelp{
+ color: #444;
+ font-size: 12px;
}
-.paragraaf {
- font-size : 11pt;
- font-weight : bold;
- padding-bottom : 6px;
+.remove{
+ color: #FF0000;
+ font-size: 11px;
+ cursor: pointer;
+}
+
+#variants{
+ /* border: 1px solid green; */
}
-.submen1{
- left : 30px;
- position : relative;
+.group:after {
+ visibility: hidden;
+ display: block;
+ content: "";
+ clear: both;
+ height: 0;
}
-.subparagraaf {
- font-size : 10pt;
- font-weight : bold;
+* html .group { zoom: 1; } /* IE6 */
+
+*:first-child+html .group { zoom: 1; } /* IE7 */
+
+
+
+.thumb-home {
+ background-color: #ebebeb;
+ height: 240px;
}
-.test1 {
- position : relative;
+.thumb-home > .caption > h3 {
+ margin-top: auto;
}
-.th {
- color : #FFFFFF;
- font-weight : bold;
+@media (min-height: 850px) and (min-width: 992px) {
+ .thumb-home {
+ height: 245px;
+ margin-bottom: 30px;
+ }
+
+ .thumb-home > .caption > h3 {
+ margin-top: 12px;
+ }
}
-.thcontent {
- padding-bottom : 1px;
- padding-left : 1px;
- padding-right : 1px;
- padding-top : 1px;
+@media (max-width: 991px) {
+ .thumb-home {
+ height: auto;
+ }
}
-.menu {
- line-height : 18px;
+.color-1 {
+ background-color: rgba(165, 192, 96, .35);
+ border-color: rgba(165, 192, 96, .75);
}
-.menu a {
- color : #002E65;
- text-decoration : none;
+.color-2 {
+ background-color: rgba(237, 160, 118, .35);
+ border-color: rgba(237, 160, 118, .75);
+}
+.color-3 {
+ background-color: rgba(112, 187, 224, .35);
+ border-color: rgba(112, 187, 224, .75);
}
-.menu:hover a, .menu a:hover {
- color : #FFFFFF;
+.color-4 {
+ background-color: rgba(172, 135, 204, .35);
+ border-color: rgba(172, 135, 204, .75);
}
-.menu.active a {
- color : #FFFFFF;
- font-weight: bold;
+.color-5 {
+ background-color: rgba(255, 238, 128, .35);
+ border-color: rgba(255, 238, 128, .75);
}
-.menu .bullet {
- height: 22px;
- background: url('../images/bullitdonker.gif') no-repeat top left;
+.color-6 {
+ background-color: rgba(189, 95, 101, .35);
+ border-color: rgba(189, 95, 101, .75);
}
-.menu .bullet.sub {
- background-image: url('../images/bullitmiddel.gif');
+.color-7 {
+ background-color: rgba(191, 191, 191, .35);
+ border-color: rgba(191, 191, 191, .75);
}
-.menu.active .bullet, .menu:hover .bullet {
- background-image: url('../images/bullitlicht1.gif');
+.color-8 {
+ background-color: rgba(84, 84, 84, .35);
+ border-color: rgba(84, 84, 84, .75);
}
-.menu.active .bullet.sub, .menu:hover .bullet.sub {
- background-image: url('../images/bullitlicht2.gif');
+.color-1:hover {
+ background-color: rgba(165, 192, 96, .6);
+ border-color: rgba(165, 192, 96, 1);
}
-.menu.inactive:hover .bullet {
- background-image: url('../images/bullitdonker.gif');
+.color-2:hover {
+ background-color: rgba(237, 160, 118, .6);
+ border-color: rgba(237, 160, 118, 1);
+}
+.color-3:hover {
+ background-color: rgba(112, 187, 224, .6);
+ border-color: rgba(112, 187, 224, 1);
}
-#content{
- left : 230px;
- position : absolute;
- top : 121px;
- width : 480px;
+.color-4:hover {
+ background-color: rgba(172, 135, 204, .6);
+ border-color: rgba(172, 135, 204, 1);
}
-#menu{
- left : 0px;
- width : 175px;
- z-index : 10;
+.color-5:hover {
+ background-color: rgba(255, 238, 128, .6);
+ border-color: rgba(255, 238, 128, 1);
}
-#menu td {
- color : #002E65;
+.color-6:hover {
+ background-color: rgba(189, 95, 101, .6);
+ border-color: rgba(189, 95, 101, 1);
}
-.Interface {
- color : #FFCC00;
- background-color : #333333;
- font-weight : bold;
- text-align : center;
- font-family : Arial, Helvetica, sans-serif;
+.color-7:hover {
+ background-color: rgba(191, 191, 191, .6);
+ border-color: rgba(191, 191, 191, 1);
}
-.Info {
- color : Black;
- background-color : #D1DBFD;
- border : 1px solid Black;
- text-align : justify;
- font-family : Arial, Helvetica, sans-serif;
+
+.color-8:hover {
+ background-color: rgba(84, 84, 84, .6);
+ border-color: rgba(84, 84, 84, 1);
}
-.Important {
- color : Darkred;
- background-color : #cccccc;
- font-weight : bold;
- font-style : italic;
- font-family : Arial, Helvetica, sans-serif;
+
+
+.thumb-large {
+ font-size: 17px;
+ line-height: 24px;
+ height: auto;
+}
+
+.thumb-large > caption > h3{
+ font-size: 27px;
+}
+.clickbox {
+ cursor: pointer;
}
-.Header {
- color : Black;
- text-align : left;
- font-style : italic;
- font-family : "Times New Roman", Times, serif;
+
+.navbar-default .navbar-nav > li > a{
+ color: #444;
+}
+
+.block-700{
+ min-width: 900px;
+ padding: 20px;
}
-i {
- font-size : 10pt;
- font-style : italic;
- font-family : Arial, Helvetica, sans-serif;
+.form-control-small{
+ width: 740px;
+ display: inline-block;
+}
+.form-control-clear{
+ width: 842px;
+ display: inline-block;
}
-.messages {
- width: 620px;
+.leftcol{
+ width: 40%;
+ float: left;
}
-.debug, .information, .warning, .error {
- padding-left: 25px;
- background: left top no-repeat;
+.rightcol{
+ width: 40%;
+ float: right;
}
-.debug {
- background-image: url('../images/debug.png');
+.example-input, .example-input-2 {
+ cursor: pointer;
}
-.information {
- background-image: url('../images/info.png');
+.example-input:hover, .example-input-2:hover {
+ color: #F2F9F3;
+ background-color: #5BC779;
}
-.warning {
- background-image: url('../images/warning.png');
+.btn-home-down {
+ position: absolute;
+ bottom: 34px;
+ right: 34px;
}
-.error {
- background-image: url('../images/error.png');
+@media (min-height: 850px) and (min-width: 992px) {
+ .btn-home-down {
+ bottom: 44px;
+ }
}
-.thnormal {
- font-family: Arial, Helvetica, sans-serif;
- font-weight: bold;
- color: #FFFFFF;
- background-color : #002E65;
+@media (max-width: 991px) {
+ .btn-home-down {
+ position: static;
+ }
}
-.person {
- color: #002E65;
- text-decoration: none;
- font-style: italic;
+
+.btn.pull-right + .btn.pull-right {
+ margin-right: 4px;
}
-.person:hover {
- color : #8096B2;
- text-decoration: none;
- font-style: italic;
+@media (max-width: 767px) {
+ .btn {
+ width: 100%;
+ }
+ .btn ~ .btn {
+ margin: 5px 0px 0px 0px;
+ }
+ .btn.pull-right + .btn.pull-right {
+ margin-right: 0px;
+ }
}
-.person:visited {
- text-decoration: none;
- font-style: italic;
+
+.label-left{
+ width: 160px;
}
-.submitLink {
- color: #00f;
- font-family: monospace;
- background-color: transparent;
- text-decoration: underline;
- border: none;
- padding: 0;
- cursor: pointer;
- text-align: left;
+/* NAME CHECKER SPECIFIC */
+@media (min-width: 992px) {
+ .name-checker-left-column {
+ padding-right: 40px;
+ }
+
+ .name-checker-left-column > h3 {
+ margin-top: 40px;
+ }
+
+ .name-checker-left-column > h4 {
+ margin-top: 25px;
+ }
+}
+
+/* NAME GENERATOR SPECIFIC */
+.form-horizontal-inline > div.form-group, .form-horizontal-inline > div > div.form-group {
+ margin-left: 0;
+ margin-right: 0;
+}
+
+
+.form-signin {
+ width: 610px;
+ margin: 0 auto;
+ display: block;
+ padding: 15px 30px;
+ /* border: 1px solid blue; */
+}
+.form-signin .form-signin-heading,
+.form-signin .checkbox {
+ margin-bottom: 10px;
+}
+.form-signin .checkbox {
+ font-weight: normal;
+}
+.form-signin .form-control {
+ position: relative;
+ height: auto;
+ -webkit-box-sizing: border-box;
+ -moz-box-sizing: border-box;
+ box-sizing: border-box;
+ padding: 10px;
+ font-size: 16px;
+}
+.form-signin .form-control:focus {
+ z-index: 2;
+}
+.form-signin input[type="email"] {
+ margin-bottom: -1px;
+ border-bottom-right-radius: 0;
+ border-bottom-left-radius: 0;
+}
+.form-signin input[type="password"] {
+ margin-bottom: 10px;
+ border-top-left-radius: 0;
+ border-top-right-radius: 0;
}
diff --git a/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.eot b/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.eot
new file mode 100644
index 0000000000000000000000000000000000000000..4a4ca865d67e86f961bc6e2ef00bffa4e34bb9ed
Binary files /dev/null and b/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.eot differ
diff --git a/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.svg b/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.svg
new file mode 100644
index 0000000000000000000000000000000000000000..e3e2dc739dd851f2d7d291be032e30b909e3e95f
--- /dev/null
+++ b/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.svg
@@ -0,0 +1,229 @@
+<?xml version="1.0" standalone="no"?>
+<!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd" >
+<svg xmlns="http://www.w3.org/2000/svg">
+<metadata></metadata>
+<defs>
+<font id="glyphicons_halflingsregular" horiz-adv-x="1200" >
+<font-face units-per-em="1200" ascent="960" descent="-240" />
+<missing-glyph horiz-adv-x="500" />
+<glyph />
+<glyph />
+<glyph unicode="
" />
+<glyph unicode=" " />
+<glyph unicode="*" d="M100 500v200h259l-183 183l141 141l183 -183v259h200v-259l183 183l141 -141l-183 -183h259v-200h-259l183 -183l-141 -141l-183 183v-259h-200v259l-183 -183l-141 141l183 183h-259z" />
+<glyph unicode="+" d="M0 400v300h400v400h300v-400h400v-300h-400v-400h-300v400h-400z" />
+<glyph unicode=" " />
+<glyph unicode=" " horiz-adv-x="652" />
+<glyph unicode=" " horiz-adv-x="1304" />
+<glyph unicode=" " horiz-adv-x="652" />
+<glyph unicode=" " horiz-adv-x="1304" />
+<glyph unicode=" " horiz-adv-x="434" />
+<glyph unicode=" " horiz-adv-x="326" />
+<glyph unicode=" " horiz-adv-x="217" />
+<glyph unicode=" " horiz-adv-x="217" />
+<glyph unicode=" " horiz-adv-x="163" />
+<glyph unicode=" " horiz-adv-x="260" />
+<glyph unicode=" " horiz-adv-x="72" />
+<glyph unicode=" " horiz-adv-x="260" />
+<glyph unicode=" " horiz-adv-x="326" />
+<glyph unicode="€" d="M100 500l100 100h113q0 47 5 100h-218l100 100h135q37 167 112 257q117 141 297 141q242 0 354 -189q60 -103 66 -209h-181q0 55 -25.5 99t-63.5 68t-75 36.5t-67 12.5q-24 0 -52.5 -10t-62.5 -32t-65.5 -67t-50.5 -107h379l-100 -100h-300q-6 -46 -6 -100h406l-100 -100 h-300q9 -74 33 -132t52.5 -91t62 -54.5t59 -29t46.5 -7.5q29 0 66 13t75 37t63.5 67.5t25.5 96.5h174q-31 -172 -128 -278q-107 -117 -274 -117q-205 0 -324 158q-36 46 -69 131.5t-45 205.5h-217z" />
+<glyph unicode="−" d="M200 400h900v300h-900v-300z" />
+<glyph unicode="◼" horiz-adv-x="500" d="M0 0z" />
+<glyph unicode="☁" d="M-14 494q0 -80 56.5 -137t135.5 -57h750q120 0 205 86.5t85 207.5t-85 207t-205 86q-46 0 -90 -14q-44 97 -134.5 156.5t-200.5 59.5q-152 0 -260 -107.5t-108 -260.5q0 -25 2 -37q-66 -14 -108.5 -67.5t-42.5 -122.5z" />
+<glyph unicode="✉" d="M0 100l400 400l200 -200l200 200l400 -400h-1200zM0 300v600l300 -300zM0 1100l600 -603l600 603h-1200zM900 600l300 300v-600z" />
+<glyph unicode="✏" d="M-13 -13l333 112l-223 223zM187 403l214 -214l614 614l-214 214zM887 1103l214 -214l99 92q13 13 13 32.5t-13 33.5l-153 153q-15 13 -33 13t-33 -13z" />
+<glyph unicode="" d="M0 1200h1200l-500 -550v-550h300v-100h-800v100h300v550z" />
+<glyph unicode="" d="M14 84q18 -55 86 -75.5t147 5.5q65 21 109 69t44 90v606l600 155v-521q-64 16 -138 -7q-79 -26 -122.5 -83t-25.5 -111q18 -55 86 -75.5t147 4.5q70 23 111.5 63.5t41.5 95.5v881q0 10 -7 15.5t-17 2.5l-752 -193q-10 -3 -17 -12.5t-7 -19.5v-689q-64 17 -138 -7 q-79 -25 -122.5 -82t-25.5 -112z" />
+<glyph unicode="" d="M23 693q0 200 142 342t342 142t342 -142t142 -342q0 -142 -78 -261l300 -300q7 -8 7 -18t-7 -18l-109 -109q-8 -7 -18 -7t-18 7l-300 300q-119 -78 -261 -78q-200 0 -342 142t-142 342zM176 693q0 -136 97 -233t234 -97t233.5 96.5t96.5 233.5t-96.5 233.5t-233.5 96.5 t-234 -97t-97 -233z" />
+<glyph unicode="" d="M100 784q0 64 28 123t73 100.5t104.5 64t119 20.5t120 -38.5t104.5 -104.5q48 69 109.5 105t121.5 38t118.5 -20.5t102.5 -64t71 -100.5t27 -123q0 -57 -33.5 -117.5t-94 -124.5t-126.5 -127.5t-150 -152.5t-146 -174q-62 85 -145.5 174t-149.5 152.5t-126.5 127.5 t-94 124.5t-33.5 117.5z" />
+<glyph unicode="" d="M-72 800h479l146 400h2l146 -400h472l-382 -278l145 -449l-384 275l-382 -275l146 447zM168 71l2 1z" />
+<glyph unicode="" d="M-72 800h479l146 400h2l146 -400h472l-382 -278l145 -449l-384 275l-382 -275l146 447zM168 71l2 1zM237 700l196 -142l-73 -226l192 140l195 -141l-74 229l193 140h-235l-77 211l-78 -211h-239z" />
+<glyph unicode="" d="M0 0v143l400 257v100q-37 0 -68.5 74.5t-31.5 125.5v200q0 124 88 212t212 88t212 -88t88 -212v-200q0 -51 -31.5 -125.5t-68.5 -74.5v-100l400 -257v-143h-1200z" />
+<glyph unicode="" d="M0 0v1100h1200v-1100h-1200zM100 100h100v100h-100v-100zM100 300h100v100h-100v-100zM100 500h100v100h-100v-100zM100 700h100v100h-100v-100zM100 900h100v100h-100v-100zM300 100h600v400h-600v-400zM300 600h600v400h-600v-400zM1000 100h100v100h-100v-100z M1000 300h100v100h-100v-100zM1000 500h100v100h-100v-100zM1000 700h100v100h-100v-100zM1000 900h100v100h-100v-100z" />
+<glyph unicode="" d="M0 50v400q0 21 14.5 35.5t35.5 14.5h400q21 0 35.5 -14.5t14.5 -35.5v-400q0 -21 -14.5 -35.5t-35.5 -14.5h-400q-21 0 -35.5 14.5t-14.5 35.5zM0 650v400q0 21 14.5 35.5t35.5 14.5h400q21 0 35.5 -14.5t14.5 -35.5v-400q0 -21 -14.5 -35.5t-35.5 -14.5h-400 q-21 0 -35.5 14.5t-14.5 35.5zM600 50v400q0 21 14.5 35.5t35.5 14.5h400q21 0 35.5 -14.5t14.5 -35.5v-400q0 -21 -14.5 -35.5t-35.5 -14.5h-400q-21 0 -35.5 14.5t-14.5 35.5zM600 650v400q0 21 14.5 35.5t35.5 14.5h400q21 0 35.5 -14.5t14.5 -35.5v-400 q0 -21 -14.5 -35.5t-35.5 -14.5h-400q-21 0 -35.5 14.5t-14.5 35.5z" />
+<glyph unicode="" d="M0 50v200q0 21 14.5 35.5t35.5 14.5h200q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5zM0 450v200q0 21 14.5 35.5t35.5 14.5h200q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-200 q-21 0 -35.5 14.5t-14.5 35.5zM0 850v200q0 21 14.5 35.5t35.5 14.5h200q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5zM400 50v200q0 21 14.5 35.5t35.5 14.5h200q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5 t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5zM400 450v200q0 21 14.5 35.5t35.5 14.5h200q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5zM400 850v200q0 21 14.5 35.5t35.5 14.5h200q21 0 35.5 -14.5t14.5 -35.5 v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5zM800 50v200q0 21 14.5 35.5t35.5 14.5h200q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5zM800 450v200q0 21 14.5 35.5t35.5 14.5h200 q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5zM800 850v200q0 21 14.5 35.5t35.5 14.5h200q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5z" />
+<glyph unicode="" d="M0 50v200q0 21 14.5 35.5t35.5 14.5h200q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5zM0 450q0 -21 14.5 -35.5t35.5 -14.5h200q21 0 35.5 14.5t14.5 35.5v200q0 21 -14.5 35.5t-35.5 14.5h-200q-21 0 -35.5 -14.5 t-14.5 -35.5v-200zM0 850v200q0 21 14.5 35.5t35.5 14.5h200q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5zM400 50v200q0 21 14.5 35.5t35.5 14.5h700q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5 t-35.5 -14.5h-700q-21 0 -35.5 14.5t-14.5 35.5zM400 450v200q0 21 14.5 35.5t35.5 14.5h700q21 0 35.5 -14.5t14.5 -35.5v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-700q-21 0 -35.5 14.5t-14.5 35.5zM400 850v200q0 21 14.5 35.5t35.5 14.5h700q21 0 35.5 -14.5t14.5 -35.5 v-200q0 -21 -14.5 -35.5t-35.5 -14.5h-700q-21 0 -35.5 14.5t-14.5 35.5z" />
+<glyph unicode="" d="M29 454l419 -420l818 820l-212 212l-607 -607l-206 207z" />
+<glyph unicode="" d="M106 318l282 282l-282 282l212 212l282 -282l282 282l212 -212l-282 -282l282 -282l-212 -212l-282 282l-282 -282z" />
+<glyph unicode="" d="M23 693q0 200 142 342t342 142t342 -142t142 -342q0 -142 -78 -261l300 -300q7 -8 7 -18t-7 -18l-109 -109q-8 -7 -18 -7t-18 7l-300 300q-119 -78 -261 -78q-200 0 -342 142t-142 342zM176 693q0 -136 97 -233t234 -97t233.5 96.5t96.5 233.5t-96.5 233.5t-233.5 96.5 t-234 -97t-97 -233zM300 600v200h100v100h200v-100h100v-200h-100v-100h-200v100h-100z" />
+<glyph unicode="" d="M23 694q0 200 142 342t342 142t342 -142t142 -342q0 -141 -78 -262l300 -299q7 -7 7 -18t-7 -18l-109 -109q-8 -8 -18 -8t-18 8l-300 300q-119 -78 -261 -78q-200 0 -342 142t-142 342zM176 694q0 -136 97 -233t234 -97t233.5 97t96.5 233t-96.5 233t-233.5 97t-234 -97 t-97 -233zM300 601h400v200h-400v-200z" />
+<glyph unicode="" d="M23 600q0 183 105 331t272 210v-166q-103 -55 -165 -155t-62 -220q0 -177 125 -302t302 -125t302 125t125 302q0 120 -62 220t-165 155v166q167 -62 272 -210t105 -331q0 -118 -45.5 -224.5t-123 -184t-184 -123t-224.5 -45.5t-224.5 45.5t-184 123t-123 184t-45.5 224.5 zM500 750q0 -21 14.5 -35.5t35.5 -14.5h100q21 0 35.5 14.5t14.5 35.5v400q0 21 -14.5 35.5t-35.5 14.5h-100q-21 0 -35.5 -14.5t-14.5 -35.5v-400z" />
+<glyph unicode="" d="M100 1h200v300h-200v-300zM400 1v500h200v-500h-200zM700 1v800h200v-800h-200zM1000 1v1200h200v-1200h-200z" />
+<glyph unicode="" d="M26 601q0 -33 6 -74l151 -38l2 -6q14 -49 38 -93l3 -5l-80 -134q45 -59 105 -105l133 81l5 -3q45 -26 94 -39l5 -2l38 -151q40 -5 74 -5q27 0 74 5l38 151l6 2q46 13 93 39l5 3l134 -81q56 44 104 105l-80 134l3 5q24 44 39 93l1 6l152 38q5 40 5 74q0 28 -5 73l-152 38 l-1 6q-16 51 -39 93l-3 5l80 134q-44 58 -104 105l-134 -81l-5 3q-45 25 -93 39l-6 1l-38 152q-40 5 -74 5q-27 0 -74 -5l-38 -152l-5 -1q-50 -14 -94 -39l-5 -3l-133 81q-59 -47 -105 -105l80 -134l-3 -5q-25 -47 -38 -93l-2 -6l-151 -38q-6 -48 -6 -73zM385 601 q0 88 63 151t152 63t152 -63t63 -151q0 -89 -63 -152t-152 -63t-152 63t-63 152z" />
+<glyph unicode="" d="M100 1025v50q0 10 7.5 17.5t17.5 7.5h275v100q0 41 29.5 70.5t70.5 29.5h300q41 0 70.5 -29.5t29.5 -70.5v-100h275q10 0 17.5 -7.5t7.5 -17.5v-50q0 -11 -7 -18t-18 -7h-1050q-11 0 -18 7t-7 18zM200 100v800h900v-800q0 -41 -29.5 -71t-70.5 -30h-700q-41 0 -70.5 30 t-29.5 71zM300 100h100v700h-100v-700zM500 100h100v700h-100v-700zM500 1100h300v100h-300v-100zM700 100h100v700h-100v-700zM900 100h100v700h-100v-700z" />
+<glyph unicode="" d="M1 601l656 644l644 -644h-200v-600h-300v400h-300v-400h-300v600h-200z" />
+<glyph unicode="" d="M100 25v1150q0 11 7 18t18 7h475v-500h400v-675q0 -11 -7 -18t-18 -7h-850q-11 0 -18 7t-7 18zM700 800v300l300 -300h-300z" />
+<glyph unicode="" d="M4 600q0 162 80 299t217 217t299 80t299 -80t217 -217t80 -299t-80 -299t-217 -217t-299 -80t-299 80t-217 217t-80 299zM186 600q0 -171 121.5 -292.5t292.5 -121.5t292.5 121.5t121.5 292.5t-121.5 292.5t-292.5 121.5t-292.5 -121.5t-121.5 -292.5zM500 500v400h100 v-300h200v-100h-300z" />
+<glyph unicode="" d="M-100 0l431 1200h209l-21 -300h162l-20 300h208l431 -1200h-538l-41 400h-242l-40 -400h-539zM488 500h224l-27 300h-170z" />
+<glyph unicode="" d="M0 0v400h490l-290 300h200v500h300v-500h200l-290 -300h490v-400h-1100zM813 200h175v100h-175v-100z" />
+<glyph unicode="" d="M1 600q0 122 47.5 233t127.5 191t191 127.5t233 47.5t233 -47.5t191 -127.5t127.5 -191t47.5 -233t-47.5 -233t-127.5 -191t-191 -127.5t-233 -47.5t-233 47.5t-191 127.5t-127.5 191t-47.5 233zM188 600q0 -170 121 -291t291 -121t291 121t121 291t-121 291t-291 121 t-291 -121t-121 -291zM350 600h150v300h200v-300h150l-250 -300z" />
+<glyph unicode="" d="M4 600q0 162 80 299t217 217t299 80t299 -80t217 -217t80 -299t-80 -299t-217 -217t-299 -80t-299 80t-217 217t-80 299zM186 600q0 -171 121.5 -292.5t292.5 -121.5t292.5 121.5t121.5 292.5t-121.5 292.5t-292.5 121.5t-292.5 -121.5t-121.5 -292.5zM350 600l250 300 l250 -300h-150v-300h-200v300h-150z" />
+<glyph unicode="" d="M0 25v475l200 700h800l199 -700l1 -475q0 -11 -7 -18t-18 -7h-1150q-11 0 -18 7t-7 18zM200 500h200l50 -200h300l50 200h200l-97 500h-606z" />
+<glyph unicode="" d="M4 600q0 162 80 299t217 217t299 80t299 -80t217 -217t80 -299t-80 -299t-217 -217t-299 -80t-299 80t-217 217t-80 299zM186 600q0 -172 121.5 -293t292.5 -121t292.5 121t121.5 293q0 171 -121.5 292.5t-292.5 121.5t-292.5 -121.5t-121.5 -292.5zM500 397v401 l297 -200z" />
+<glyph unicode="" d="M23 600q0 -118 45.5 -224.5t123 -184t184 -123t224.5 -45.5t224.5 45.5t184 123t123 184t45.5 224.5h-150q0 -177 -125 -302t-302 -125t-302 125t-125 302t125 302t302 125q136 0 246 -81l-146 -146h400v400l-145 -145q-157 122 -355 122q-118 0 -224.5 -45.5t-184 -123 t-123 -184t-45.5 -224.5z" />
+<glyph unicode="" d="M23 600q0 118 45.5 224.5t123 184t184 123t224.5 45.5q198 0 355 -122l145 145v-400h-400l147 147q-112 80 -247 80q-177 0 -302 -125t-125 -302h-150zM100 0v400h400l-147 -147q112 -80 247 -80q177 0 302 125t125 302h150q0 -118 -45.5 -224.5t-123 -184t-184 -123 t-224.5 -45.5q-198 0 -355 122z" />
+<glyph unicode="" d="M100 0h1100v1200h-1100v-1200zM200 100v900h900v-900h-900zM300 200v100h100v-100h-100zM300 400v100h100v-100h-100zM300 600v100h100v-100h-100zM300 800v100h100v-100h-100zM500 200h500v100h-500v-100zM500 400v100h500v-100h-500zM500 600v100h500v-100h-500z M500 800v100h500v-100h-500z" />
+<glyph unicode="" d="M0 100v600q0 41 29.5 70.5t70.5 29.5h100v200q0 82 59 141t141 59h300q82 0 141 -59t59 -141v-200h100q41 0 70.5 -29.5t29.5 -70.5v-600q0 -41 -29.5 -70.5t-70.5 -29.5h-900q-41 0 -70.5 29.5t-29.5 70.5zM400 800h300v150q0 21 -14.5 35.5t-35.5 14.5h-200 q-21 0 -35.5 -14.5t-14.5 -35.5v-150z" />
+<glyph unicode="" d="M100 0v1100h100v-1100h-100zM300 400q60 60 127.5 84t127.5 17.5t122 -23t119 -30t110 -11t103 42t91 120.5v500q-40 -81 -101.5 -115.5t-127.5 -29.5t-138 25t-139.5 40t-125.5 25t-103 -29.5t-65 -115.5v-500z" />
+<glyph unicode="" d="M0 275q0 -11 7 -18t18 -7h50q11 0 18 7t7 18v300q0 127 70.5 231.5t184.5 161.5t245 57t245 -57t184.5 -161.5t70.5 -231.5v-300q0 -11 7 -18t18 -7h50q11 0 18 7t7 18v300q0 116 -49.5 227t-131 192.5t-192.5 131t-227 49.5t-227 -49.5t-192.5 -131t-131 -192.5 t-49.5 -227v-300zM200 20v460q0 8 6 14t14 6h160q8 0 14 -6t6 -14v-460q0 -8 -6 -14t-14 -6h-160q-8 0 -14 6t-6 14zM800 20v460q0 8 6 14t14 6h160q8 0 14 -6t6 -14v-460q0 -8 -6 -14t-14 -6h-160q-8 0 -14 6t-6 14z" />
+<glyph unicode="" d="M0 400h300l300 -200v800l-300 -200h-300v-400zM688 459l141 141l-141 141l71 71l141 -141l141 141l71 -71l-141 -141l141 -141l-71 -71l-141 141l-141 -141z" />
+<glyph unicode="" d="M0 400h300l300 -200v800l-300 -200h-300v-400zM700 857l69 53q111 -135 111 -310q0 -169 -106 -302l-67 54q86 110 86 248q0 146 -93 257z" />
+<glyph unicode="" d="M0 401v400h300l300 200v-800l-300 200h-300zM702 858l69 53q111 -135 111 -310q0 -170 -106 -303l-67 55q86 110 86 248q0 145 -93 257zM889 951l7 -8q123 -151 123 -344q0 -189 -119 -339l-7 -8l81 -66l6 8q142 178 142 405q0 230 -144 408l-6 8z" />
+<glyph unicode="" d="M0 0h500v500h-200v100h-100v-100h-200v-500zM0 600h100v100h400v100h100v100h-100v300h-500v-600zM100 100v300h300v-300h-300zM100 800v300h300v-300h-300zM200 200v100h100v-100h-100zM200 900h100v100h-100v-100zM500 500v100h300v-300h200v-100h-100v-100h-200v100 h-100v100h100v200h-200zM600 0v100h100v-100h-100zM600 1000h100v-300h200v-300h300v200h-200v100h200v500h-600v-200zM800 800v300h300v-300h-300zM900 0v100h300v-100h-300zM900 900v100h100v-100h-100zM1100 200v100h100v-100h-100z" />
+<glyph unicode="" d="M0 200h100v1000h-100v-1000zM100 0v100h300v-100h-300zM200 200v1000h100v-1000h-100zM500 0v91h100v-91h-100zM500 200v1000h200v-1000h-200zM700 0v91h100v-91h-100zM800 200v1000h100v-1000h-100zM900 0v91h200v-91h-200zM1000 200v1000h200v-1000h-200z" />
+<glyph unicode="" d="M0 700l1 475q0 10 7.5 17.5t17.5 7.5h474l700 -700l-500 -500zM148 953q0 -42 29 -71q30 -30 71.5 -30t71.5 30q29 29 29 71t-29 71q-30 30 -71.5 30t-71.5 -30q-29 -29 -29 -71z" />
+<glyph unicode="" d="M1 700l1 475q0 11 7 18t18 7h474l700 -700l-500 -500zM148 953q0 -42 30 -71q29 -30 71 -30t71 30q30 29 30 71t-30 71q-29 30 -71 30t-71 -30q-30 -29 -30 -71zM701 1200h100l700 -700l-500 -500l-50 50l450 450z" />
+<glyph unicode="" d="M100 0v1025l175 175h925v-1000l-100 -100v1000h-750l-100 -100h750v-1000h-900z" />
+<glyph unicode="" d="M200 0l450 444l450 -443v1150q0 20 -14.5 35t-35.5 15h-800q-21 0 -35.5 -15t-14.5 -35v-1151z" />
+<glyph unicode="" d="M0 100v700h200l100 -200h600l100 200h200v-700h-200v200h-800v-200h-200zM253 829l40 -124h592l62 124l-94 346q-2 11 -10 18t-18 7h-450q-10 0 -18 -7t-10 -18zM281 24l38 152q2 10 11.5 17t19.5 7h500q10 0 19.5 -7t11.5 -17l38 -152q2 -10 -3.5 -17t-15.5 -7h-600 q-10 0 -15.5 7t-3.5 17z" />
+<glyph unicode="" d="M0 200q0 -41 29.5 -70.5t70.5 -29.5h1000q41 0 70.5 29.5t29.5 70.5v600q0 41 -29.5 70.5t-70.5 29.5h-150q-4 8 -11.5 21.5t-33 48t-53 61t-69 48t-83.5 21.5h-200q-41 0 -82 -20.5t-70 -50t-52 -59t-34 -50.5l-12 -20h-150q-41 0 -70.5 -29.5t-29.5 -70.5v-600z M356 500q0 100 72 172t172 72t172 -72t72 -172t-72 -172t-172 -72t-172 72t-72 172zM494 500q0 -44 31 -75t75 -31t75 31t31 75t-31 75t-75 31t-75 -31t-31 -75zM900 700v100h100v-100h-100z" />
+<glyph unicode="" d="M53 0h365v66q-41 0 -72 11t-49 38t1 71l92 234h391l82 -222q16 -45 -5.5 -88.5t-74.5 -43.5v-66h417v66q-34 1 -74 43q-18 19 -33 42t-21 37l-6 13l-385 998h-93l-399 -1006q-24 -48 -52 -75q-12 -12 -33 -25t-36 -20l-15 -7v-66zM416 521l178 457l46 -140l116 -317h-340 z" />
+<glyph unicode="" d="M100 0v89q41 7 70.5 32.5t29.5 65.5v827q0 28 -1 39.5t-5.5 26t-15.5 21t-29 14t-49 14.5v71l471 -1q120 0 213 -88t93 -228q0 -55 -11.5 -101.5t-28 -74t-33.5 -47.5t-28 -28l-12 -7q8 -3 21.5 -9t48 -31.5t60.5 -58t47.5 -91.5t21.5 -129q0 -84 -59 -156.5t-142 -111 t-162 -38.5h-500zM400 200h161q89 0 153 48.5t64 132.5q0 90 -62.5 154.5t-156.5 64.5h-159v-400zM400 700h139q76 0 130 61.5t54 138.5q0 82 -84 130.5t-239 48.5v-379z" />
+<glyph unicode="" d="M200 0v57q77 7 134.5 40.5t65.5 80.5l173 849q10 56 -10 74t-91 37q-6 1 -10.5 2.5t-9.5 2.5v57h425l2 -57q-33 -8 -62 -25.5t-46 -37t-29.5 -38t-17.5 -30.5l-5 -12l-128 -825q-10 -52 14 -82t95 -36v-57h-500z" />
+<glyph unicode="" d="M-75 200h75v800h-75l125 167l125 -167h-75v-800h75l-125 -167zM300 900v300h150h700h150v-300h-50q0 29 -8 48.5t-18.5 30t-33.5 15t-39.5 5.5t-50.5 1h-200v-850l100 -50v-100h-400v100l100 50v850h-200q-34 0 -50.5 -1t-40 -5.5t-33.5 -15t-18.5 -30t-8.5 -48.5h-49z " />
+<glyph unicode="" d="M33 51l167 125v-75h800v75l167 -125l-167 -125v75h-800v-75zM100 901v300h150h700h150v-300h-50q0 29 -8 48.5t-18 30t-33.5 15t-40 5.5t-50.5 1h-200v-650l100 -50v-100h-400v100l100 50v650h-200q-34 0 -50.5 -1t-39.5 -5.5t-33.5 -15t-18.5 -30t-8 -48.5h-50z" />
+<glyph unicode="" d="M0 50q0 -20 14.5 -35t35.5 -15h1100q21 0 35.5 15t14.5 35v100q0 21 -14.5 35.5t-35.5 14.5h-1100q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM0 350q0 -20 14.5 -35t35.5 -15h800q21 0 35.5 15t14.5 35v100q0 21 -14.5 35.5t-35.5 14.5h-800q-21 0 -35.5 -14.5t-14.5 -35.5 v-100zM0 650q0 -20 14.5 -35t35.5 -15h1000q21 0 35.5 15t14.5 35v100q0 21 -14.5 35.5t-35.5 14.5h-1000q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM0 950q0 -20 14.5 -35t35.5 -15h600q21 0 35.5 15t14.5 35v100q0 21 -14.5 35.5t-35.5 14.5h-600q-21 0 -35.5 -14.5 t-14.5 -35.5v-100z" />
+<glyph unicode="" d="M0 50q0 -20 14.5 -35t35.5 -15h1100q21 0 35.5 15t14.5 35v100q0 21 -14.5 35.5t-35.5 14.5h-1100q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM0 650q0 -20 14.5 -35t35.5 -15h1100q21 0 35.5 15t14.5 35v100q0 21 -14.5 35.5t-35.5 14.5h-1100q-21 0 -35.5 -14.5t-14.5 -35.5 v-100zM200 350q0 -20 14.5 -35t35.5 -15h700q21 0 35.5 15t14.5 35v100q0 21 -14.5 35.5t-35.5 14.5h-700q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM200 950q0 -20 14.5 -35t35.5 -15h700q21 0 35.5 15t14.5 35v100q0 21 -14.5 35.5t-35.5 14.5h-700q-21 0 -35.5 -14.5 t-14.5 -35.5v-100z" />
+<glyph unicode="" d="M0 50v100q0 21 14.5 35.5t35.5 14.5h1100q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-1100q-21 0 -35.5 15t-14.5 35zM100 650v100q0 21 14.5 35.5t35.5 14.5h1000q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-1000q-21 0 -35.5 15 t-14.5 35zM300 350v100q0 21 14.5 35.5t35.5 14.5h800q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-800q-21 0 -35.5 15t-14.5 35zM500 950v100q0 21 14.5 35.5t35.5 14.5h600q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-600 q-21 0 -35.5 15t-14.5 35z" />
+<glyph unicode="" d="M0 50v100q0 21 14.5 35.5t35.5 14.5h1100q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-1100q-21 0 -35.5 15t-14.5 35zM0 350v100q0 21 14.5 35.5t35.5 14.5h1100q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-1100q-21 0 -35.5 15 t-14.5 35zM0 650v100q0 21 14.5 35.5t35.5 14.5h1100q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-1100q-21 0 -35.5 15t-14.5 35zM0 950v100q0 21 14.5 35.5t35.5 14.5h1100q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-1100 q-21 0 -35.5 15t-14.5 35z" />
+<glyph unicode="" d="M0 50v100q0 21 14.5 35.5t35.5 14.5h100q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-100q-21 0 -35.5 15t-14.5 35zM0 350v100q0 21 14.5 35.5t35.5 14.5h100q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-100q-21 0 -35.5 15 t-14.5 35zM0 650v100q0 21 14.5 35.5t35.5 14.5h100q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-100q-21 0 -35.5 15t-14.5 35zM0 950v100q0 21 14.5 35.5t35.5 14.5h100q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-100q-21 0 -35.5 15 t-14.5 35zM300 50v100q0 21 14.5 35.5t35.5 14.5h800q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-800q-21 0 -35.5 15t-14.5 35zM300 350v100q0 21 14.5 35.5t35.5 14.5h800q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-800 q-21 0 -35.5 15t-14.5 35zM300 650v100q0 21 14.5 35.5t35.5 14.5h800q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15h-800q-21 0 -35.5 15t-14.5 35zM300 950v100q0 21 14.5 35.5t35.5 14.5h800q21 0 35.5 -14.5t14.5 -35.5v-100q0 -20 -14.5 -35t-35.5 -15 h-800q-21 0 -35.5 15t-14.5 35z" />
+<glyph unicode="" d="M-101 500v100h201v75l166 -125l-166 -125v75h-201zM300 0h100v1100h-100v-1100zM500 50q0 -20 14.5 -35t35.5 -15h600q20 0 35 15t15 35v100q0 21 -15 35.5t-35 14.5h-600q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM500 350q0 -20 14.5 -35t35.5 -15h300q20 0 35 15t15 35 v100q0 21 -15 35.5t-35 14.5h-300q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM500 650q0 -20 14.5 -35t35.5 -15h500q20 0 35 15t15 35v100q0 21 -15 35.5t-35 14.5h-500q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM500 950q0 -20 14.5 -35t35.5 -15h100q20 0 35 15t15 35v100 q0 21 -15 35.5t-35 14.5h-100q-21 0 -35.5 -14.5t-14.5 -35.5v-100z" />
+<glyph unicode="" d="M1 50q0 -20 14.5 -35t35.5 -15h600q20 0 35 15t15 35v100q0 21 -15 35.5t-35 14.5h-600q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM1 350q0 -20 14.5 -35t35.5 -15h300q20 0 35 15t15 35v100q0 21 -15 35.5t-35 14.5h-300q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM1 650 q0 -20 14.5 -35t35.5 -15h500q20 0 35 15t15 35v100q0 21 -15 35.5t-35 14.5h-500q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM1 950q0 -20 14.5 -35t35.5 -15h100q20 0 35 15t15 35v100q0 21 -15 35.5t-35 14.5h-100q-21 0 -35.5 -14.5t-14.5 -35.5v-100zM801 0v1100h100v-1100 h-100zM934 550l167 -125v75h200v100h-200v75z" />
+<glyph unicode="" d="M0 275v650q0 31 22 53t53 22h750q31 0 53 -22t22 -53v-650q0 -31 -22 -53t-53 -22h-750q-31 0 -53 22t-22 53zM900 600l300 300v-600z" />
+<glyph unicode="" d="M0 44v1012q0 18 13 31t31 13h1112q19 0 31.5 -13t12.5 -31v-1012q0 -18 -12.5 -31t-31.5 -13h-1112q-18 0 -31 13t-13 31zM100 263l247 182l298 -131l-74 156l293 318l236 -288v500h-1000v-737zM208 750q0 56 39 95t95 39t95 -39t39 -95t-39 -95t-95 -39t-95 39t-39 95z " />
+<glyph unicode="" d="M148 745q0 124 60.5 231.5t165 172t226.5 64.5q123 0 227 -63t164.5 -169.5t60.5 -229.5t-73 -272q-73 -114 -166.5 -237t-150.5 -189l-57 -66q-10 9 -27 26t-66.5 70.5t-96 109t-104 135.5t-100.5 155q-63 139 -63 262zM342 772q0 -107 75.5 -182.5t181.5 -75.5 q107 0 182.5 75.5t75.5 182.5t-75.5 182t-182.5 75t-182 -75.5t-75 -181.5z" />
+<glyph unicode="" d="M1 600q0 122 47.5 233t127.5 191t191 127.5t233 47.5t233 -47.5t191 -127.5t127.5 -191t47.5 -233t-47.5 -233t-127.5 -191t-191 -127.5t-233 -47.5t-233 47.5t-191 127.5t-127.5 191t-47.5 233zM173 600q0 -177 125.5 -302t301.5 -125v854q-176 0 -301.5 -125 t-125.5 -302z" />
+<glyph unicode="" d="M117 406q0 94 34 186t88.5 172.5t112 159t115 177t87.5 194.5q21 -71 57.5 -142.5t76 -130.5t83 -118.5t82 -117t70 -116t50 -125.5t18.5 -136q0 -89 -39 -165.5t-102 -126.5t-140 -79.5t-156 -33.5q-114 6 -211.5 53t-161.5 139t-64 210zM243 414q14 -82 59.5 -136 t136.5 -80l16 98q-7 6 -18 17t-34 48t-33 77q-15 73 -14 143.5t10 122.5l9 51q-92 -110 -119.5 -185t-12.5 -156z" />
+<glyph unicode="" d="M0 400v300q0 165 117.5 282.5t282.5 117.5q366 -6 397 -14l-186 -186h-311q-41 0 -70.5 -29.5t-29.5 -70.5v-500q0 -41 29.5 -70.5t70.5 -29.5h500q41 0 70.5 29.5t29.5 70.5v125l200 200v-225q0 -165 -117.5 -282.5t-282.5 -117.5h-300q-165 0 -282.5 117.5 t-117.5 282.5zM436 341l161 50l412 412l-114 113l-405 -405zM995 1015l113 -113l113 113l-21 85l-92 28z" />
+<glyph unicode="" d="M0 400v300q0 165 117.5 282.5t282.5 117.5h261l2 -80q-133 -32 -218 -120h-145q-41 0 -70.5 -29.5t-29.5 -70.5v-500q0 -41 29.5 -70.5t70.5 -29.5h500q41 0 70.5 29.5t29.5 70.5l200 153v-53q0 -165 -117.5 -282.5t-282.5 -117.5h-300q-165 0 -282.5 117.5t-117.5 282.5 zM423 524q30 38 81.5 64t103 35.5t99 14t77.5 3.5l29 -1v-209l360 324l-359 318v-216q-7 0 -19 -1t-48 -8t-69.5 -18.5t-76.5 -37t-76.5 -59t-62 -88t-39.5 -121.5z" />
+<glyph unicode="" d="M0 400v300q0 165 117.5 282.5t282.5 117.5h300q61 0 127 -23l-178 -177h-349q-41 0 -70.5 -29.5t-29.5 -70.5v-500q0 -41 29.5 -70.5t70.5 -29.5h500q41 0 70.5 29.5t29.5 70.5v69l200 200v-169q0 -165 -117.5 -282.5t-282.5 -117.5h-300q-165 0 -282.5 117.5 t-117.5 282.5zM342 632l283 -284l567 567l-137 137l-430 -431l-146 147z" />
+<glyph unicode="" d="M0 603l300 296v-198h200v200h-200l300 300l295 -300h-195v-200h200v198l300 -296l-300 -300v198h-200v-200h195l-295 -300l-300 300h200v200h-200v-198z" />
+<glyph unicode="" d="M200 50v1000q0 21 14.5 35.5t35.5 14.5h100q21 0 35.5 -14.5t14.5 -35.5v-437l500 487v-1100l-500 488v-438q0 -21 -14.5 -35.5t-35.5 -14.5h-100q-21 0 -35.5 14.5t-14.5 35.5z" />
+<glyph unicode="" d="M0 50v1000q0 21 14.5 35.5t35.5 14.5h100q21 0 35.5 -14.5t14.5 -35.5v-437l500 487v-487l500 487v-1100l-500 488v-488l-500 488v-438q0 -21 -14.5 -35.5t-35.5 -14.5h-100q-21 0 -35.5 14.5t-14.5 35.5z" />
+<glyph unicode="" d="M136 550l564 550v-487l500 487v-1100l-500 488v-488z" />
+<glyph unicode="" d="M200 0l900 550l-900 550v-1100z" />
+<glyph unicode="" d="M200 150q0 -21 14.5 -35.5t35.5 -14.5h200q21 0 35.5 14.5t14.5 35.5v800q0 21 -14.5 35.5t-35.5 14.5h-200q-21 0 -35.5 -14.5t-14.5 -35.5v-800zM600 150q0 -21 14.5 -35.5t35.5 -14.5h200q21 0 35.5 14.5t14.5 35.5v800q0 21 -14.5 35.5t-35.5 14.5h-200 q-21 0 -35.5 -14.5t-14.5 -35.5v-800z" />
+<glyph unicode="" d="M200 150q0 -20 14.5 -35t35.5 -15h800q21 0 35.5 15t14.5 35v800q0 21 -14.5 35.5t-35.5 14.5h-800q-21 0 -35.5 -14.5t-14.5 -35.5v-800z" />
+<glyph unicode="" d="M0 0v1100l500 -487v487l564 -550l-564 -550v488z" />
+<glyph unicode="" d="M0 0v1100l500 -487v487l500 -487v437q0 21 14.5 35.5t35.5 14.5h100q21 0 35.5 -14.5t14.5 -35.5v-1000q0 -21 -14.5 -35.5t-35.5 -14.5h-100q-21 0 -35.5 14.5t-14.5 35.5v438l-500 -488v488z" />
+<glyph unicode="" d="M300 0v1100l500 -487v437q0 21 14.5 35.5t35.5 14.5h100q21 0 35.5 -14.5t14.5 -35.5v-1000q0 -21 -14.5 -35.5t-35.5 -14.5h-100q-21 0 -35.5 14.5t-14.5 35.5v438z" />
+<glyph unicode="" d="M100 250v100q0 21 14.5 35.5t35.5 14.5h1000q21 0 35.5 -14.5t14.5 -35.5v-100q0 -21 -14.5 -35.5t-35.5 -14.5h-1000q-21 0 -35.5 14.5t-14.5 35.5zM100 500h1100l-550 564z" />
+<glyph unicode="" d="M185 599l592 -592l240 240l-353 353l353 353l-240 240z" />
+<glyph unicode="" d="M272 194l353 353l-353 353l241 240l572 -571l21 -22l-1 -1v-1l-592 -591z" />
+<glyph unicode="" d="M3 600q0 162 80 299.5t217.5 217.5t299.5 80t299.5 -80t217.5 -217.5t80 -299.5t-80 -299.5t-217.5 -217.5t-299.5 -80t-299.5 80t-217.5 217.5t-80 299.5zM300 500h200v-200h200v200h200v200h-200v200h-200v-200h-200v-200z" />
+<glyph unicode="" d="M3 600q0 162 80 299.5t217.5 217.5t299.5 80t299.5 -80t217.5 -217.5t80 -299.5t-80 -299.5t-217.5 -217.5t-299.5 -80t-299.5 80t-217.5 217.5t-80 299.5zM300 500h600v200h-600v-200z" />
+<glyph unicode="" d="M3 600q0 162 80 299.5t217.5 217.5t299.5 80t299.5 -80t217.5 -217.5t80 -299.5t-80 -299.5t-217.5 -217.5t-299.5 -80t-299.5 80t-217.5 217.5t-80 299.5zM246 459l213 -213l141 142l141 -142l213 213l-142 141l142 141l-213 212l-141 -141l-141 142l-212 -213l141 -141 z" />
+<glyph unicode="" d="M3 600q0 162 80 299.5t217.5 217.5t299.5 80t299.5 -80t217.5 -217.5t80 -299.5t-80 -299.5t-217.5 -217.5t-299.5 -80t-299.5 80t-217.5 217.5t-80 299.5zM270 551l276 -277l411 411l-175 174l-236 -236l-102 102z" />
+<glyph unicode="" d="M3 600q0 162 80 299.5t217.5 217.5t299.5 80t299.5 -80t217.5 -217.5t80 -299.5t-80 -299.5t-217.5 -217.5t-299.5 -80t-299.5 80t-217.5 217.5t-80 299.5zM364 700h143q4 0 11.5 -1t11 -1t6.5 3t3 9t1 11t3.5 8.5t3.5 6t5.5 4t6.5 2.5t9 1.5t9 0.5h11.5h12.5 q19 0 30 -10t11 -26q0 -22 -4 -28t-27 -22q-5 -1 -12.5 -3t-27 -13.5t-34 -27t-26.5 -46t-11 -68.5h200q5 3 14 8t31.5 25.5t39.5 45.5t31 69t14 94q0 51 -17.5 89t-42 58t-58.5 32t-58.5 15t-51.5 3q-50 0 -90.5 -12t-75 -38.5t-53.5 -74.5t-19 -114zM500 300h200v100h-200 v-100z" />
+<glyph unicode="" d="M3 600q0 162 80 299.5t217.5 217.5t299.5 80t299.5 -80t217.5 -217.5t80 -299.5t-80 -299.5t-217.5 -217.5t-299.5 -80t-299.5 80t-217.5 217.5t-80 299.5zM400 300h400v100h-100v300h-300v-100h100v-200h-100v-100zM500 800h200v100h-200v-100z" />
+<glyph unicode="" d="M0 500v200h195q31 125 98.5 199.5t206.5 100.5v200h200v-200q54 -20 113 -60t112.5 -105.5t71.5 -134.5h203v-200h-203q-25 -102 -116.5 -186t-180.5 -117v-197h-200v197q-140 27 -208 102.5t-98 200.5h-194zM290 500q24 -73 79.5 -127.5t130.5 -78.5v206h200v-206 q149 48 201 206h-201v200h200q-25 74 -75.5 127t-124.5 77v-204h-200v203q-75 -23 -130 -77t-79 -126h209v-200h-210z" />
+<glyph unicode="" d="M4 600q0 162 80 299t217 217t299 80t299 -80t217 -217t80 -299t-80 -299t-217 -217t-299 -80t-299 80t-217 217t-80 299zM186 600q0 -171 121.5 -292.5t292.5 -121.5t292.5 121.5t121.5 292.5t-121.5 292.5t-292.5 121.5t-292.5 -121.5t-121.5 -292.5zM356 465l135 135 l-135 135l109 109l135 -135l135 135l109 -109l-135 -135l135 -135l-109 -109l-135 135l-135 -135z" />
+<glyph unicode="" d="M4 600q0 162 80 299t217 217t299 80t299 -80t217 -217t80 -299t-80 -299t-217 -217t-299 -80t-299 80t-217 217t-80 299zM186 600q0 -171 121.5 -292.5t292.5 -121.5t292.5 121.5t121.5 292.5t-121.5 292.5t-292.5 121.5t-292.5 -121.5t-121.5 -292.5zM322 537l141 141 l87 -87l204 205l142 -142l-346 -345z" />
+<glyph unicode="" d="M4 600q0 162 80 299t217 217t299 80t299 -80t217 -217t80 -299t-80 -299t-217 -217t-299 -80t-299 80t-217 217t-80 299zM186 600q0 -115 62 -215l568 567q-100 62 -216 62q-171 0 -292.5 -121.5t-121.5 -292.5zM391 245q97 -59 209 -59q171 0 292.5 121.5t121.5 292.5 q0 112 -59 209z" />
+<glyph unicode="" d="M0 547l600 453v-300h600v-300h-600v-301z" />
+<glyph unicode="" d="M0 400v300h600v300l600 -453l-600 -448v301h-600z" />
+<glyph unicode="" d="M204 600l450 600l444 -600h-298v-600h-300v600h-296z" />
+<glyph unicode="" d="M104 600h296v600h300v-600h298l-449 -600z" />
+<glyph unicode="" d="M0 200q6 132 41 238.5t103.5 193t184 138t271.5 59.5v271l600 -453l-600 -448v301q-95 -2 -183 -20t-170 -52t-147 -92.5t-100 -135.5z" />
+<glyph unicode="" d="M0 0v400l129 -129l294 294l142 -142l-294 -294l129 -129h-400zM635 777l142 -142l294 294l129 -129v400h-400l129 -129z" />
+<glyph unicode="" d="M34 176l295 295l-129 129h400v-400l-129 130l-295 -295zM600 600v400l129 -129l295 295l142 -141l-295 -295l129 -130h-400z" />
+<glyph unicode="" d="M23 600q0 118 45.5 224.5t123 184t184 123t224.5 45.5t224.5 -45.5t184 -123t123 -184t45.5 -224.5t-45.5 -224.5t-123 -184t-184 -123t-224.5 -45.5t-224.5 45.5t-184 123t-123 184t-45.5 224.5zM456 851l58 -302q4 -20 21.5 -34.5t37.5 -14.5h54q20 0 37.5 14.5 t21.5 34.5l58 302q4 20 -8 34.5t-32 14.5h-207q-21 0 -33 -14.5t-8 -34.5zM500 300h200v100h-200v-100z" />
+<glyph unicode="" d="M0 800h100v-200h400v300h200v-300h400v200h100v100h-111q1 1 1 6.5t-1.5 15t-3.5 17.5l-34 172q-11 39 -41.5 63t-69.5 24q-32 0 -61 -17l-239 -144q-22 -13 -40 -35q-19 24 -40 36l-238 144q-33 18 -62 18q-39 0 -69.5 -23t-40.5 -61l-35 -177q-2 -8 -3 -18t-1 -15v-6 h-111v-100zM100 0h400v400h-400v-400zM200 900q-3 0 14 48t36 96l18 47l213 -191h-281zM700 0v400h400v-400h-400zM731 900l202 197q5 -12 12 -32.5t23 -64t25 -72t7 -28.5h-269z" />
+<glyph unicode="" d="M0 -22v143l216 193q-9 53 -13 83t-5.5 94t9 113t38.5 114t74 124q47 60 99.5 102.5t103 68t127.5 48t145.5 37.5t184.5 43.5t220 58.5q0 -189 -22 -343t-59 -258t-89 -181.5t-108.5 -120t-122 -68t-125.5 -30t-121.5 -1.5t-107.5 12.5t-87.5 17t-56.5 7.5l-99 -55z M238.5 300.5q19.5 -6.5 86.5 76.5q55 66 367 234q70 38 118.5 69.5t102 79t99 111.5t86.5 148q22 50 24 60t-6 19q-7 5 -17 5t-26.5 -14.5t-33.5 -39.5q-35 -51 -113.5 -108.5t-139.5 -89.5l-61 -32q-369 -197 -458 -401q-48 -111 -28.5 -117.5z" />
+<glyph unicode="" d="M111 408q0 -33 5 -63q9 -56 44 -119.5t105 -108.5q31 -21 64 -16t62 23.5t57 49.5t48 61.5t35 60.5q32 66 39 184.5t-13 157.5q79 -80 122 -164t26 -184q-5 -33 -20.5 -69.5t-37.5 -80.5q-10 -19 -14.5 -29t-12 -26t-9 -23.5t-3 -19t2.5 -15.5t11 -9.5t19.5 -5t30.5 2.5 t42 8q57 20 91 34t87.5 44.5t87 64t65.5 88.5t47 122q38 172 -44.5 341.5t-246.5 278.5q22 -44 43 -129q39 -159 -32 -154q-15 2 -33 9q-79 33 -120.5 100t-44 175.5t48.5 257.5q-13 -8 -34 -23.5t-72.5 -66.5t-88.5 -105.5t-60 -138t-8 -166.5q2 -12 8 -41.5t8 -43t6 -39.5 t3.5 -39.5t-1 -33.5t-6 -31.5t-13.5 -24t-21 -20.5t-31 -12q-38 -10 -67 13t-40.5 61.5t-15 81.5t10.5 75q-52 -46 -83.5 -101t-39 -107t-7.5 -85z" />
+<glyph unicode="" d="M-61 600l26 40q6 10 20 30t49 63.5t74.5 85.5t97 90t116.5 83.5t132.5 59t145.5 23.5t145.5 -23.5t132.5 -59t116.5 -83.5t97 -90t74.5 -85.5t49 -63.5t20 -30l26 -40l-26 -40q-6 -10 -20 -30t-49 -63.5t-74.5 -85.5t-97 -90t-116.5 -83.5t-132.5 -59t-145.5 -23.5 t-145.5 23.5t-132.5 59t-116.5 83.5t-97 90t-74.5 85.5t-49 63.5t-20 30zM120 600q7 -10 40.5 -58t56 -78.5t68 -77.5t87.5 -75t103 -49.5t125 -21.5t123.5 20t100.5 45.5t85.5 71.5t66.5 75.5t58 81.5t47 66q-1 1 -28.5 37.5t-42 55t-43.5 53t-57.5 63.5t-58.5 54 q49 -74 49 -163q0 -124 -88 -212t-212 -88t-212 88t-88 212q0 85 46 158q-102 -87 -226 -258zM377 656q49 -124 154 -191l105 105q-37 24 -75 72t-57 84l-20 36z" />
+<glyph unicode="" d="M-61 600l26 40q6 10 20 30t49 63.5t74.5 85.5t97 90t116.5 83.5t132.5 59t145.5 23.5q61 0 121 -17l37 142h148l-314 -1200h-148l37 143q-82 21 -165 71.5t-140 102t-109.5 112t-72 88.5t-29.5 43zM120 600q210 -282 393 -336l37 141q-107 18 -178.5 101.5t-71.5 193.5 q0 85 46 158q-102 -87 -226 -258zM377 656q49 -124 154 -191l47 47l23 87q-30 28 -59 69t-44 68l-14 26zM780 161l38 145q22 15 44.5 34t46 44t40.5 44t41 50.5t33.5 43.5t33 44t24.5 34q-97 127 -140 175l39 146q67 -54 131.5 -125.5t87.5 -103.5t36 -52l26 -40l-26 -40 q-7 -12 -25.5 -38t-63.5 -79.5t-95.5 -102.5t-124 -100t-146.5 -79z" />
+<glyph unicode="" d="M-97.5 34q13.5 -34 50.5 -34h1294q37 0 50.5 35.5t-7.5 67.5l-642 1056q-20 34 -48 36.5t-48 -29.5l-642 -1066q-21 -32 -7.5 -66zM155 200l445 723l445 -723h-345v100h-200v-100h-345zM500 600l100 -300l100 300v100h-200v-100z" />
+<glyph unicode="" d="M100 262v41q0 20 11 44.5t26 38.5l363 325v339q0 62 44 106t106 44t106 -44t44 -106v-339l363 -325q15 -14 26 -38.5t11 -44.5v-41q0 -20 -12 -26.5t-29 5.5l-359 249v-263q100 -91 100 -113v-64q0 -20 -13 -28.5t-32 0.5l-94 78h-222l-94 -78q-19 -9 -32 -0.5t-13 28.5 v64q0 22 100 113v263l-359 -249q-17 -12 -29 -5.5t-12 26.5z" />
+<glyph unicode="" d="M0 50q0 -20 14.5 -35t35.5 -15h1000q21 0 35.5 15t14.5 35v750h-1100v-750zM0 900h1100v150q0 21 -14.5 35.5t-35.5 14.5h-150v100h-100v-100h-500v100h-100v-100h-150q-21 0 -35.5 -14.5t-14.5 -35.5v-150zM100 100v100h100v-100h-100zM100 300v100h100v-100h-100z M100 500v100h100v-100h-100zM300 100v100h100v-100h-100zM300 300v100h100v-100h-100zM300 500v100h100v-100h-100zM500 100v100h100v-100h-100zM500 300v100h100v-100h-100zM500 500v100h100v-100h-100zM700 100v100h100v-100h-100zM700 300v100h100v-100h-100zM700 500 v100h100v-100h-100zM900 100v100h100v-100h-100zM900 300v100h100v-100h-100zM900 500v100h100v-100h-100z" />
+<glyph unicode="" d="M0 200v200h259l600 600h241v198l300 -295l-300 -300v197h-159l-600 -600h-341zM0 800h259l122 -122l141 142l-181 180h-341v-200zM678 381l141 142l122 -123h159v198l300 -295l-300 -300v197h-241z" />
+<glyph unicode="" d="M0 400v600q0 41 29.5 70.5t70.5 29.5h1000q41 0 70.5 -29.5t29.5 -70.5v-600q0 -41 -29.5 -70.5t-70.5 -29.5h-596l-304 -300v300h-100q-41 0 -70.5 29.5t-29.5 70.5z" />
+<glyph unicode="" d="M100 600v200h300v-250q0 -113 6 -145q17 -92 102 -117q39 -11 92 -11q37 0 66.5 5.5t50 15.5t36 24t24 31.5t14 37.5t7 42t2.5 45t0 47v25v250h300v-200q0 -42 -3 -83t-15 -104t-31.5 -116t-58 -109.5t-89 -96.5t-129 -65.5t-174.5 -25.5t-174.5 25.5t-129 65.5t-89 96.5 t-58 109.5t-31.5 116t-15 104t-3 83zM100 900v300h300v-300h-300zM800 900v300h300v-300h-300z" />
+<glyph unicode="" d="M-30 411l227 -227l352 353l353 -353l226 227l-578 579z" />
+<glyph unicode="" d="M70 797l580 -579l578 579l-226 227l-353 -353l-352 353z" />
+<glyph unicode="" d="M-198 700l299 283l300 -283h-203v-400h385l215 -200h-800v600h-196zM402 1000l215 -200h381v-400h-198l299 -283l299 283h-200v600h-796z" />
+<glyph unicode="" d="M18 939q-5 24 10 42q14 19 39 19h896l38 162q5 17 18.5 27.5t30.5 10.5h94q20 0 35 -14.5t15 -35.5t-15 -35.5t-35 -14.5h-54l-201 -961q-2 -4 -6 -10.5t-19 -17.5t-33 -11h-31v-50q0 -20 -14.5 -35t-35.5 -15t-35.5 15t-14.5 35v50h-300v-50q0 -20 -14.5 -35t-35.5 -15 t-35.5 15t-14.5 35v50h-50q-21 0 -35.5 15t-14.5 35q0 21 14.5 35.5t35.5 14.5h535l48 200h-633q-32 0 -54.5 21t-27.5 43z" />
+<glyph unicode="" d="M0 0v800h1200v-800h-1200zM0 900v100h200q0 41 29.5 70.5t70.5 29.5h300q41 0 70.5 -29.5t29.5 -70.5h500v-100h-1200z" />
+<glyph unicode="" d="M1 0l300 700h1200l-300 -700h-1200zM1 400v600h200q0 41 29.5 70.5t70.5 29.5h300q41 0 70.5 -29.5t29.5 -70.5h500v-200h-1000z" />
+<glyph unicode="" d="M302 300h198v600h-198l298 300l298 -300h-198v-600h198l-298 -300z" />
+<glyph unicode="" d="M0 600l300 298v-198h600v198l300 -298l-300 -297v197h-600v-197z" />
+<glyph unicode="" d="M0 100v100q0 41 29.5 70.5t70.5 29.5h1000q41 0 70.5 -29.5t29.5 -70.5v-100q0 -41 -29.5 -70.5t-70.5 -29.5h-1000q-41 0 -70.5 29.5t-29.5 70.5zM31 400l172 739q5 22 23 41.5t38 19.5h672q19 0 37.5 -22.5t23.5 -45.5l172 -732h-1138zM800 100h100v100h-100v-100z M1000 100h100v100h-100v-100z" />
+<glyph unicode="" d="M-101 600v50q0 24 25 49t50 38l25 13v-250l-11 5.5t-24 14t-30 21.5t-24 27.5t-11 31.5zM100 500v250v8v8v7t0.5 7t1.5 5.5t2 5t3 4t4.5 3.5t6 1.5t7.5 0.5h200l675 250v-850l-675 200h-38l47 -276q2 -12 -3 -17.5t-11 -6t-21 -0.5h-8h-83q-20 0 -34.5 14t-18.5 35 q-55 337 -55 351zM1100 200v850q0 21 14.5 35.5t35.5 14.5q20 0 35 -14.5t15 -35.5v-850q0 -20 -15 -35t-35 -15q-21 0 -35.5 15t-14.5 35z" />
+<glyph unicode="" d="M74 350q0 21 13.5 35.5t33.5 14.5h18l117 173l63 327q15 77 76 140t144 83l-18 32q-6 19 3 32t29 13h94q20 0 29 -10.5t3 -29.5q-18 -36 -18 -37q83 -19 144 -82.5t76 -140.5l63 -327l118 -173h17q20 0 33.5 -14.5t13.5 -35.5q0 -20 -13 -40t-31 -27q-8 -3 -23 -8.5 t-65 -20t-103 -25t-132.5 -19.5t-158.5 -9q-125 0 -245.5 20.5t-178.5 40.5l-58 20q-18 7 -31 27.5t-13 40.5zM497 110q12 -49 40 -79.5t63 -30.5t63 30.5t39 79.5q-48 -6 -102 -6t-103 6z" />
+<glyph unicode="" d="M21 445l233 -45l-78 -224l224 78l45 -233l155 179l155 -179l45 233l224 -78l-78 224l234 45l-180 155l180 156l-234 44l78 225l-224 -78l-45 233l-155 -180l-155 180l-45 -233l-224 78l78 -225l-233 -44l179 -156z" />
+<glyph unicode="" d="M0 200h200v600h-200v-600zM300 275q0 -75 100 -75h61q124 -100 139 -100h250q46 0 83 57l238 344q29 31 29 74v100q0 44 -30.5 84.5t-69.5 40.5h-328q28 118 28 125v150q0 44 -30.5 84.5t-69.5 40.5h-50q-27 0 -51 -20t-38 -48l-96 -198l-145 -196q-20 -26 -20 -63v-400z M400 300v375l150 213l100 212h50v-175l-50 -225h450v-125l-250 -375h-214l-136 100h-100z" />
+<glyph unicode="" d="M0 400v600h200v-600h-200zM300 525v400q0 75 100 75h61q124 100 139 100h250q46 0 83 -57l238 -344q29 -31 29 -74v-100q0 -44 -30.5 -84.5t-69.5 -40.5h-328q28 -118 28 -125v-150q0 -44 -30.5 -84.5t-69.5 -40.5h-50q-27 0 -51 20t-38 48l-96 198l-145 196 q-20 26 -20 63zM400 525l150 -212l100 -213h50v175l-50 225h450v125l-250 375h-214l-136 -100h-100v-375z" />
+<glyph unicode="" d="M8 200v600h200v-600h-200zM308 275v525q0 17 14 35.5t28 28.5l14 9l362 230q14 6 25 6q17 0 29 -12l109 -112q14 -14 14 -34q0 -18 -11 -32l-85 -121h302q85 0 138.5 -38t53.5 -110t-54.5 -111t-138.5 -39h-107l-130 -339q-7 -22 -20.5 -41.5t-28.5 -19.5h-341 q-7 0 -90 81t-83 94zM408 289l100 -89h293l131 339q6 21 19.5 41t28.5 20h203q16 0 25 15t9 36q0 20 -9 34.5t-25 14.5h-457h-6.5h-7.5t-6.5 0.5t-6 1t-5 1.5t-5.5 2.5t-4 4t-4 5.5q-5 12 -5 20q0 14 10 27l147 183l-86 83l-339 -236v-503z" />
+<glyph unicode="" d="M-101 651q0 72 54 110t139 38l302 -1l-85 121q-11 16 -11 32q0 21 14 34l109 113q13 12 29 12q11 0 25 -6l365 -230q7 -4 17 -10.5t26.5 -26t16.5 -36.5v-526q0 -13 -86 -93.5t-94 -80.5h-341q-16 0 -29.5 20t-19.5 41l-130 339h-107q-84 0 -139 39t-55 111zM-1 601h222 q15 0 28.5 -20.5t19.5 -40.5l131 -339h293l107 89v502l-343 237l-87 -83l145 -184q10 -11 10 -26q0 -11 -5 -20q-1 -3 -3.5 -5.5l-4 -4t-5 -2.5t-5.5 -1.5t-6.5 -1t-6.5 -0.5h-7.5h-6.5h-476v-100zM1000 201v600h200v-600h-200z" />
+<glyph unicode="" d="M97 719l230 -363q4 -6 10.5 -15.5t26 -25t36.5 -15.5h525q13 0 94 83t81 90v342q0 15 -20 28.5t-41 19.5l-339 131v106q0 84 -39 139t-111 55t-110 -53.5t-38 -138.5v-302l-121 84q-15 12 -33.5 11.5t-32.5 -13.5l-112 -110q-22 -22 -6 -53zM172 739l83 86l183 -146 q22 -18 47 -5q3 1 5.5 3.5l4 4t2.5 5t1.5 5.5t1 6.5t0.5 6.5v7.5v6.5v456q0 22 25 31t50 -0.5t25 -30.5v-202q0 -16 20 -29.5t41 -19.5l339 -130v-294l-89 -100h-503zM400 0v200h600v-200h-600z" />
+<glyph unicode="" d="M2 585q-16 -31 6 -53l112 -110q13 -13 32 -13.5t34 10.5l121 85q0 -51 -0.5 -153.5t-0.5 -148.5q0 -84 38.5 -138t110.5 -54t111 55t39 139v106l339 131q20 6 40.5 19.5t20.5 28.5v342q0 7 -81 90t-94 83h-525q-17 0 -35.5 -14t-28.5 -28l-10 -15zM77 565l236 339h503 l89 -100v-294l-340 -130q-20 -6 -40 -20t-20 -29v-202q0 -22 -25 -31t-50 0t-25 31v456v14.5t-1.5 11.5t-5 12t-9.5 7q-24 13 -46 -5l-184 -146zM305 1104v200h600v-200h-600z" />
+<glyph unicode="" d="M5 597q0 122 47.5 232.5t127.5 190.5t190.5 127.5t232.5 47.5q162 0 299.5 -80t217.5 -218t80 -300t-80 -299.5t-217.5 -217.5t-299.5 -80t-300 80t-218 217.5t-80 299.5zM298 701l2 -201h300l-2 -194l402 294l-402 298v-197h-300z" />
+<glyph unicode="" d="M0 597q0 122 47.5 232.5t127.5 190.5t190.5 127.5t231.5 47.5q122 0 232.5 -47.5t190.5 -127.5t127.5 -190.5t47.5 -232.5q0 -162 -80 -299.5t-218 -217.5t-300 -80t-299.5 80t-217.5 217.5t-80 299.5zM200 600l402 -294l-2 194h300l2 201h-300v197z" />
+<glyph unicode="" d="M5 597q0 122 47.5 232.5t127.5 190.5t190.5 127.5t232.5 47.5q162 0 299.5 -80t217.5 -218t80 -300t-80 -299.5t-217.5 -217.5t-299.5 -80t-300 80t-218 217.5t-80 299.5zM300 600h200v-300h200v300h200l-300 400z" />
+<glyph unicode="" d="M5 597q0 122 47.5 232.5t127.5 190.5t190.5 127.5t232.5 47.5q162 0 299.5 -80t217.5 -218t80 -300t-80 -299.5t-217.5 -217.5t-299.5 -80t-300 80t-218 217.5t-80 299.5zM300 600l300 -400l300 400h-200v300h-200v-300h-200z" />
+<glyph unicode="" d="M5 597q0 122 47.5 232.5t127.5 190.5t190.5 127.5t232.5 47.5q121 0 231.5 -47.5t190.5 -127.5t127.5 -190.5t47.5 -232.5q0 -162 -80 -299.5t-217.5 -217.5t-299.5 -80t-300 80t-218 217.5t-80 299.5zM254 780q-8 -33 5.5 -92.5t7.5 -87.5q0 -9 17 -44t16 -60 q12 0 23 -5.5t23 -15t20 -13.5q24 -12 108 -42q22 -8 53 -31.5t59.5 -38.5t57.5 -11q8 -18 -15 -55t-20 -57q42 -71 87 -80q0 -6 -3 -15.5t-3.5 -14.5t4.5 -17q104 -3 221 112q30 29 47 47t34.5 49t20.5 62q-14 9 -37 9.5t-36 7.5q-14 7 -49 15t-52 19q-9 0 -39.5 -0.5 t-46.5 -1.5t-39 -6.5t-39 -16.5q-50 -35 -66 -12q-4 2 -3.5 25.5t0.5 25.5q-6 13 -26.5 17t-24.5 7q2 22 -2 41t-16.5 28t-38.5 -20q-23 -25 -42 4q-19 28 -8 58q6 16 22 22q6 -1 26 -1.5t33.5 -4t19.5 -13.5q12 -19 32 -37.5t34 -27.5l14 -8q0 3 9.5 39.5t5.5 57.5 q-4 23 14.5 44.5t22.5 31.5q5 14 10 35t8.5 31t15.5 22.5t34 21.5q-6 18 10 37q8 0 23.5 -1.5t24.5 -1.5t20.5 4.5t20.5 15.5q-10 23 -30.5 42.5t-38 30t-49 26.5t-43.5 23q11 39 2 44q31 -13 58 -14.5t39 3.5l11 4q7 36 -16.5 53.5t-64.5 28.5t-56 23q-19 -3 -37 0 q-15 -12 -36.5 -21t-34.5 -12t-44 -8t-39 -6q-15 -3 -45.5 0.5t-45.5 -2.5q-21 -7 -52 -26.5t-34 -34.5q-3 -11 6.5 -22.5t8.5 -18.5q-3 -34 -27.5 -90.5t-29.5 -79.5zM518 916q3 12 16 30t16 25q10 -10 18.5 -10t14 6t14.5 14.5t16 12.5q0 -24 17 -66.5t17 -43.5 q-9 2 -31 5t-36 5t-32 8t-30 14zM692 1003h1h-1z" />
+<glyph unicode="" d="M0 164.5q0 21.5 15 37.5l600 599q-33 101 6 201.5t135 154.5q164 92 306 -9l-259 -138l145 -232l251 126q13 -175 -151 -267q-123 -70 -253 -23l-596 -596q-15 -16 -36.5 -16t-36.5 16l-111 110q-15 15 -15 36.5z" />
+<glyph unicode="" horiz-adv-x="1220" d="M0 196v100q0 41 29.5 70.5t70.5 29.5h1000q41 0 70.5 -29.5t29.5 -70.5v-100q0 -41 -29.5 -70.5t-70.5 -29.5h-1000q-41 0 -70.5 29.5t-29.5 70.5zM0 596v100q0 41 29.5 70.5t70.5 29.5h1000q41 0 70.5 -29.5t29.5 -70.5v-100q0 -41 -29.5 -70.5t-70.5 -29.5h-1000 q-41 0 -70.5 29.5t-29.5 70.5zM0 996v100q0 41 29.5 70.5t70.5 29.5h1000q41 0 70.5 -29.5t29.5 -70.5v-100q0 -41 -29.5 -70.5t-70.5 -29.5h-1000q-41 0 -70.5 29.5t-29.5 70.5zM600 596h500v100h-500v-100zM800 196h300v100h-300v-100zM900 996h200v100h-200v-100z" />
+<glyph unicode="" d="M100 1100v100h1000v-100h-1000zM150 1000h900l-350 -500v-300l-200 -200v500z" />
+<glyph unicode="" d="M0 200v200h1200v-200q0 -41 -29.5 -70.5t-70.5 -29.5h-1000q-41 0 -70.5 29.5t-29.5 70.5zM0 500v400q0 41 29.5 70.5t70.5 29.5h300v100q0 41 29.5 70.5t70.5 29.5h200q41 0 70.5 -29.5t29.5 -70.5v-100h300q41 0 70.5 -29.5t29.5 -70.5v-400h-500v100h-200v-100h-500z M500 1000h200v100h-200v-100z" />
+<glyph unicode="" d="M0 0v400l129 -129l200 200l142 -142l-200 -200l129 -129h-400zM0 800l129 129l200 -200l142 142l-200 200l129 129h-400v-400zM729 329l142 142l200 -200l129 129v-400h-400l129 129zM729 871l200 200l-129 129h400v-400l-129 129l-200 -200z" />
+<glyph unicode="" d="M0 596q0 162 80 299t217 217t299 80t299 -80t217 -217t80 -299t-80 -299t-217 -217t-299 -80t-299 80t-217 217t-80 299zM182 596q0 -172 121.5 -293t292.5 -121t292.5 121t121.5 293q0 171 -121.5 292.5t-292.5 121.5t-292.5 -121.5t-121.5 -292.5zM291 655 q0 23 15.5 38.5t38.5 15.5t39 -16t16 -38q0 -23 -16 -39t-39 -16q-22 0 -38 16t-16 39zM400 850q0 22 16 38.5t39 16.5q22 0 38 -16t16 -39t-16 -39t-38 -16q-23 0 -39 16.5t-16 38.5zM514 609q0 32 20.5 56.5t51.5 29.5l122 126l1 1q-9 14 -9 28q0 22 16 38.5t39 16.5 q22 0 38 -16t16 -39t-16 -39t-38 -16q-14 0 -29 10l-55 -145q17 -22 17 -51q0 -36 -25.5 -61.5t-61.5 -25.5t-61.5 25.5t-25.5 61.5zM800 655q0 22 16 38t39 16t38.5 -15.5t15.5 -38.5t-16 -39t-38 -16q-23 0 -39 16t-16 39z" />
+<glyph unicode="" d="M-40 375q-13 -95 35 -173q35 -57 94 -89t129 -32q63 0 119 28q33 16 65 40.5t52.5 45.5t59.5 64q40 44 57 61l394 394q35 35 47 84t-3 96q-27 87 -117 104q-20 2 -29 2q-46 0 -78.5 -16.5t-67.5 -51.5l-389 -396l-7 -7l69 -67l377 373q20 22 39 38q23 23 50 23 q38 0 53 -36q16 -39 -20 -75l-547 -547q-52 -52 -125 -52q-55 0 -100 33t-54 96q-5 35 2.5 66t31.5 63t42 50t56 54q24 21 44 41l348 348q52 52 82.5 79.5t84 54t107.5 26.5q25 0 48 -4q95 -17 154 -94.5t51 -175.5q-7 -101 -98 -192l-252 -249l-253 -256l7 -7l69 -60 l517 511q67 67 95 157t11 183q-16 87 -67 154t-130 103q-69 33 -152 33q-107 0 -197 -55q-40 -24 -111 -95l-512 -512q-68 -68 -81 -163z" />
+<glyph unicode="" d="M80 784q0 131 98.5 229.5t230.5 98.5q143 0 241 -129q103 129 246 129q129 0 226 -98.5t97 -229.5q0 -46 -17.5 -91t-61 -99t-77 -89.5t-104.5 -105.5q-197 -191 -293 -322l-17 -23l-16 23q-43 58 -100 122.5t-92 99.5t-101 100q-71 70 -104.5 105.5t-77 89.5t-61 99 t-17.5 91zM250 784q0 -27 30.5 -70t61.5 -75.5t95 -94.5l22 -22q93 -90 190 -201q82 92 195 203l12 12q64 62 97.5 97t64.5 79t31 72q0 71 -48 119.5t-105 48.5q-74 0 -132 -83l-118 -171l-114 174q-51 80 -123 80q-60 0 -109.5 -49.5t-49.5 -118.5z" />
+<glyph unicode="" d="M57 353q0 -95 66 -159l141 -142q68 -66 159 -66q93 0 159 66l283 283q66 66 66 159t-66 159l-141 141q-8 9 -19 17l-105 -105l212 -212l-389 -389l-247 248l95 95l-18 18q-46 45 -75 101l-55 -55q-66 -66 -66 -159zM269 706q0 -93 66 -159l141 -141q7 -7 19 -17l105 105 l-212 212l389 389l247 -247l-95 -96l18 -17q47 -49 77 -100l29 29q35 35 62.5 88t27.5 96q0 93 -66 159l-141 141q-66 66 -159 66q-95 0 -159 -66l-283 -283q-66 -64 -66 -159z" />
+<glyph unicode="" d="M200 100v953q0 21 30 46t81 48t129 38t163 15t162 -15t127 -38t79 -48t29 -46v-953q0 -41 -29.5 -70.5t-70.5 -29.5h-600q-41 0 -70.5 29.5t-29.5 70.5zM300 300h600v700h-600v-700zM496 150q0 -43 30.5 -73.5t73.5 -30.5t73.5 30.5t30.5 73.5t-30.5 73.5t-73.5 30.5 t-73.5 -30.5t-30.5 -73.5z" />
+<glyph unicode="" d="M0 0l303 380l207 208l-210 212h300l267 279l-35 36q-15 14 -15 35t15 35q14 15 35 15t35 -15l283 -282q15 -15 15 -36t-15 -35q-14 -15 -35 -15t-35 15l-36 35l-279 -267v-300l-212 210l-208 -207z" />
+<glyph unicode="" d="M295 433h139q5 -77 48.5 -126.5t117.5 -64.5v335q-6 1 -15.5 4t-11.5 3q-46 14 -79 26.5t-72 36t-62.5 52t-40 72.5t-16.5 99q0 92 44 159.5t109 101t144 40.5v78h100v-79q38 -4 72.5 -13.5t75.5 -31.5t71 -53.5t51.5 -84t24.5 -118.5h-159q-8 72 -35 109.5t-101 50.5 v-307l64 -14q34 -7 64 -16.5t70 -31.5t67.5 -52t47.5 -80.5t20 -112.5q0 -139 -89 -224t-244 -96v-77h-100v78q-152 17 -237 104q-40 40 -52.5 93.5t-15.5 139.5zM466 889q0 -29 8 -51t16.5 -34t29.5 -22.5t31 -13.5t38 -10q7 -2 11 -3v274q-61 -8 -97.5 -37.5t-36.5 -102.5 zM700 237q170 18 170 151q0 64 -44 99.5t-126 60.5v-311z" />
+<glyph unicode="" d="M100 600v100h166q-24 49 -44 104q-10 26 -14.5 55.5t-3 72.5t25 90t68.5 87q97 88 263 88q129 0 230 -89t101 -208h-153q0 52 -34 89.5t-74 51.5t-76 14q-37 0 -79 -14.5t-62 -35.5q-41 -44 -41 -101q0 -28 16.5 -69.5t28 -62.5t41.5 -72h241v-100h-197q8 -50 -2.5 -115 t-31.5 -94q-41 -59 -99 -113q35 11 84 18t70 7q33 1 103 -16t103 -17q76 0 136 30l50 -147q-41 -25 -80.5 -36.5t-59 -13t-61.5 -1.5q-23 0 -128 33t-155 29q-39 -4 -82 -17t-66 -25l-24 -11l-55 145l16.5 11t15.5 10t13.5 9.5t14.5 12t14.5 14t17.5 18.5q48 55 54 126.5 t-30 142.5h-221z" />
+<glyph unicode="" d="M2 300l298 -300l298 300h-198v900h-200v-900h-198zM602 900l298 300l298 -300h-198v-900h-200v900h-198z" />
+<glyph unicode="" d="M2 300h198v900h200v-900h198l-298 -300zM700 0v200h100v-100h200v-100h-300zM700 400v100h300v-200h-99v-100h-100v100h99v100h-200zM700 700v500h300v-500h-100v100h-100v-100h-100zM801 900h100v200h-100v-200z" />
+<glyph unicode="" d="M2 300h198v900h200v-900h198l-298 -300zM700 0v500h300v-500h-100v100h-100v-100h-100zM700 700v200h100v-100h200v-100h-300zM700 1100v100h300v-200h-99v-100h-100v100h99v100h-200zM801 200h100v200h-100v-200z" />
+<glyph unicode="" d="M2 300l298 -300l298 300h-198v900h-200v-900h-198zM800 100v400h300v-500h-100v100h-200zM800 1100v100h200v-500h-100v400h-100zM901 200h100v200h-100v-200z" />
+<glyph unicode="" d="M2 300l298 -300l298 300h-198v900h-200v-900h-198zM800 400v100h200v-500h-100v400h-100zM800 800v400h300v-500h-100v100h-200zM901 900h100v200h-100v-200z" />
+<glyph unicode="" d="M2 300l298 -300l298 300h-198v900h-200v-900h-198zM700 100v200h500v-200h-500zM700 400v200h400v-200h-400zM700 700v200h300v-200h-300zM700 1000v200h200v-200h-200z" />
+<glyph unicode="" d="M2 300l298 -300l298 300h-198v900h-200v-900h-198zM700 100v200h200v-200h-200zM700 400v200h300v-200h-300zM700 700v200h400v-200h-400zM700 1000v200h500v-200h-500z" />
+<glyph unicode="" d="M0 400v300q0 165 117.5 282.5t282.5 117.5h300q162 0 281 -118.5t119 -281.5v-300q0 -165 -118.5 -282.5t-281.5 -117.5h-300q-165 0 -282.5 117.5t-117.5 282.5zM200 300q0 -41 29.5 -70.5t70.5 -29.5h500q41 0 70.5 29.5t29.5 70.5v500q0 41 -29.5 70.5t-70.5 29.5 h-500q-41 0 -70.5 -29.5t-29.5 -70.5v-500z" />
+<glyph unicode="" d="M0 400v300q0 163 119 281.5t281 118.5h300q165 0 282.5 -117.5t117.5 -282.5v-300q0 -165 -117.5 -282.5t-282.5 -117.5h-300q-163 0 -281.5 117.5t-118.5 282.5zM200 300q0 -41 29.5 -70.5t70.5 -29.5h500q41 0 70.5 29.5t29.5 70.5v500q0 41 -29.5 70.5t-70.5 29.5 h-500q-41 0 -70.5 -29.5t-29.5 -70.5v-500zM400 300l333 250l-333 250v-500z" />
+<glyph unicode="" d="M0 400v300q0 163 117.5 281.5t282.5 118.5h300q163 0 281.5 -119t118.5 -281v-300q0 -165 -117.5 -282.5t-282.5 -117.5h-300q-165 0 -282.5 117.5t-117.5 282.5zM200 300q0 -41 29.5 -70.5t70.5 -29.5h500q41 0 70.5 29.5t29.5 70.5v500q0 41 -29.5 70.5t-70.5 29.5 h-500q-41 0 -70.5 -29.5t-29.5 -70.5v-500zM300 700l250 -333l250 333h-500z" />
+<glyph unicode="" d="M0 400v300q0 165 117.5 282.5t282.5 117.5h300q165 0 282.5 -117.5t117.5 -282.5v-300q0 -162 -118.5 -281t-281.5 -119h-300q-165 0 -282.5 118.5t-117.5 281.5zM200 300q0 -41 29.5 -70.5t70.5 -29.5h500q41 0 70.5 29.5t29.5 70.5v500q0 41 -29.5 70.5t-70.5 29.5 h-500q-41 0 -70.5 -29.5t-29.5 -70.5v-500zM300 400h500l-250 333z" />
+<glyph unicode="" d="M0 400v300h300v200l400 -350l-400 -350v200h-300zM500 0v200h500q41 0 70.5 29.5t29.5 70.5v500q0 41 -29.5 70.5t-70.5 29.5h-500v200h400q165 0 282.5 -117.5t117.5 -282.5v-300q0 -165 -117.5 -282.5t-282.5 -117.5h-400z" />
+<glyph unicode="" d="M217 519q8 -19 31 -19h302q-155 -438 -160 -458q-5 -21 4 -32l9 -8h9q14 0 26 15q11 13 274.5 321.5t264.5 308.5q14 19 5 36q-8 17 -31 17l-301 -1q1 4 78 219.5t79 227.5q2 15 -5 27l-9 9h-9q-15 0 -25 -16q-4 -6 -98 -111.5t-228.5 -257t-209.5 -237.5q-16 -19 -6 -41 z" />
+<glyph unicode="" d="M0 400q0 -165 117.5 -282.5t282.5 -117.5h300q47 0 100 15v185h-500q-41 0 -70.5 29.5t-29.5 70.5v500q0 41 29.5 70.5t70.5 29.5h500v185q-14 4 -114 7.5t-193 5.5l-93 2q-165 0 -282.5 -117.5t-117.5 -282.5v-300zM600 400v300h300v200l400 -350l-400 -350v200h-300z " />
+<glyph unicode="" d="M0 400q0 -165 117.5 -282.5t282.5 -117.5h300q163 0 281.5 117.5t118.5 282.5v98l-78 73l-122 -123v-148q0 -41 -29.5 -70.5t-70.5 -29.5h-500q-41 0 -70.5 29.5t-29.5 70.5v500q0 41 29.5 70.5t70.5 29.5h156l118 122l-74 78h-100q-165 0 -282.5 -117.5t-117.5 -282.5 v-300zM496 709l353 342l-149 149h500v-500l-149 149l-342 -353z" />
+<glyph unicode="" d="M4 600q0 162 80 299t217 217t299 80t299 -80t217 -217t80 -299t-80 -299t-217 -217t-299 -80t-299 80t-217 217t-80 299zM186 600q0 -171 121.5 -292.5t292.5 -121.5t292.5 121.5t121.5 292.5t-121.5 292.5t-292.5 121.5t-292.5 -121.5t-121.5 -292.5zM406 600 q0 80 57 137t137 57t137 -57t57 -137t-57 -137t-137 -57t-137 57t-57 137z" />
+<glyph unicode="" d="M0 0v275q0 11 7 18t18 7h1048q11 0 19 -7.5t8 -17.5v-275h-1100zM100 800l445 -500l450 500h-295v400h-300v-400h-300zM900 150h100v50h-100v-50z" />
+<glyph unicode="" d="M0 0v275q0 11 7 18t18 7h1048q11 0 19 -7.5t8 -17.5v-275h-1100zM100 700h300v-300h300v300h295l-445 500zM900 150h100v50h-100v-50z" />
+<glyph unicode="" d="M0 0v275q0 11 7 18t18 7h1048q11 0 19 -7.5t8 -17.5v-275h-1100zM100 705l305 -305l596 596l-154 155l-442 -442l-150 151zM900 150h100v50h-100v-50z" />
+<glyph unicode="" d="M0 0v275q0 11 7 18t18 7h1048q11 0 19 -7.5t8 -17.5v-275h-1100zM100 988l97 -98l212 213l-97 97zM200 400l697 1l3 699l-250 -239l-149 149l-212 -212l149 -149zM900 150h100v50h-100v-50z" />
+<glyph unicode="" d="M0 0v275q0 11 7 18t18 7h1048q11 0 19 -7.5t8 -17.5v-275h-1100zM200 612l212 -212l98 97l-213 212zM300 1200l239 -250l-149 -149l212 -212l149 148l249 -237l-1 697zM900 150h100v50h-100v-50z" />
+<glyph unicode="" d="M23 415l1177 784v-1079l-475 272l-310 -393v416h-392zM494 210l672 938l-672 -712v-226z" />
+<glyph unicode="" d="M0 150v1000q0 20 14.5 35t35.5 15h250v-300h500v300h100l200 -200v-850q0 -21 -15 -35.5t-35 -14.5h-150v400h-700v-400h-150q-21 0 -35.5 14.5t-14.5 35.5zM600 1000h100v200h-100v-200z" />
+<glyph unicode="" d="M0 150v1000q0 20 14.5 35t35.5 15h250v-300h500v300h100l200 -200v-218l-276 -275l-120 120l-126 -127h-378v-400h-150q-21 0 -35.5 14.5t-14.5 35.5zM581 306l123 123l120 -120l353 352l123 -123l-475 -476zM600 1000h100v200h-100v-200z" />
+<glyph unicode="" d="M0 150v1000q0 20 14.5 35t35.5 15h250v-300h500v300h100l200 -200v-269l-103 -103l-170 170l-298 -298h-329v-400h-150q-21 0 -35.5 14.5t-14.5 35.5zM600 1000h100v200h-100v-200zM700 133l170 170l-170 170l127 127l170 -170l170 170l127 -128l-170 -169l170 -170 l-127 -127l-170 170l-170 -170z" />
+<glyph unicode="" d="M0 150v1000q0 20 14.5 35t35.5 15h250v-300h500v300h100l200 -200v-300h-400v-200h-500v-400h-150q-21 0 -35.5 14.5t-14.5 35.5zM600 300l300 -300l300 300h-200v300h-200v-300h-200zM600 1000v200h100v-200h-100z" />
+<glyph unicode="" d="M0 150v1000q0 20 14.5 35t35.5 15h250v-300h500v300h100l200 -200v-402l-200 200l-298 -298h-402v-400h-150q-21 0 -35.5 14.5t-14.5 35.5zM600 300h200v-300h200v300h200l-300 300zM600 1000v200h100v-200h-100z" />
+<glyph unicode="" d="M0 250q0 -21 14.5 -35.5t35.5 -14.5h1100q21 0 35.5 14.5t14.5 35.5v550h-1200v-550zM0 900h1200v150q0 21 -14.5 35.5t-35.5 14.5h-1100q-21 0 -35.5 -14.5t-14.5 -35.5v-150zM100 300v200h400v-200h-400z" />
+<glyph unicode="" d="M0 400l300 298v-198h400v-200h-400v-198zM100 800v200h100v-200h-100zM300 800v200h100v-200h-100zM500 800v200h400v198l300 -298l-300 -298v198h-400zM800 300v200h100v-200h-100zM1000 300h100v200h-100v-200z" />
+<glyph unicode="" d="M100 700v400l50 100l50 -100v-300h100v300l50 100l50 -100v-300h100v300l50 100l50 -100v-400l-100 -203v-447q0 -21 -14.5 -35.5t-35.5 -14.5h-200q-21 0 -35.5 14.5t-14.5 35.5v447zM800 597q0 -29 10.5 -55.5t25 -43t29 -28.5t25.5 -18l10 -5v-397q0 -21 14.5 -35.5 t35.5 -14.5h200q21 0 35.5 14.5t14.5 35.5v1106q0 31 -18 40.5t-44 -7.5l-276 -116q-25 -17 -43.5 -51.5t-18.5 -65.5v-359z" />
+<glyph unicode="" d="M100 0h400v56q-75 0 -87.5 6t-12.5 44v394h500v-394q0 -38 -12.5 -44t-87.5 -6v-56h400v56q-4 0 -11 0.5t-24 3t-30 7t-24 15t-11 24.5v888q0 22 25 34.5t50 13.5l25 2v56h-400v-56q75 0 87.5 -6t12.5 -44v-394h-500v394q0 38 12.5 44t87.5 6v56h-400v-56q4 0 11 -0.5 t24 -3t30 -7t24 -15t11 -24.5v-888q0 -22 -25 -34.5t-50 -13.5l-25 -2v-56z" />
+<glyph unicode="" d="M0 300q0 -41 29.5 -70.5t70.5 -29.5h300q41 0 70.5 29.5t29.5 70.5v500q0 41 -29.5 70.5t-70.5 29.5h-300q-41 0 -70.5 -29.5t-29.5 -70.5v-500zM100 100h400l200 200h105l295 98v-298h-425l-100 -100h-375zM100 300v200h300v-200h-300zM100 600v200h300v-200h-300z M100 1000h400l200 -200v-98l295 98h105v200h-425l-100 100h-375zM700 402v163l400 133v-163z" />
+<glyph unicode="" d="M16.5 974.5q0.5 -21.5 16 -90t46.5 -140t104 -177.5t175 -208q103 -103 207.5 -176t180 -103.5t137 -47t92.5 -16.5l31 1l163 162q17 18 13.5 41t-22.5 37l-192 136q-19 14 -45 12t-42 -19l-118 -118q-142 101 -268 227t-227 268l118 118q17 17 20 41.5t-11 44.5 l-139 194q-14 19 -36.5 22t-40.5 -14l-162 -162q-1 -11 -0.5 -32.5z" />
+<glyph unicode="" d="M0 50v212q0 20 10.5 45.5t24.5 39.5l365 303v50q0 4 1 10.5t12 22.5t30 28.5t60 23t97 10.5t97 -10t60 -23.5t30 -27.5t12 -24l1 -10v-50l365 -303q14 -14 24.5 -39.5t10.5 -45.5v-212q0 -21 -14.5 -35.5t-35.5 -14.5h-1100q-20 0 -35 14.5t-15 35.5zM0 712 q0 -21 14.5 -33.5t34.5 -8.5l202 33q20 4 34.5 21t14.5 38v146q141 24 300 24t300 -24v-146q0 -21 14.5 -38t34.5 -21l202 -33q20 -4 34.5 8.5t14.5 33.5v200q-6 8 -19 20.5t-63 45t-112 57t-171 45t-235 20.5q-92 0 -175 -10.5t-141.5 -27t-108.5 -36.5t-81.5 -40 t-53.5 -36.5t-31 -27.5l-9 -10v-200z" />
+<glyph unicode="" d="M100 0v100h1100v-100h-1100zM175 200h950l-125 150v250l100 100v400h-100v-200h-100v200h-200v-200h-100v200h-200v-200h-100v200h-100v-400l100 -100v-250z" />
+<glyph unicode="" d="M100 0h300v400q0 41 -29.5 70.5t-70.5 29.5h-100q-41 0 -70.5 -29.5t-29.5 -70.5v-400zM500 0v1000q0 41 29.5 70.5t70.5 29.5h100q41 0 70.5 -29.5t29.5 -70.5v-1000h-300zM900 0v700q0 41 29.5 70.5t70.5 29.5h100q41 0 70.5 -29.5t29.5 -70.5v-700h-300z" />
+<glyph unicode="" d="M-100 300v500q0 124 88 212t212 88h700q124 0 212 -88t88 -212v-500q0 -124 -88 -212t-212 -88h-700q-124 0 -212 88t-88 212zM100 200h900v700h-900v-700zM200 300h300v300h-200v100h200v100h-300v-300h200v-100h-200v-100zM600 300h200v100h100v300h-100v100h-200v-500 zM700 400v300h100v-300h-100z" />
+<glyph unicode="" d="M-100 300v500q0 124 88 212t212 88h700q124 0 212 -88t88 -212v-500q0 -124 -88 -212t-212 -88h-700q-124 0 -212 88t-88 212zM100 200h900v700h-900v-700zM200 300h100v200h100v-200h100v500h-100v-200h-100v200h-100v-500zM600 300h200v100h100v300h-100v100h-200v-500 zM700 400v300h100v-300h-100z" />
+<glyph unicode="" d="M-100 300v500q0 124 88 212t212 88h700q124 0 212 -88t88 -212v-500q0 -124 -88 -212t-212 -88h-700q-124 0 -212 88t-88 212zM100 200h900v700h-900v-700zM200 300h300v100h-200v300h200v100h-300v-500zM600 300h300v100h-200v300h200v100h-300v-500z" />
+<glyph unicode="" d="M-100 300v500q0 124 88 212t212 88h700q124 0 212 -88t88 -212v-500q0 -124 -88 -212t-212 -88h-700q-124 0 -212 88t-88 212zM100 200h900v700h-900v-700zM200 550l300 -150v300zM600 400l300 150l-300 150v-300z" />
+<glyph unicode="" d="M-100 300v500q0 124 88 212t212 88h700q124 0 212 -88t88 -212v-500q0 -124 -88 -212t-212 -88h-700q-124 0 -212 88t-88 212zM100 200h900v700h-900v-700zM200 300v500h700v-500h-700zM300 400h130q41 0 68 42t27 107t-28.5 108t-66.5 43h-130v-300zM575 549 q0 -65 27 -107t68 -42h130v300h-130q-38 0 -66.5 -43t-28.5 -108z" />
+<glyph unicode="" d="M-100 300v500q0 124 88 212t212 88h700q124 0 212 -88t88 -212v-500q0 -124 -88 -212t-212 -88h-700q-124 0 -212 88t-88 212zM100 200h900v700h-900v-700zM200 300h300v300h-200v100h200v100h-300v-300h200v-100h-200v-100zM601 300h100v100h-100v-100zM700 700h100 v-400h100v500h-200v-100z" />
+<glyph unicode="" d="M-100 300v500q0 124 88 212t212 88h700q124 0 212 -88t88 -212v-500q0 -124 -88 -212t-212 -88h-700q-124 0 -212 88t-88 212zM100 200h900v700h-900v-700zM200 300h300v400h-200v100h-100v-500zM301 400v200h100v-200h-100zM601 300h100v100h-100v-100zM700 700h100 v-400h100v500h-200v-100z" />
+<glyph unicode="" d="M-100 300v500q0 124 88 212t212 88h700q124 0 212 -88t88 -212v-500q0 -124 -88 -212t-212 -88h-700q-124 0 -212 88t-88 212zM100 200h900v700h-900v-700zM200 700v100h300v-300h-99v-100h-100v100h99v200h-200zM201 300v100h100v-100h-100zM601 300v100h100v-100h-100z M700 700v100h200v-500h-100v400h-100z" />
+<glyph unicode="" d="M4 600q0 162 80 299t217 217t299 80t299 -80t217 -217t80 -299t-80 -299t-217 -217t-299 -80t-299 80t-217 217t-80 299zM186 600q0 -171 121.5 -292.5t292.5 -121.5t292.5 121.5t121.5 292.5t-121.5 292.5t-292.5 121.5t-292.5 -121.5t-121.5 -292.5zM400 500v200 l100 100h300v-100h-300v-200h300v-100h-300z" />
+<glyph unicode="" d="M0 600q0 162 80 299t217 217t299 80t299 -80t217 -217t80 -299t-80 -299t-217 -217t-299 -80t-299 80t-217 217t-80 299zM182 600q0 -171 121.5 -292.5t292.5 -121.5t292.5 121.5t121.5 292.5t-121.5 292.5t-292.5 121.5t-292.5 -121.5t-121.5 -292.5zM400 400v400h300 l100 -100v-100h-100v100h-200v-100h200v-100h-200v-100h-100zM700 400v100h100v-100h-100z" />
+<glyph unicode="" d="M-14 494q0 -80 56.5 -137t135.5 -57h222v300h400v-300h128q120 0 205 86.5t85 207.5t-85 207t-205 86q-46 0 -90 -14q-44 97 -134.5 156.5t-200.5 59.5q-152 0 -260 -107.5t-108 -260.5q0 -25 2 -37q-66 -14 -108.5 -67.5t-42.5 -122.5zM300 200h200v300h200v-300h200 l-300 -300z" />
+<glyph unicode="" d="M-14 494q0 -80 56.5 -137t135.5 -57h8l414 414l403 -403q94 26 154.5 104.5t60.5 178.5q0 120 -85 206.5t-205 86.5q-46 0 -90 -14q-44 97 -134.5 156.5t-200.5 59.5q-152 0 -260 -107.5t-108 -260.5q0 -25 2 -37q-66 -14 -108.5 -67.5t-42.5 -122.5zM300 200l300 300 l300 -300h-200v-300h-200v300h-200z" />
+<glyph unicode="" d="M100 200h400v-155l-75 -45h350l-75 45v155h400l-270 300h170l-270 300h170l-300 333l-300 -333h170l-270 -300h170z" />
+<glyph unicode="" d="M121 700q0 -53 28.5 -97t75.5 -65q-4 -16 -4 -38q0 -74 52.5 -126.5t126.5 -52.5q56 0 100 30v-306l-75 -45h350l-75 45v306q46 -30 100 -30q74 0 126.5 52.5t52.5 126.5q0 24 -9 55q50 32 79.5 83t29.5 112q0 90 -61.5 155.5t-150.5 71.5q-26 89 -99.5 145.5 t-167.5 56.5q-116 0 -197.5 -81.5t-81.5 -197.5q0 -4 1 -11.5t1 -11.5q-14 2 -23 2q-74 0 -126.5 -52.5t-52.5 -126.5z" />
+</font>
+</defs></svg>
\ No newline at end of file
diff --git a/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.ttf b/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.ttf
new file mode 100644
index 0000000000000000000000000000000000000000..67fa00bf83801d2fa568546b982c80d27f6ef74e
Binary files /dev/null and b/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.ttf differ
diff --git a/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.woff b/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.woff
new file mode 100644
index 0000000000000000000000000000000000000000..8c54182aa5d4d1ab3c9171976b615c1dcb1dc187
Binary files /dev/null and b/mutalyzer/website/templates/static/fonts/glyphicons-halflings-regular.woff differ
diff --git a/mutalyzer/website/templates/static/images/1x1b.gif b/mutalyzer/website/templates/static/images/1x1b.gif
deleted file mode 100644
index d794434481d0414bcfe6d6d73fc97045fa134b06..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/1x1b.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/1x1w.gif b/mutalyzer/website/templates/static/images/1x1w.gif
deleted file mode 100644
index b636f4b8df536b0a85e7cea1a6cf3f0bd3179b96..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/1x1w.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/background.gif b/mutalyzer/website/templates/static/images/background.gif
deleted file mode 100644
index 6ead0ee22f1e1d904e1685927f395e8bb9d88328..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/background.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/background.gif.old b/mutalyzer/website/templates/static/images/background.gif.old
deleted file mode 100644
index 59ad6fdd131b516f73ce40e28e09ab1050c60274..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/background.gif.old and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/banner.jpg b/mutalyzer/website/templates/static/images/banner.jpg
deleted file mode 100644
index ede7dcd57b2febf586622fd3963fcec8e22b0ee6..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/banner.jpg and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/bullit.gif b/mutalyzer/website/templates/static/images/bullit.gif
deleted file mode 100644
index ea03a4a526665e8e0f73b7254883775bd6ff6b14..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/bullit.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/bullitdonker.gif b/mutalyzer/website/templates/static/images/bullitdonker.gif
deleted file mode 100644
index 274f00384e36294959c3064ab62f11f137e02b86..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/bullitdonker.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/bullitlicht1.gif b/mutalyzer/website/templates/static/images/bullitlicht1.gif
deleted file mode 100644
index 167aa451d5acf8904b170e9ac2f91589906d4417..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/bullitlicht1.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/bullitlicht2.gif b/mutalyzer/website/templates/static/images/bullitlicht2.gif
deleted file mode 100644
index 12c17c3e52ceef5f77d605806e8a0a2ca744f2dc..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/bullitlicht2.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/bullitmiddel.gif b/mutalyzer/website/templates/static/images/bullitmiddel.gif
deleted file mode 100644
index 7160e5c26605788150f4ed0246f01c4e7baafbb3..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/bullitmiddel.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/bullitmiddel.gif.old b/mutalyzer/website/templates/static/images/bullitmiddel.gif.old
deleted file mode 100644
index 52d2c7a9cadf1cee4ac1417b59114770cdb4e7db..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/bullitmiddel.gif.old and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/cubic4-17.gif b/mutalyzer/website/templates/static/images/cubic4-17.gif
deleted file mode 100644
index cd1b1bfb22d09e6d1edd6e39606318d12cfc55ed..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/cubic4-17.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/cubic4-17c.gif b/mutalyzer/website/templates/static/images/cubic4-17c.gif
deleted file mode 100644
index e557427ddd43f776e1f00233169f74a1bb0ee716..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/cubic4-17c.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/debug.png b/mutalyzer/website/templates/static/images/debug.png
deleted file mode 100644
index 555887a28d64bc812c4dfa98a6ff1da1927b7792..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/debug.png and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/detailkaart.jpg b/mutalyzer/website/templates/static/images/detailkaart.jpg
deleted file mode 100644
index 72c6194f74779b6315a0f24962d9c99ab4a68d29..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/detailkaart.jpg and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/error.png b/mutalyzer/website/templates/static/images/error.png
deleted file mode 100644
index 517725822ba2859be6811af489efc672fe4117df..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/error.png and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/info.png b/mutalyzer/website/templates/static/images/info.png
deleted file mode 100644
index bd4f552a8bfccb0abe072437a8762598a562a7a7..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/info.png and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/landscape_logo.png b/mutalyzer/website/templates/static/images/landscape_logo.png
new file mode 100644
index 0000000000000000000000000000000000000000..5face0dd1960a40f96d7a803a1451c68e392607d
Binary files /dev/null and b/mutalyzer/website/templates/static/images/landscape_logo.png differ
diff --git a/mutalyzer/website/templates/static/images/logoULE.gif b/mutalyzer/website/templates/static/images/logoULE.gif
deleted file mode 100644
index 28801ff7b866b37bc295648a16d286687ecbe570..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/logoULE.gif and /dev/null differ
diff --git a/mutalyzer/website/templates/static/images/mutalyzer_logo_bw.png b/mutalyzer/website/templates/static/images/mutalyzer_logo_bw.png
index b196d2b3288bf51703ebf006e74a9ab50427daf6..f829dcb670cd43c775cdfe3e8d6e2305d8884cd0 100644
Binary files a/mutalyzer/website/templates/static/images/mutalyzer_logo_bw.png and b/mutalyzer/website/templates/static/images/mutalyzer_logo_bw.png differ
diff --git a/mutalyzer/website/templates/static/images/warning.png b/mutalyzer/website/templates/static/images/warning.png
deleted file mode 100644
index 9b0460ed47c11361b948e4f7ebf39e2a799f3d8f..0000000000000000000000000000000000000000
Binary files a/mutalyzer/website/templates/static/images/warning.png and /dev/null differ
diff --git a/mutalyzer/website/templates/static/js/bootstrap.js b/mutalyzer/website/templates/static/js/bootstrap.js
new file mode 100644
index 0000000000000000000000000000000000000000..8ae571b6da5be9c7dcd95ba25896ae39e1917445
--- /dev/null
+++ b/mutalyzer/website/templates/static/js/bootstrap.js
@@ -0,0 +1,1951 @@
+/*!
+ * Bootstrap v3.1.1 (http://getbootstrap.com)
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ */
+
+if (typeof jQuery === 'undefined') { throw new Error('Bootstrap\'s JavaScript requires jQuery') }
+
+/* ========================================================================
+ * Bootstrap: transition.js v3.1.1
+ * http://getbootstrap.com/javascript/#transitions
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // CSS TRANSITION SUPPORT (Shoutout: http://www.modernizr.com/)
+ // ============================================================
+
+ function transitionEnd() {
+ var el = document.createElement('bootstrap')
+
+ var transEndEventNames = {
+ 'WebkitTransition' : 'webkitTransitionEnd',
+ 'MozTransition' : 'transitionend',
+ 'OTransition' : 'oTransitionEnd otransitionend',
+ 'transition' : 'transitionend'
+ }
+
+ for (var name in transEndEventNames) {
+ if (el.style[name] !== undefined) {
+ return { end: transEndEventNames[name] }
+ }
+ }
+
+ return false // explicit for ie8 ( ._.)
+ }
+
+ // http://blog.alexmaccaw.com/css-transitions
+ $.fn.emulateTransitionEnd = function (duration) {
+ var called = false, $el = this
+ $(this).one($.support.transition.end, function () { called = true })
+ var callback = function () { if (!called) $($el).trigger($.support.transition.end) }
+ setTimeout(callback, duration)
+ return this
+ }
+
+ $(function () {
+ $.support.transition = transitionEnd()
+ })
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: alert.js v3.1.1
+ * http://getbootstrap.com/javascript/#alerts
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // ALERT CLASS DEFINITION
+ // ======================
+
+ var dismiss = '[data-dismiss="alert"]'
+ var Alert = function (el) {
+ $(el).on('click', dismiss, this.close)
+ }
+
+ Alert.prototype.close = function (e) {
+ var $this = $(this)
+ var selector = $this.attr('data-target')
+
+ if (!selector) {
+ selector = $this.attr('href')
+ selector = selector && selector.replace(/.*(?=#[^\s]*$)/, '') // strip for ie7
+ }
+
+ var $parent = $(selector)
+
+ if (e) e.preventDefault()
+
+ if (!$parent.length) {
+ $parent = $this.hasClass('alert') ? $this : $this.parent()
+ }
+
+ $parent.trigger(e = $.Event('close.bs.alert'))
+
+ if (e.isDefaultPrevented()) return
+
+ $parent.removeClass('in')
+
+ function removeElement() {
+ $parent.trigger('closed.bs.alert').remove()
+ }
+
+ $.support.transition && $parent.hasClass('fade') ?
+ $parent
+ .one($.support.transition.end, removeElement)
+ .emulateTransitionEnd(150) :
+ removeElement()
+ }
+
+
+ // ALERT PLUGIN DEFINITION
+ // =======================
+
+ var old = $.fn.alert
+
+ $.fn.alert = function (option) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.alert')
+
+ if (!data) $this.data('bs.alert', (data = new Alert(this)))
+ if (typeof option == 'string') data[option].call($this)
+ })
+ }
+
+ $.fn.alert.Constructor = Alert
+
+
+ // ALERT NO CONFLICT
+ // =================
+
+ $.fn.alert.noConflict = function () {
+ $.fn.alert = old
+ return this
+ }
+
+
+ // ALERT DATA-API
+ // ==============
+
+ $(document).on('click.bs.alert.data-api', dismiss, Alert.prototype.close)
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: button.js v3.1.1
+ * http://getbootstrap.com/javascript/#buttons
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // BUTTON PUBLIC CLASS DEFINITION
+ // ==============================
+
+ var Button = function (element, options) {
+ this.$element = $(element)
+ this.options = $.extend({}, Button.DEFAULTS, options)
+ this.isLoading = false
+ }
+
+ Button.DEFAULTS = {
+ loadingText: 'loading...'
+ }
+
+ Button.prototype.setState = function (state) {
+ var d = 'disabled'
+ var $el = this.$element
+ var val = $el.is('input') ? 'val' : 'html'
+ var data = $el.data()
+
+ state = state + 'Text'
+
+ if (!data.resetText) $el.data('resetText', $el[val]())
+
+ $el[val](data[state] || this.options[state])
+
+ // push to event loop to allow forms to submit
+ setTimeout($.proxy(function () {
+ if (state == 'loadingText') {
+ this.isLoading = true
+ $el.addClass(d).attr(d, d)
+ } else if (this.isLoading) {
+ this.isLoading = false
+ $el.removeClass(d).removeAttr(d)
+ }
+ }, this), 0)
+ }
+
+ Button.prototype.toggle = function () {
+ var changed = true
+ var $parent = this.$element.closest('[data-toggle="buttons"]')
+
+ if ($parent.length) {
+ var $input = this.$element.find('input')
+ if ($input.prop('type') == 'radio') {
+ if ($input.prop('checked') && this.$element.hasClass('active')) changed = false
+ else $parent.find('.active').removeClass('active')
+ }
+ if (changed) $input.prop('checked', !this.$element.hasClass('active')).trigger('change')
+ }
+
+ if (changed) this.$element.toggleClass('active')
+ }
+
+
+ // BUTTON PLUGIN DEFINITION
+ // ========================
+
+ var old = $.fn.button
+
+ $.fn.button = function (option) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.button')
+ var options = typeof option == 'object' && option
+
+ if (!data) $this.data('bs.button', (data = new Button(this, options)))
+
+ if (option == 'toggle') data.toggle()
+ else if (option) data.setState(option)
+ })
+ }
+
+ $.fn.button.Constructor = Button
+
+
+ // BUTTON NO CONFLICT
+ // ==================
+
+ $.fn.button.noConflict = function () {
+ $.fn.button = old
+ return this
+ }
+
+
+ // BUTTON DATA-API
+ // ===============
+
+ $(document).on('click.bs.button.data-api', '[data-toggle^=button]', function (e) {
+ var $btn = $(e.target)
+ if (!$btn.hasClass('btn')) $btn = $btn.closest('.btn')
+ $btn.button('toggle')
+ e.preventDefault()
+ })
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: carousel.js v3.1.1
+ * http://getbootstrap.com/javascript/#carousel
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // CAROUSEL CLASS DEFINITION
+ // =========================
+
+ var Carousel = function (element, options) {
+ this.$element = $(element)
+ this.$indicators = this.$element.find('.carousel-indicators')
+ this.options = options
+ this.paused =
+ this.sliding =
+ this.interval =
+ this.$active =
+ this.$items = null
+
+ this.options.pause == 'hover' && this.$element
+ .on('mouseenter', $.proxy(this.pause, this))
+ .on('mouseleave', $.proxy(this.cycle, this))
+ }
+
+ Carousel.DEFAULTS = {
+ interval: 5000,
+ pause: 'hover',
+ wrap: true
+ }
+
+ Carousel.prototype.cycle = function (e) {
+ e || (this.paused = false)
+
+ this.interval && clearInterval(this.interval)
+
+ this.options.interval
+ && !this.paused
+ && (this.interval = setInterval($.proxy(this.next, this), this.options.interval))
+
+ return this
+ }
+
+ Carousel.prototype.getActiveIndex = function () {
+ this.$active = this.$element.find('.item.active')
+ this.$items = this.$active.parent().children()
+
+ return this.$items.index(this.$active)
+ }
+
+ Carousel.prototype.to = function (pos) {
+ var that = this
+ var activeIndex = this.getActiveIndex()
+
+ if (pos > (this.$items.length - 1) || pos < 0) return
+
+ if (this.sliding) return this.$element.one('slid.bs.carousel', function () { that.to(pos) })
+ if (activeIndex == pos) return this.pause().cycle()
+
+ return this.slide(pos > activeIndex ? 'next' : 'prev', $(this.$items[pos]))
+ }
+
+ Carousel.prototype.pause = function (e) {
+ e || (this.paused = true)
+
+ if (this.$element.find('.next, .prev').length && $.support.transition) {
+ this.$element.trigger($.support.transition.end)
+ this.cycle(true)
+ }
+
+ this.interval = clearInterval(this.interval)
+
+ return this
+ }
+
+ Carousel.prototype.next = function () {
+ if (this.sliding) return
+ return this.slide('next')
+ }
+
+ Carousel.prototype.prev = function () {
+ if (this.sliding) return
+ return this.slide('prev')
+ }
+
+ Carousel.prototype.slide = function (type, next) {
+ var $active = this.$element.find('.item.active')
+ var $next = next || $active[type]()
+ var isCycling = this.interval
+ var direction = type == 'next' ? 'left' : 'right'
+ var fallback = type == 'next' ? 'first' : 'last'
+ var that = this
+
+ if (!$next.length) {
+ if (!this.options.wrap) return
+ $next = this.$element.find('.item')[fallback]()
+ }
+
+ if ($next.hasClass('active')) return this.sliding = false
+
+ var e = $.Event('slide.bs.carousel', { relatedTarget: $next[0], direction: direction })
+ this.$element.trigger(e)
+ if (e.isDefaultPrevented()) return
+
+ this.sliding = true
+
+ isCycling && this.pause()
+
+ if (this.$indicators.length) {
+ this.$indicators.find('.active').removeClass('active')
+ this.$element.one('slid.bs.carousel', function () {
+ var $nextIndicator = $(that.$indicators.children()[that.getActiveIndex()])
+ $nextIndicator && $nextIndicator.addClass('active')
+ })
+ }
+
+ if ($.support.transition && this.$element.hasClass('slide')) {
+ $next.addClass(type)
+ $next[0].offsetWidth // force reflow
+ $active.addClass(direction)
+ $next.addClass(direction)
+ $active
+ .one($.support.transition.end, function () {
+ $next.removeClass([type, direction].join(' ')).addClass('active')
+ $active.removeClass(['active', direction].join(' '))
+ that.sliding = false
+ setTimeout(function () { that.$element.trigger('slid.bs.carousel') }, 0)
+ })
+ .emulateTransitionEnd($active.css('transition-duration').slice(0, -1) * 1000)
+ } else {
+ $active.removeClass('active')
+ $next.addClass('active')
+ this.sliding = false
+ this.$element.trigger('slid.bs.carousel')
+ }
+
+ isCycling && this.cycle()
+
+ return this
+ }
+
+
+ // CAROUSEL PLUGIN DEFINITION
+ // ==========================
+
+ var old = $.fn.carousel
+
+ $.fn.carousel = function (option) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.carousel')
+ var options = $.extend({}, Carousel.DEFAULTS, $this.data(), typeof option == 'object' && option)
+ var action = typeof option == 'string' ? option : options.slide
+
+ if (!data) $this.data('bs.carousel', (data = new Carousel(this, options)))
+ if (typeof option == 'number') data.to(option)
+ else if (action) data[action]()
+ else if (options.interval) data.pause().cycle()
+ })
+ }
+
+ $.fn.carousel.Constructor = Carousel
+
+
+ // CAROUSEL NO CONFLICT
+ // ====================
+
+ $.fn.carousel.noConflict = function () {
+ $.fn.carousel = old
+ return this
+ }
+
+
+ // CAROUSEL DATA-API
+ // =================
+
+ $(document).on('click.bs.carousel.data-api', '[data-slide], [data-slide-to]', function (e) {
+ var $this = $(this), href
+ var $target = $($this.attr('data-target') || (href = $this.attr('href')) && href.replace(/.*(?=#[^\s]+$)/, '')) //strip for ie7
+ var options = $.extend({}, $target.data(), $this.data())
+ var slideIndex = $this.attr('data-slide-to')
+ if (slideIndex) options.interval = false
+
+ $target.carousel(options)
+
+ if (slideIndex = $this.attr('data-slide-to')) {
+ $target.data('bs.carousel').to(slideIndex)
+ }
+
+ e.preventDefault()
+ })
+
+ $(window).on('load', function () {
+ $('[data-ride="carousel"]').each(function () {
+ var $carousel = $(this)
+ $carousel.carousel($carousel.data())
+ })
+ })
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: collapse.js v3.1.1
+ * http://getbootstrap.com/javascript/#collapse
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // COLLAPSE PUBLIC CLASS DEFINITION
+ // ================================
+
+ var Collapse = function (element, options) {
+ this.$element = $(element)
+ this.options = $.extend({}, Collapse.DEFAULTS, options)
+ this.transitioning = null
+
+ if (this.options.parent) this.$parent = $(this.options.parent)
+ if (this.options.toggle) this.toggle()
+ }
+
+ Collapse.DEFAULTS = {
+ toggle: true
+ }
+
+ Collapse.prototype.dimension = function () {
+ var hasWidth = this.$element.hasClass('width')
+ return hasWidth ? 'width' : 'height'
+ }
+
+ Collapse.prototype.show = function () {
+ if (this.transitioning || this.$element.hasClass('in')) return
+
+ var startEvent = $.Event('show.bs.collapse')
+ this.$element.trigger(startEvent)
+ if (startEvent.isDefaultPrevented()) return
+
+ var actives = this.$parent && this.$parent.find('> .panel > .in')
+
+ if (actives && actives.length) {
+ var hasData = actives.data('bs.collapse')
+ if (hasData && hasData.transitioning) return
+ actives.collapse('hide')
+ hasData || actives.data('bs.collapse', null)
+ }
+
+ var dimension = this.dimension()
+
+ this.$element
+ .removeClass('collapse')
+ .addClass('collapsing')
+ [dimension](0)
+
+ this.transitioning = 1
+
+ var complete = function () {
+ this.$element
+ .removeClass('collapsing')
+ .addClass('collapse in')
+ [dimension]('auto')
+ this.transitioning = 0
+ this.$element.trigger('shown.bs.collapse')
+ }
+
+ if (!$.support.transition) return complete.call(this)
+
+ var scrollSize = $.camelCase(['scroll', dimension].join('-'))
+
+ this.$element
+ .one($.support.transition.end, $.proxy(complete, this))
+ .emulateTransitionEnd(350)
+ [dimension](this.$element[0][scrollSize])
+ }
+
+ Collapse.prototype.hide = function () {
+ if (this.transitioning || !this.$element.hasClass('in')) return
+
+ var startEvent = $.Event('hide.bs.collapse')
+ this.$element.trigger(startEvent)
+ if (startEvent.isDefaultPrevented()) return
+
+ var dimension = this.dimension()
+
+ this.$element
+ [dimension](this.$element[dimension]())
+ [0].offsetHeight
+
+ this.$element
+ .addClass('collapsing')
+ .removeClass('collapse')
+ .removeClass('in')
+
+ this.transitioning = 1
+
+ var complete = function () {
+ this.transitioning = 0
+ this.$element
+ .trigger('hidden.bs.collapse')
+ .removeClass('collapsing')
+ .addClass('collapse')
+ }
+
+ if (!$.support.transition) return complete.call(this)
+
+ this.$element
+ [dimension](0)
+ .one($.support.transition.end, $.proxy(complete, this))
+ .emulateTransitionEnd(350)
+ }
+
+ Collapse.prototype.toggle = function () {
+ this[this.$element.hasClass('in') ? 'hide' : 'show']()
+ }
+
+
+ // COLLAPSE PLUGIN DEFINITION
+ // ==========================
+
+ var old = $.fn.collapse
+
+ $.fn.collapse = function (option) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.collapse')
+ var options = $.extend({}, Collapse.DEFAULTS, $this.data(), typeof option == 'object' && option)
+
+ if (!data && options.toggle && option == 'show') option = !option
+ if (!data) $this.data('bs.collapse', (data = new Collapse(this, options)))
+ if (typeof option == 'string') data[option]()
+ })
+ }
+
+ $.fn.collapse.Constructor = Collapse
+
+
+ // COLLAPSE NO CONFLICT
+ // ====================
+
+ $.fn.collapse.noConflict = function () {
+ $.fn.collapse = old
+ return this
+ }
+
+
+ // COLLAPSE DATA-API
+ // =================
+
+ $(document).on('click.bs.collapse.data-api', '[data-toggle=collapse]', function (e) {
+ var $this = $(this), href
+ var target = $this.attr('data-target')
+ || e.preventDefault()
+ || (href = $this.attr('href')) && href.replace(/.*(?=#[^\s]+$)/, '') //strip for ie7
+ var $target = $(target)
+ var data = $target.data('bs.collapse')
+ var option = data ? 'toggle' : $this.data()
+ var parent = $this.attr('data-parent')
+ var $parent = parent && $(parent)
+
+ if (!data || !data.transitioning) {
+ if ($parent) $parent.find('[data-toggle=collapse][data-parent="' + parent + '"]').not($this).addClass('collapsed')
+ $this[$target.hasClass('in') ? 'addClass' : 'removeClass']('collapsed')
+ }
+
+ $target.collapse(option)
+ })
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: dropdown.js v3.1.1
+ * http://getbootstrap.com/javascript/#dropdowns
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // DROPDOWN CLASS DEFINITION
+ // =========================
+
+ var backdrop = '.dropdown-backdrop'
+ var toggle = '[data-toggle=dropdown]'
+ var Dropdown = function (element) {
+ $(element).on('click.bs.dropdown', this.toggle)
+ }
+
+ Dropdown.prototype.toggle = function (e) {
+ var $this = $(this)
+
+ if ($this.is('.disabled, :disabled')) return
+
+ var $parent = getParent($this)
+ var isActive = $parent.hasClass('open')
+
+ clearMenus()
+
+ if (!isActive) {
+ if ('ontouchstart' in document.documentElement && !$parent.closest('.navbar-nav').length) {
+ // if mobile we use a backdrop because click events don't delegate
+ $('<div class="dropdown-backdrop"/>').insertAfter($(this)).on('click', clearMenus)
+ }
+
+ var relatedTarget = { relatedTarget: this }
+ $parent.trigger(e = $.Event('show.bs.dropdown', relatedTarget))
+
+ if (e.isDefaultPrevented()) return
+
+ $parent
+ .toggleClass('open')
+ .trigger('shown.bs.dropdown', relatedTarget)
+
+ $this.focus()
+ }
+
+ return false
+ }
+
+ Dropdown.prototype.keydown = function (e) {
+ if (!/(38|40|27)/.test(e.keyCode)) return
+
+ var $this = $(this)
+
+ e.preventDefault()
+ e.stopPropagation()
+
+ if ($this.is('.disabled, :disabled')) return
+
+ var $parent = getParent($this)
+ var isActive = $parent.hasClass('open')
+
+ if (!isActive || (isActive && e.keyCode == 27)) {
+ if (e.which == 27) $parent.find(toggle).focus()
+ return $this.click()
+ }
+
+ var desc = ' li:not(.divider):visible a'
+ var $items = $parent.find('[role=menu]' + desc + ', [role=listbox]' + desc)
+
+ if (!$items.length) return
+
+ var index = $items.index($items.filter(':focus'))
+
+ if (e.keyCode == 38 && index > 0) index-- // up
+ if (e.keyCode == 40 && index < $items.length - 1) index++ // down
+ if (!~index) index = 0
+
+ $items.eq(index).focus()
+ }
+
+ function clearMenus(e) {
+ $(backdrop).remove()
+ $(toggle).each(function () {
+ var $parent = getParent($(this))
+ var relatedTarget = { relatedTarget: this }
+ if (!$parent.hasClass('open')) return
+ $parent.trigger(e = $.Event('hide.bs.dropdown', relatedTarget))
+ if (e.isDefaultPrevented()) return
+ $parent.removeClass('open').trigger('hidden.bs.dropdown', relatedTarget)
+ })
+ }
+
+ function getParent($this) {
+ var selector = $this.attr('data-target')
+
+ if (!selector) {
+ selector = $this.attr('href')
+ selector = selector && /#[A-Za-z]/.test(selector) && selector.replace(/.*(?=#[^\s]*$)/, '') //strip for ie7
+ }
+
+ var $parent = selector && $(selector)
+
+ return $parent && $parent.length ? $parent : $this.parent()
+ }
+
+
+ // DROPDOWN PLUGIN DEFINITION
+ // ==========================
+
+ var old = $.fn.dropdown
+
+ $.fn.dropdown = function (option) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.dropdown')
+
+ if (!data) $this.data('bs.dropdown', (data = new Dropdown(this)))
+ if (typeof option == 'string') data[option].call($this)
+ })
+ }
+
+ $.fn.dropdown.Constructor = Dropdown
+
+
+ // DROPDOWN NO CONFLICT
+ // ====================
+
+ $.fn.dropdown.noConflict = function () {
+ $.fn.dropdown = old
+ return this
+ }
+
+
+ // APPLY TO STANDARD DROPDOWN ELEMENTS
+ // ===================================
+
+ $(document)
+ .on('click.bs.dropdown.data-api', clearMenus)
+ .on('click.bs.dropdown.data-api', '.dropdown form', function (e) { e.stopPropagation() })
+ .on('click.bs.dropdown.data-api', toggle, Dropdown.prototype.toggle)
+ .on('keydown.bs.dropdown.data-api', toggle + ', [role=menu], [role=listbox]', Dropdown.prototype.keydown)
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: modal.js v3.1.1
+ * http://getbootstrap.com/javascript/#modals
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // MODAL CLASS DEFINITION
+ // ======================
+
+ var Modal = function (element, options) {
+ this.options = options
+ this.$element = $(element)
+ this.$backdrop =
+ this.isShown = null
+
+ if (this.options.remote) {
+ this.$element
+ .find('.modal-content')
+ .load(this.options.remote, $.proxy(function () {
+ this.$element.trigger('loaded.bs.modal')
+ }, this))
+ }
+ }
+
+ Modal.DEFAULTS = {
+ backdrop: true,
+ keyboard: true,
+ show: true
+ }
+
+ Modal.prototype.toggle = function (_relatedTarget) {
+ return this[!this.isShown ? 'show' : 'hide'](_relatedTarget)
+ }
+
+ Modal.prototype.show = function (_relatedTarget) {
+ var that = this
+ var e = $.Event('show.bs.modal', { relatedTarget: _relatedTarget })
+
+ this.$element.trigger(e)
+
+ if (this.isShown || e.isDefaultPrevented()) return
+
+ this.isShown = true
+
+ this.escape()
+
+ this.$element.on('click.dismiss.bs.modal', '[data-dismiss="modal"]', $.proxy(this.hide, this))
+
+ this.backdrop(function () {
+ var transition = $.support.transition && that.$element.hasClass('fade')
+
+ if (!that.$element.parent().length) {
+ that.$element.appendTo(document.body) // don't move modals dom position
+ }
+
+ that.$element
+ .show()
+ .scrollTop(0)
+
+ if (transition) {
+ that.$element[0].offsetWidth // force reflow
+ }
+
+ that.$element
+ .addClass('in')
+ .attr('aria-hidden', false)
+
+ that.enforceFocus()
+
+ var e = $.Event('shown.bs.modal', { relatedTarget: _relatedTarget })
+
+ transition ?
+ that.$element.find('.modal-dialog') // wait for modal to slide in
+ .one($.support.transition.end, function () {
+ that.$element.focus().trigger(e)
+ })
+ .emulateTransitionEnd(300) :
+ that.$element.focus().trigger(e)
+ })
+ }
+
+ Modal.prototype.hide = function (e) {
+ if (e) e.preventDefault()
+
+ e = $.Event('hide.bs.modal')
+
+ this.$element.trigger(e)
+
+ if (!this.isShown || e.isDefaultPrevented()) return
+
+ this.isShown = false
+
+ this.escape()
+
+ $(document).off('focusin.bs.modal')
+
+ this.$element
+ .removeClass('in')
+ .attr('aria-hidden', true)
+ .off('click.dismiss.bs.modal')
+
+ $.support.transition && this.$element.hasClass('fade') ?
+ this.$element
+ .one($.support.transition.end, $.proxy(this.hideModal, this))
+ .emulateTransitionEnd(300) :
+ this.hideModal()
+ }
+
+ Modal.prototype.enforceFocus = function () {
+ $(document)
+ .off('focusin.bs.modal') // guard against infinite focus loop
+ .on('focusin.bs.modal', $.proxy(function (e) {
+ if (this.$element[0] !== e.target && !this.$element.has(e.target).length) {
+ this.$element.focus()
+ }
+ }, this))
+ }
+
+ Modal.prototype.escape = function () {
+ if (this.isShown && this.options.keyboard) {
+ this.$element.on('keyup.dismiss.bs.modal', $.proxy(function (e) {
+ e.which == 27 && this.hide()
+ }, this))
+ } else if (!this.isShown) {
+ this.$element.off('keyup.dismiss.bs.modal')
+ }
+ }
+
+ Modal.prototype.hideModal = function () {
+ var that = this
+ this.$element.hide()
+ this.backdrop(function () {
+ that.removeBackdrop()
+ that.$element.trigger('hidden.bs.modal')
+ })
+ }
+
+ Modal.prototype.removeBackdrop = function () {
+ this.$backdrop && this.$backdrop.remove()
+ this.$backdrop = null
+ }
+
+ Modal.prototype.backdrop = function (callback) {
+ var animate = this.$element.hasClass('fade') ? 'fade' : ''
+
+ if (this.isShown && this.options.backdrop) {
+ var doAnimate = $.support.transition && animate
+
+ this.$backdrop = $('<div class="modal-backdrop ' + animate + '" />')
+ .appendTo(document.body)
+
+ this.$element.on('click.dismiss.bs.modal', $.proxy(function (e) {
+ if (e.target !== e.currentTarget) return
+ this.options.backdrop == 'static'
+ ? this.$element[0].focus.call(this.$element[0])
+ : this.hide.call(this)
+ }, this))
+
+ if (doAnimate) this.$backdrop[0].offsetWidth // force reflow
+
+ this.$backdrop.addClass('in')
+
+ if (!callback) return
+
+ doAnimate ?
+ this.$backdrop
+ .one($.support.transition.end, callback)
+ .emulateTransitionEnd(150) :
+ callback()
+
+ } else if (!this.isShown && this.$backdrop) {
+ this.$backdrop.removeClass('in')
+
+ $.support.transition && this.$element.hasClass('fade') ?
+ this.$backdrop
+ .one($.support.transition.end, callback)
+ .emulateTransitionEnd(150) :
+ callback()
+
+ } else if (callback) {
+ callback()
+ }
+ }
+
+
+ // MODAL PLUGIN DEFINITION
+ // =======================
+
+ var old = $.fn.modal
+
+ $.fn.modal = function (option, _relatedTarget) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.modal')
+ var options = $.extend({}, Modal.DEFAULTS, $this.data(), typeof option == 'object' && option)
+
+ if (!data) $this.data('bs.modal', (data = new Modal(this, options)))
+ if (typeof option == 'string') data[option](_relatedTarget)
+ else if (options.show) data.show(_relatedTarget)
+ })
+ }
+
+ $.fn.modal.Constructor = Modal
+
+
+ // MODAL NO CONFLICT
+ // =================
+
+ $.fn.modal.noConflict = function () {
+ $.fn.modal = old
+ return this
+ }
+
+
+ // MODAL DATA-API
+ // ==============
+
+ $(document).on('click.bs.modal.data-api', '[data-toggle="modal"]', function (e) {
+ var $this = $(this)
+ var href = $this.attr('href')
+ var $target = $($this.attr('data-target') || (href && href.replace(/.*(?=#[^\s]+$)/, ''))) //strip for ie7
+ var option = $target.data('bs.modal') ? 'toggle' : $.extend({ remote: !/#/.test(href) && href }, $target.data(), $this.data())
+
+ if ($this.is('a')) e.preventDefault()
+
+ $target
+ .modal(option, this)
+ .one('hide', function () {
+ $this.is(':visible') && $this.focus()
+ })
+ })
+
+ $(document)
+ .on('show.bs.modal', '.modal', function () { $(document.body).addClass('modal-open') })
+ .on('hidden.bs.modal', '.modal', function () { $(document.body).removeClass('modal-open') })
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: tooltip.js v3.1.1
+ * http://getbootstrap.com/javascript/#tooltip
+ * Inspired by the original jQuery.tipsy by Jason Frame
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // TOOLTIP PUBLIC CLASS DEFINITION
+ // ===============================
+
+ var Tooltip = function (element, options) {
+ this.type =
+ this.options =
+ this.enabled =
+ this.timeout =
+ this.hoverState =
+ this.$element = null
+
+ this.init('tooltip', element, options)
+ }
+
+ Tooltip.DEFAULTS = {
+ animation: true,
+ placement: 'top',
+ selector: false,
+ template: '<div class="tooltip"><div class="tooltip-arrow"></div><div class="tooltip-inner"></div></div>',
+ trigger: 'hover focus',
+ title: '',
+ delay: 0,
+ html: false,
+ container: false
+ }
+
+ Tooltip.prototype.init = function (type, element, options) {
+ this.enabled = true
+ this.type = type
+ this.$element = $(element)
+ this.options = this.getOptions(options)
+
+ var triggers = this.options.trigger.split(' ')
+
+ for (var i = triggers.length; i--;) {
+ var trigger = triggers[i]
+
+ if (trigger == 'click') {
+ this.$element.on('click.' + this.type, this.options.selector, $.proxy(this.toggle, this))
+ } else if (trigger != 'manual') {
+ var eventIn = trigger == 'hover' ? 'mouseenter' : 'focusin'
+ var eventOut = trigger == 'hover' ? 'mouseleave' : 'focusout'
+
+ this.$element.on(eventIn + '.' + this.type, this.options.selector, $.proxy(this.enter, this))
+ this.$element.on(eventOut + '.' + this.type, this.options.selector, $.proxy(this.leave, this))
+ }
+ }
+
+ this.options.selector ?
+ (this._options = $.extend({}, this.options, { trigger: 'manual', selector: '' })) :
+ this.fixTitle()
+ }
+
+ Tooltip.prototype.getDefaults = function () {
+ return Tooltip.DEFAULTS
+ }
+
+ Tooltip.prototype.getOptions = function (options) {
+ options = $.extend({}, this.getDefaults(), this.$element.data(), options)
+
+ if (options.delay && typeof options.delay == 'number') {
+ options.delay = {
+ show: options.delay,
+ hide: options.delay
+ }
+ }
+
+ return options
+ }
+
+ Tooltip.prototype.getDelegateOptions = function () {
+ var options = {}
+ var defaults = this.getDefaults()
+
+ this._options && $.each(this._options, function (key, value) {
+ if (defaults[key] != value) options[key] = value
+ })
+
+ return options
+ }
+
+ Tooltip.prototype.enter = function (obj) {
+ var self = obj instanceof this.constructor ?
+ obj : $(obj.currentTarget)[this.type](this.getDelegateOptions()).data('bs.' + this.type)
+
+ clearTimeout(self.timeout)
+
+ self.hoverState = 'in'
+
+ if (!self.options.delay || !self.options.delay.show) return self.show()
+
+ self.timeout = setTimeout(function () {
+ if (self.hoverState == 'in') self.show()
+ }, self.options.delay.show)
+ }
+
+ Tooltip.prototype.leave = function (obj) {
+ var self = obj instanceof this.constructor ?
+ obj : $(obj.currentTarget)[this.type](this.getDelegateOptions()).data('bs.' + this.type)
+
+ clearTimeout(self.timeout)
+
+ self.hoverState = 'out'
+
+ if (!self.options.delay || !self.options.delay.hide) return self.hide()
+
+ self.timeout = setTimeout(function () {
+ if (self.hoverState == 'out') self.hide()
+ }, self.options.delay.hide)
+ }
+
+ Tooltip.prototype.show = function () {
+ var e = $.Event('show.bs.' + this.type)
+
+ if (this.hasContent() && this.enabled) {
+ this.$element.trigger(e)
+
+ if (e.isDefaultPrevented()) return
+ var that = this;
+
+ var $tip = this.tip()
+
+ this.setContent()
+
+ if (this.options.animation) $tip.addClass('fade')
+
+ var placement = typeof this.options.placement == 'function' ?
+ this.options.placement.call(this, $tip[0], this.$element[0]) :
+ this.options.placement
+
+ var autoToken = /\s?auto?\s?/i
+ var autoPlace = autoToken.test(placement)
+ if (autoPlace) placement = placement.replace(autoToken, '') || 'top'
+
+ $tip
+ .detach()
+ .css({ top: 0, left: 0, display: 'block' })
+ .addClass(placement)
+
+ this.options.container ? $tip.appendTo(this.options.container) : $tip.insertAfter(this.$element)
+
+ var pos = this.getPosition()
+ var actualWidth = $tip[0].offsetWidth
+ var actualHeight = $tip[0].offsetHeight
+
+ if (autoPlace) {
+ var $parent = this.$element.parent()
+
+ var orgPlacement = placement
+ var docScroll = document.documentElement.scrollTop || document.body.scrollTop
+ var parentWidth = this.options.container == 'body' ? window.innerWidth : $parent.outerWidth()
+ var parentHeight = this.options.container == 'body' ? window.innerHeight : $parent.outerHeight()
+ var parentLeft = this.options.container == 'body' ? 0 : $parent.offset().left
+
+ placement = placement == 'bottom' && pos.top + pos.height + actualHeight - docScroll > parentHeight ? 'top' :
+ placement == 'top' && pos.top - docScroll - actualHeight < 0 ? 'bottom' :
+ placement == 'right' && pos.right + actualWidth > parentWidth ? 'left' :
+ placement == 'left' && pos.left - actualWidth < parentLeft ? 'right' :
+ placement
+
+ $tip
+ .removeClass(orgPlacement)
+ .addClass(placement)
+ }
+
+ var calculatedOffset = this.getCalculatedOffset(placement, pos, actualWidth, actualHeight)
+
+ this.applyPlacement(calculatedOffset, placement)
+ this.hoverState = null
+
+ var complete = function() {
+ that.$element.trigger('shown.bs.' + that.type)
+ }
+
+ $.support.transition && this.$tip.hasClass('fade') ?
+ $tip
+ .one($.support.transition.end, complete)
+ .emulateTransitionEnd(150) :
+ complete()
+ }
+ }
+
+ Tooltip.prototype.applyPlacement = function (offset, placement) {
+ var replace
+ var $tip = this.tip()
+ var width = $tip[0].offsetWidth
+ var height = $tip[0].offsetHeight
+
+ // manually read margins because getBoundingClientRect includes difference
+ var marginTop = parseInt($tip.css('margin-top'), 10)
+ var marginLeft = parseInt($tip.css('margin-left'), 10)
+
+ // we must check for NaN for ie 8/9
+ if (isNaN(marginTop)) marginTop = 0
+ if (isNaN(marginLeft)) marginLeft = 0
+
+ offset.top = offset.top + marginTop
+ offset.left = offset.left + marginLeft
+
+ // $.fn.offset doesn't round pixel values
+ // so we use setOffset directly with our own function B-0
+ $.offset.setOffset($tip[0], $.extend({
+ using: function (props) {
+ $tip.css({
+ top: Math.round(props.top),
+ left: Math.round(props.left)
+ })
+ }
+ }, offset), 0)
+
+ $tip.addClass('in')
+
+ // check to see if placing tip in new offset caused the tip to resize itself
+ var actualWidth = $tip[0].offsetWidth
+ var actualHeight = $tip[0].offsetHeight
+
+ if (placement == 'top' && actualHeight != height) {
+ replace = true
+ offset.top = offset.top + height - actualHeight
+ }
+
+ if (/bottom|top/.test(placement)) {
+ var delta = 0
+
+ if (offset.left < 0) {
+ delta = offset.left * -2
+ offset.left = 0
+
+ $tip.offset(offset)
+
+ actualWidth = $tip[0].offsetWidth
+ actualHeight = $tip[0].offsetHeight
+ }
+
+ this.replaceArrow(delta - width + actualWidth, actualWidth, 'left')
+ } else {
+ this.replaceArrow(actualHeight - height, actualHeight, 'top')
+ }
+
+ if (replace) $tip.offset(offset)
+ }
+
+ Tooltip.prototype.replaceArrow = function (delta, dimension, position) {
+ this.arrow().css(position, delta ? (50 * (1 - delta / dimension) + '%') : '')
+ }
+
+ Tooltip.prototype.setContent = function () {
+ var $tip = this.tip()
+ var title = this.getTitle()
+
+ $tip.find('.tooltip-inner')[this.options.html ? 'html' : 'text'](title)
+ $tip.removeClass('fade in top bottom left right')
+ }
+
+ Tooltip.prototype.hide = function () {
+ var that = this
+ var $tip = this.tip()
+ var e = $.Event('hide.bs.' + this.type)
+
+ function complete() {
+ if (that.hoverState != 'in') $tip.detach()
+ that.$element.trigger('hidden.bs.' + that.type)
+ }
+
+ this.$element.trigger(e)
+
+ if (e.isDefaultPrevented()) return
+
+ $tip.removeClass('in')
+
+ $.support.transition && this.$tip.hasClass('fade') ?
+ $tip
+ .one($.support.transition.end, complete)
+ .emulateTransitionEnd(150) :
+ complete()
+
+ this.hoverState = null
+
+ return this
+ }
+
+ Tooltip.prototype.fixTitle = function () {
+ var $e = this.$element
+ if ($e.attr('title') || typeof($e.attr('data-original-title')) != 'string') {
+ $e.attr('data-original-title', $e.attr('title') || '').attr('title', '')
+ }
+ }
+
+ Tooltip.prototype.hasContent = function () {
+ return this.getTitle()
+ }
+
+ Tooltip.prototype.getPosition = function () {
+ var el = this.$element[0]
+ return $.extend({}, (typeof el.getBoundingClientRect == 'function') ? el.getBoundingClientRect() : {
+ width: el.offsetWidth,
+ height: el.offsetHeight
+ }, this.$element.offset())
+ }
+
+ Tooltip.prototype.getCalculatedOffset = function (placement, pos, actualWidth, actualHeight) {
+ return placement == 'bottom' ? { top: pos.top + pos.height, left: pos.left + pos.width / 2 - actualWidth / 2 } :
+ placement == 'top' ? { top: pos.top - actualHeight, left: pos.left + pos.width / 2 - actualWidth / 2 } :
+ placement == 'left' ? { top: pos.top + pos.height / 2 - actualHeight / 2, left: pos.left - actualWidth } :
+ /* placement == 'right' */ { top: pos.top + pos.height / 2 - actualHeight / 2, left: pos.left + pos.width }
+ }
+
+ Tooltip.prototype.getTitle = function () {
+ var title
+ var $e = this.$element
+ var o = this.options
+
+ title = $e.attr('data-original-title')
+ || (typeof o.title == 'function' ? o.title.call($e[0]) : o.title)
+
+ return title
+ }
+
+ Tooltip.prototype.tip = function () {
+ return this.$tip = this.$tip || $(this.options.template)
+ }
+
+ Tooltip.prototype.arrow = function () {
+ return this.$arrow = this.$arrow || this.tip().find('.tooltip-arrow')
+ }
+
+ Tooltip.prototype.validate = function () {
+ if (!this.$element[0].parentNode) {
+ this.hide()
+ this.$element = null
+ this.options = null
+ }
+ }
+
+ Tooltip.prototype.enable = function () {
+ this.enabled = true
+ }
+
+ Tooltip.prototype.disable = function () {
+ this.enabled = false
+ }
+
+ Tooltip.prototype.toggleEnabled = function () {
+ this.enabled = !this.enabled
+ }
+
+ Tooltip.prototype.toggle = function (e) {
+ var self = e ? $(e.currentTarget)[this.type](this.getDelegateOptions()).data('bs.' + this.type) : this
+ self.tip().hasClass('in') ? self.leave(self) : self.enter(self)
+ }
+
+ Tooltip.prototype.destroy = function () {
+ clearTimeout(this.timeout)
+ this.hide().$element.off('.' + this.type).removeData('bs.' + this.type)
+ }
+
+
+ // TOOLTIP PLUGIN DEFINITION
+ // =========================
+
+ var old = $.fn.tooltip
+
+ $.fn.tooltip = function (option) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.tooltip')
+ var options = typeof option == 'object' && option
+
+ if (!data && option == 'destroy') return
+ if (!data) $this.data('bs.tooltip', (data = new Tooltip(this, options)))
+ if (typeof option == 'string') data[option]()
+ })
+ }
+
+ $.fn.tooltip.Constructor = Tooltip
+
+
+ // TOOLTIP NO CONFLICT
+ // ===================
+
+ $.fn.tooltip.noConflict = function () {
+ $.fn.tooltip = old
+ return this
+ }
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: popover.js v3.1.1
+ * http://getbootstrap.com/javascript/#popovers
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // POPOVER PUBLIC CLASS DEFINITION
+ // ===============================
+
+ var Popover = function (element, options) {
+ this.init('popover', element, options)
+ }
+
+ if (!$.fn.tooltip) throw new Error('Popover requires tooltip.js')
+
+ Popover.DEFAULTS = $.extend({}, $.fn.tooltip.Constructor.DEFAULTS, {
+ placement: 'right',
+ trigger: 'click',
+ content: '',
+ template: '<div class="popover"><div class="arrow"></div><h3 class="popover-title"></h3><div class="popover-content"></div></div>'
+ })
+
+
+ // NOTE: POPOVER EXTENDS tooltip.js
+ // ================================
+
+ Popover.prototype = $.extend({}, $.fn.tooltip.Constructor.prototype)
+
+ Popover.prototype.constructor = Popover
+
+ Popover.prototype.getDefaults = function () {
+ return Popover.DEFAULTS
+ }
+
+ Popover.prototype.setContent = function () {
+ var $tip = this.tip()
+ var title = this.getTitle()
+ var content = this.getContent()
+
+ $tip.find('.popover-title')[this.options.html ? 'html' : 'text'](title)
+ $tip.find('.popover-content')[ // we use append for html objects to maintain js events
+ this.options.html ? (typeof content == 'string' ? 'html' : 'append') : 'text'
+ ](content)
+
+ $tip.removeClass('fade top bottom left right in')
+
+ // IE8 doesn't accept hiding via the `:empty` pseudo selector, we have to do
+ // this manually by checking the contents.
+ if (!$tip.find('.popover-title').html()) $tip.find('.popover-title').hide()
+ }
+
+ Popover.prototype.hasContent = function () {
+ return this.getTitle() || this.getContent()
+ }
+
+ Popover.prototype.getContent = function () {
+ var $e = this.$element
+ var o = this.options
+
+ return $e.attr('data-content')
+ || (typeof o.content == 'function' ?
+ o.content.call($e[0]) :
+ o.content)
+ }
+
+ Popover.prototype.arrow = function () {
+ return this.$arrow = this.$arrow || this.tip().find('.arrow')
+ }
+
+ Popover.prototype.tip = function () {
+ if (!this.$tip) this.$tip = $(this.options.template)
+ return this.$tip
+ }
+
+
+ // POPOVER PLUGIN DEFINITION
+ // =========================
+
+ var old = $.fn.popover
+
+ $.fn.popover = function (option) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.popover')
+ var options = typeof option == 'object' && option
+
+ if (!data && option == 'destroy') return
+ if (!data) $this.data('bs.popover', (data = new Popover(this, options)))
+ if (typeof option == 'string') data[option]()
+ })
+ }
+
+ $.fn.popover.Constructor = Popover
+
+
+ // POPOVER NO CONFLICT
+ // ===================
+
+ $.fn.popover.noConflict = function () {
+ $.fn.popover = old
+ return this
+ }
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: scrollspy.js v3.1.1
+ * http://getbootstrap.com/javascript/#scrollspy
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // SCROLLSPY CLASS DEFINITION
+ // ==========================
+
+ function ScrollSpy(element, options) {
+ var href
+ var process = $.proxy(this.process, this)
+
+ this.$element = $(element).is('body') ? $(window) : $(element)
+ this.$body = $('body')
+ this.$scrollElement = this.$element.on('scroll.bs.scroll-spy.data-api', process)
+ this.options = $.extend({}, ScrollSpy.DEFAULTS, options)
+ this.selector = (this.options.target
+ || ((href = $(element).attr('href')) && href.replace(/.*(?=#[^\s]+$)/, '')) //strip for ie7
+ || '') + ' .nav li > a'
+ this.offsets = $([])
+ this.targets = $([])
+ this.activeTarget = null
+
+ this.refresh()
+ this.process()
+ }
+
+ ScrollSpy.DEFAULTS = {
+ offset: 10
+ }
+
+ ScrollSpy.prototype.refresh = function () {
+ var offsetMethod = this.$element[0] == window ? 'offset' : 'position'
+
+ this.offsets = $([])
+ this.targets = $([])
+
+ var self = this
+ var $targets = this.$body
+ .find(this.selector)
+ .map(function () {
+ var $el = $(this)
+ var href = $el.data('target') || $el.attr('href')
+ var $href = /^#./.test(href) && $(href)
+
+ return ($href
+ && $href.length
+ && $href.is(':visible')
+ && [[ $href[offsetMethod]().top + (!$.isWindow(self.$scrollElement.get(0)) && self.$scrollElement.scrollTop()), href ]]) || null
+ })
+ .sort(function (a, b) { return a[0] - b[0] })
+ .each(function () {
+ self.offsets.push(this[0])
+ self.targets.push(this[1])
+ })
+ }
+
+ ScrollSpy.prototype.process = function () {
+ var scrollTop = this.$scrollElement.scrollTop() + this.options.offset
+ var scrollHeight = this.$scrollElement[0].scrollHeight || this.$body[0].scrollHeight
+ var maxScroll = scrollHeight - this.$scrollElement.height()
+ var offsets = this.offsets
+ var targets = this.targets
+ var activeTarget = this.activeTarget
+ var i
+
+ if (scrollTop >= maxScroll) {
+ return activeTarget != (i = targets.last()[0]) && this.activate(i)
+ }
+
+ if (activeTarget && scrollTop <= offsets[0]) {
+ return activeTarget != (i = targets[0]) && this.activate(i)
+ }
+
+ for (i = offsets.length; i--;) {
+ activeTarget != targets[i]
+ && scrollTop >= offsets[i]
+ && (!offsets[i + 1] || scrollTop <= offsets[i + 1])
+ && this.activate( targets[i] )
+ }
+ }
+
+ ScrollSpy.prototype.activate = function (target) {
+ this.activeTarget = target
+
+ $(this.selector)
+ .parentsUntil(this.options.target, '.active')
+ .removeClass('active')
+
+ var selector = this.selector +
+ '[data-target="' + target + '"],' +
+ this.selector + '[href="' + target + '"]'
+
+ var active = $(selector)
+ .parents('li')
+ .addClass('active')
+
+ if (active.parent('.dropdown-menu').length) {
+ active = active
+ .closest('li.dropdown')
+ .addClass('active')
+ }
+
+ active.trigger('activate.bs.scrollspy')
+ }
+
+
+ // SCROLLSPY PLUGIN DEFINITION
+ // ===========================
+
+ var old = $.fn.scrollspy
+
+ $.fn.scrollspy = function (option) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.scrollspy')
+ var options = typeof option == 'object' && option
+
+ if (!data) $this.data('bs.scrollspy', (data = new ScrollSpy(this, options)))
+ if (typeof option == 'string') data[option]()
+ })
+ }
+
+ $.fn.scrollspy.Constructor = ScrollSpy
+
+
+ // SCROLLSPY NO CONFLICT
+ // =====================
+
+ $.fn.scrollspy.noConflict = function () {
+ $.fn.scrollspy = old
+ return this
+ }
+
+
+ // SCROLLSPY DATA-API
+ // ==================
+
+ $(window).on('load', function () {
+ $('[data-spy="scroll"]').each(function () {
+ var $spy = $(this)
+ $spy.scrollspy($spy.data())
+ })
+ })
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: tab.js v3.1.1
+ * http://getbootstrap.com/javascript/#tabs
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // TAB CLASS DEFINITION
+ // ====================
+
+ var Tab = function (element) {
+ this.element = $(element)
+ }
+
+ Tab.prototype.show = function () {
+ var $this = this.element
+ var $ul = $this.closest('ul:not(.dropdown-menu)')
+ var selector = $this.data('target')
+
+ if (!selector) {
+ selector = $this.attr('href')
+ selector = selector && selector.replace(/.*(?=#[^\s]*$)/, '') //strip for ie7
+ }
+
+ if ($this.parent('li').hasClass('active')) return
+
+ var previous = $ul.find('.active:last a')[0]
+ var e = $.Event('show.bs.tab', {
+ relatedTarget: previous
+ })
+
+ $this.trigger(e)
+
+ if (e.isDefaultPrevented()) return
+
+ var $target = $(selector)
+
+ this.activate($this.parent('li'), $ul)
+ this.activate($target, $target.parent(), function () {
+ $this.trigger({
+ type: 'shown.bs.tab',
+ relatedTarget: previous
+ })
+ })
+ }
+
+ Tab.prototype.activate = function (element, container, callback) {
+ var $active = container.find('> .active')
+ var transition = callback
+ && $.support.transition
+ && $active.hasClass('fade')
+
+ function next() {
+ $active
+ .removeClass('active')
+ .find('> .dropdown-menu > .active')
+ .removeClass('active')
+
+ element.addClass('active')
+
+ if (transition) {
+ element[0].offsetWidth // reflow for transition
+ element.addClass('in')
+ } else {
+ element.removeClass('fade')
+ }
+
+ if (element.parent('.dropdown-menu')) {
+ element.closest('li.dropdown').addClass('active')
+ }
+
+ callback && callback()
+ }
+
+ transition ?
+ $active
+ .one($.support.transition.end, next)
+ .emulateTransitionEnd(150) :
+ next()
+
+ $active.removeClass('in')
+ }
+
+
+ // TAB PLUGIN DEFINITION
+ // =====================
+
+ var old = $.fn.tab
+
+ $.fn.tab = function ( option ) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.tab')
+
+ if (!data) $this.data('bs.tab', (data = new Tab(this)))
+ if (typeof option == 'string') data[option]()
+ })
+ }
+
+ $.fn.tab.Constructor = Tab
+
+
+ // TAB NO CONFLICT
+ // ===============
+
+ $.fn.tab.noConflict = function () {
+ $.fn.tab = old
+ return this
+ }
+
+
+ // TAB DATA-API
+ // ============
+
+ $(document).on('click.bs.tab.data-api', '[data-toggle="tab"], [data-toggle="pill"]', function (e) {
+ e.preventDefault()
+ $(this).tab('show')
+ })
+
+}(jQuery);
+
+/* ========================================================================
+ * Bootstrap: affix.js v3.1.1
+ * http://getbootstrap.com/javascript/#affix
+ * ========================================================================
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ * ======================================================================== */
+
+
++function ($) {
+ 'use strict';
+
+ // AFFIX CLASS DEFINITION
+ // ======================
+
+ var Affix = function (element, options) {
+ this.options = $.extend({}, Affix.DEFAULTS, options)
+ this.$window = $(window)
+ .on('scroll.bs.affix.data-api', $.proxy(this.checkPosition, this))
+ .on('click.bs.affix.data-api', $.proxy(this.checkPositionWithEventLoop, this))
+
+ this.$element = $(element)
+ this.affixed =
+ this.unpin =
+ this.pinnedOffset = null
+
+ this.checkPosition()
+ }
+
+ Affix.RESET = 'affix affix-top affix-bottom'
+
+ Affix.DEFAULTS = {
+ offset: 0
+ }
+
+ Affix.prototype.getPinnedOffset = function () {
+ if (this.pinnedOffset) return this.pinnedOffset
+ this.$element.removeClass(Affix.RESET).addClass('affix')
+ var scrollTop = this.$window.scrollTop()
+ var position = this.$element.offset()
+ return (this.pinnedOffset = position.top - scrollTop)
+ }
+
+ Affix.prototype.checkPositionWithEventLoop = function () {
+ setTimeout($.proxy(this.checkPosition, this), 1)
+ }
+
+ Affix.prototype.checkPosition = function () {
+ if (!this.$element.is(':visible')) return
+
+ var scrollHeight = $(document).height()
+ var scrollTop = this.$window.scrollTop()
+ var position = this.$element.offset()
+ var offset = this.options.offset
+ var offsetTop = offset.top
+ var offsetBottom = offset.bottom
+
+ if (this.affixed == 'top') position.top += scrollTop
+
+ if (typeof offset != 'object') offsetBottom = offsetTop = offset
+ if (typeof offsetTop == 'function') offsetTop = offset.top(this.$element)
+ if (typeof offsetBottom == 'function') offsetBottom = offset.bottom(this.$element)
+
+ var affix = this.unpin != null && (scrollTop + this.unpin <= position.top) ? false :
+ offsetBottom != null && (position.top + this.$element.height() >= scrollHeight - offsetBottom) ? 'bottom' :
+ offsetTop != null && (scrollTop <= offsetTop) ? 'top' : false
+
+ if (this.affixed === affix) return
+ if (this.unpin) this.$element.css('top', '')
+
+ var affixType = 'affix' + (affix ? '-' + affix : '')
+ var e = $.Event(affixType + '.bs.affix')
+
+ this.$element.trigger(e)
+
+ if (e.isDefaultPrevented()) return
+
+ this.affixed = affix
+ this.unpin = affix == 'bottom' ? this.getPinnedOffset() : null
+
+ this.$element
+ .removeClass(Affix.RESET)
+ .addClass(affixType)
+ .trigger($.Event(affixType.replace('affix', 'affixed')))
+
+ if (affix == 'bottom') {
+ this.$element.offset({ top: scrollHeight - offsetBottom - this.$element.height() })
+ }
+ }
+
+
+ // AFFIX PLUGIN DEFINITION
+ // =======================
+
+ var old = $.fn.affix
+
+ $.fn.affix = function (option) {
+ return this.each(function () {
+ var $this = $(this)
+ var data = $this.data('bs.affix')
+ var options = typeof option == 'object' && option
+
+ if (!data) $this.data('bs.affix', (data = new Affix(this, options)))
+ if (typeof option == 'string') data[option]()
+ })
+ }
+
+ $.fn.affix.Constructor = Affix
+
+
+ // AFFIX NO CONFLICT
+ // =================
+
+ $.fn.affix.noConflict = function () {
+ $.fn.affix = old
+ return this
+ }
+
+
+ // AFFIX DATA-API
+ // ==============
+
+ $(window).on('load', function () {
+ $('[data-spy="affix"]').each(function () {
+ var $spy = $(this)
+ var data = $spy.data()
+
+ data.offset = data.offset || {}
+
+ if (data.offsetBottom) data.offset.bottom = data.offsetBottom
+ if (data.offsetTop) data.offset.top = data.offsetTop
+
+ $spy.affix(data)
+ })
+ })
+
+}(jQuery);
diff --git a/mutalyzer/website/templates/static/js/bootstrap.min.js b/mutalyzer/website/templates/static/js/bootstrap.min.js
new file mode 100644
index 0000000000000000000000000000000000000000..b04a0e82fffee109e8cd5e48b3f3aa2a9b2aceff
--- /dev/null
+++ b/mutalyzer/website/templates/static/js/bootstrap.min.js
@@ -0,0 +1,6 @@
+/*!
+ * Bootstrap v3.1.1 (http://getbootstrap.com)
+ * Copyright 2011-2014 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ */
+if("undefined"==typeof jQuery)throw new Error("Bootstrap's JavaScript requires jQuery");+function(a){"use strict";function b(){var a=document.createElement("bootstrap"),b={WebkitTransition:"webkitTransitionEnd",MozTransition:"transitionend",OTransition:"oTransitionEnd otransitionend",transition:"transitionend"};for(var c in b)if(void 0!==a.style[c])return{end:b[c]};return!1}a.fn.emulateTransitionEnd=function(b){var c=!1,d=this;a(this).one(a.support.transition.end,function(){c=!0});var e=function(){c||a(d).trigger(a.support.transition.end)};return setTimeout(e,b),this},a(function(){a.support.transition=b()})}(jQuery),+function(a){"use strict";var b='[data-dismiss="alert"]',c=function(c){a(c).on("click",b,this.close)};c.prototype.close=function(b){function c(){f.trigger("closed.bs.alert").remove()}var d=a(this),e=d.attr("data-target");e||(e=d.attr("href"),e=e&&e.replace(/.*(?=#[^\s]*$)/,""));var f=a(e);b&&b.preventDefault(),f.length||(f=d.hasClass("alert")?d:d.parent()),f.trigger(b=a.Event("close.bs.alert")),b.isDefaultPrevented()||(f.removeClass("in"),a.support.transition&&f.hasClass("fade")?f.one(a.support.transition.end,c).emulateTransitionEnd(150):c())};var d=a.fn.alert;a.fn.alert=function(b){return this.each(function(){var d=a(this),e=d.data("bs.alert");e||d.data("bs.alert",e=new c(this)),"string"==typeof b&&e[b].call(d)})},a.fn.alert.Constructor=c,a.fn.alert.noConflict=function(){return a.fn.alert=d,this},a(document).on("click.bs.alert.data-api",b,c.prototype.close)}(jQuery),+function(a){"use strict";var b=function(c,d){this.$element=a(c),this.options=a.extend({},b.DEFAULTS,d),this.isLoading=!1};b.DEFAULTS={loadingText:"loading..."},b.prototype.setState=function(b){var c="disabled",d=this.$element,e=d.is("input")?"val":"html",f=d.data();b+="Text",f.resetText||d.data("resetText",d[e]()),d[e](f[b]||this.options[b]),setTimeout(a.proxy(function(){"loadingText"==b?(this.isLoading=!0,d.addClass(c).attr(c,c)):this.isLoading&&(this.isLoading=!1,d.removeClass(c).removeAttr(c))},this),0)},b.prototype.toggle=function(){var a=!0,b=this.$element.closest('[data-toggle="buttons"]');if(b.length){var c=this.$element.find("input");"radio"==c.prop("type")&&(c.prop("checked")&&this.$element.hasClass("active")?a=!1:b.find(".active").removeClass("active")),a&&c.prop("checked",!this.$element.hasClass("active")).trigger("change")}a&&this.$element.toggleClass("active")};var c=a.fn.button;a.fn.button=function(c){return this.each(function(){var d=a(this),e=d.data("bs.button"),f="object"==typeof c&&c;e||d.data("bs.button",e=new b(this,f)),"toggle"==c?e.toggle():c&&e.setState(c)})},a.fn.button.Constructor=b,a.fn.button.noConflict=function(){return a.fn.button=c,this},a(document).on("click.bs.button.data-api","[data-toggle^=button]",function(b){var c=a(b.target);c.hasClass("btn")||(c=c.closest(".btn")),c.button("toggle"),b.preventDefault()})}(jQuery),+function(a){"use strict";var b=function(b,c){this.$element=a(b),this.$indicators=this.$element.find(".carousel-indicators"),this.options=c,this.paused=this.sliding=this.interval=this.$active=this.$items=null,"hover"==this.options.pause&&this.$element.on("mouseenter",a.proxy(this.pause,this)).on("mouseleave",a.proxy(this.cycle,this))};b.DEFAULTS={interval:5e3,pause:"hover",wrap:!0},b.prototype.cycle=function(b){return b||(this.paused=!1),this.interval&&clearInterval(this.interval),this.options.interval&&!this.paused&&(this.interval=setInterval(a.proxy(this.next,this),this.options.interval)),this},b.prototype.getActiveIndex=function(){return this.$active=this.$element.find(".item.active"),this.$items=this.$active.parent().children(),this.$items.index(this.$active)},b.prototype.to=function(b){var c=this,d=this.getActiveIndex();return b>this.$items.length-1||0>b?void 0:this.sliding?this.$element.one("slid.bs.carousel",function(){c.to(b)}):d==b?this.pause().cycle():this.slide(b>d?"next":"prev",a(this.$items[b]))},b.prototype.pause=function(b){return b||(this.paused=!0),this.$element.find(".next, .prev").length&&a.support.transition&&(this.$element.trigger(a.support.transition.end),this.cycle(!0)),this.interval=clearInterval(this.interval),this},b.prototype.next=function(){return this.sliding?void 0:this.slide("next")},b.prototype.prev=function(){return this.sliding?void 0:this.slide("prev")},b.prototype.slide=function(b,c){var d=this.$element.find(".item.active"),e=c||d[b](),f=this.interval,g="next"==b?"left":"right",h="next"==b?"first":"last",i=this;if(!e.length){if(!this.options.wrap)return;e=this.$element.find(".item")[h]()}if(e.hasClass("active"))return this.sliding=!1;var j=a.Event("slide.bs.carousel",{relatedTarget:e[0],direction:g});return this.$element.trigger(j),j.isDefaultPrevented()?void 0:(this.sliding=!0,f&&this.pause(),this.$indicators.length&&(this.$indicators.find(".active").removeClass("active"),this.$element.one("slid.bs.carousel",function(){var b=a(i.$indicators.children()[i.getActiveIndex()]);b&&b.addClass("active")})),a.support.transition&&this.$element.hasClass("slide")?(e.addClass(b),e[0].offsetWidth,d.addClass(g),e.addClass(g),d.one(a.support.transition.end,function(){e.removeClass([b,g].join(" ")).addClass("active"),d.removeClass(["active",g].join(" ")),i.sliding=!1,setTimeout(function(){i.$element.trigger("slid.bs.carousel")},0)}).emulateTransitionEnd(1e3*d.css("transition-duration").slice(0,-1))):(d.removeClass("active"),e.addClass("active"),this.sliding=!1,this.$element.trigger("slid.bs.carousel")),f&&this.cycle(),this)};var c=a.fn.carousel;a.fn.carousel=function(c){return this.each(function(){var d=a(this),e=d.data("bs.carousel"),f=a.extend({},b.DEFAULTS,d.data(),"object"==typeof c&&c),g="string"==typeof c?c:f.slide;e||d.data("bs.carousel",e=new b(this,f)),"number"==typeof c?e.to(c):g?e[g]():f.interval&&e.pause().cycle()})},a.fn.carousel.Constructor=b,a.fn.carousel.noConflict=function(){return a.fn.carousel=c,this},a(document).on("click.bs.carousel.data-api","[data-slide], [data-slide-to]",function(b){var c,d=a(this),e=a(d.attr("data-target")||(c=d.attr("href"))&&c.replace(/.*(?=#[^\s]+$)/,"")),f=a.extend({},e.data(),d.data()),g=d.attr("data-slide-to");g&&(f.interval=!1),e.carousel(f),(g=d.attr("data-slide-to"))&&e.data("bs.carousel").to(g),b.preventDefault()}),a(window).on("load",function(){a('[data-ride="carousel"]').each(function(){var b=a(this);b.carousel(b.data())})})}(jQuery),+function(a){"use strict";var b=function(c,d){this.$element=a(c),this.options=a.extend({},b.DEFAULTS,d),this.transitioning=null,this.options.parent&&(this.$parent=a(this.options.parent)),this.options.toggle&&this.toggle()};b.DEFAULTS={toggle:!0},b.prototype.dimension=function(){var a=this.$element.hasClass("width");return a?"width":"height"},b.prototype.show=function(){if(!this.transitioning&&!this.$element.hasClass("in")){var b=a.Event("show.bs.collapse");if(this.$element.trigger(b),!b.isDefaultPrevented()){var c=this.$parent&&this.$parent.find("> .panel > .in");if(c&&c.length){var d=c.data("bs.collapse");if(d&&d.transitioning)return;c.collapse("hide"),d||c.data("bs.collapse",null)}var e=this.dimension();this.$element.removeClass("collapse").addClass("collapsing")[e](0),this.transitioning=1;var f=function(){this.$element.removeClass("collapsing").addClass("collapse in")[e]("auto"),this.transitioning=0,this.$element.trigger("shown.bs.collapse")};if(!a.support.transition)return f.call(this);var g=a.camelCase(["scroll",e].join("-"));this.$element.one(a.support.transition.end,a.proxy(f,this)).emulateTransitionEnd(350)[e](this.$element[0][g])}}},b.prototype.hide=function(){if(!this.transitioning&&this.$element.hasClass("in")){var b=a.Event("hide.bs.collapse");if(this.$element.trigger(b),!b.isDefaultPrevented()){var c=this.dimension();this.$element[c](this.$element[c]())[0].offsetHeight,this.$element.addClass("collapsing").removeClass("collapse").removeClass("in"),this.transitioning=1;var d=function(){this.transitioning=0,this.$element.trigger("hidden.bs.collapse").removeClass("collapsing").addClass("collapse")};return a.support.transition?void this.$element[c](0).one(a.support.transition.end,a.proxy(d,this)).emulateTransitionEnd(350):d.call(this)}}},b.prototype.toggle=function(){this[this.$element.hasClass("in")?"hide":"show"]()};var c=a.fn.collapse;a.fn.collapse=function(c){return this.each(function(){var d=a(this),e=d.data("bs.collapse"),f=a.extend({},b.DEFAULTS,d.data(),"object"==typeof c&&c);!e&&f.toggle&&"show"==c&&(c=!c),e||d.data("bs.collapse",e=new b(this,f)),"string"==typeof c&&e[c]()})},a.fn.collapse.Constructor=b,a.fn.collapse.noConflict=function(){return a.fn.collapse=c,this},a(document).on("click.bs.collapse.data-api","[data-toggle=collapse]",function(b){var c,d=a(this),e=d.attr("data-target")||b.preventDefault()||(c=d.attr("href"))&&c.replace(/.*(?=#[^\s]+$)/,""),f=a(e),g=f.data("bs.collapse"),h=g?"toggle":d.data(),i=d.attr("data-parent"),j=i&&a(i);g&&g.transitioning||(j&&j.find('[data-toggle=collapse][data-parent="'+i+'"]').not(d).addClass("collapsed"),d[f.hasClass("in")?"addClass":"removeClass"]("collapsed")),f.collapse(h)})}(jQuery),+function(a){"use strict";function b(b){a(d).remove(),a(e).each(function(){var d=c(a(this)),e={relatedTarget:this};d.hasClass("open")&&(d.trigger(b=a.Event("hide.bs.dropdown",e)),b.isDefaultPrevented()||d.removeClass("open").trigger("hidden.bs.dropdown",e))})}function c(b){var c=b.attr("data-target");c||(c=b.attr("href"),c=c&&/#[A-Za-z]/.test(c)&&c.replace(/.*(?=#[^\s]*$)/,""));var d=c&&a(c);return d&&d.length?d:b.parent()}var d=".dropdown-backdrop",e="[data-toggle=dropdown]",f=function(b){a(b).on("click.bs.dropdown",this.toggle)};f.prototype.toggle=function(d){var e=a(this);if(!e.is(".disabled, :disabled")){var f=c(e),g=f.hasClass("open");if(b(),!g){"ontouchstart"in document.documentElement&&!f.closest(".navbar-nav").length&&a('<div class="dropdown-backdrop"/>').insertAfter(a(this)).on("click",b);var h={relatedTarget:this};if(f.trigger(d=a.Event("show.bs.dropdown",h)),d.isDefaultPrevented())return;f.toggleClass("open").trigger("shown.bs.dropdown",h),e.focus()}return!1}},f.prototype.keydown=function(b){if(/(38|40|27)/.test(b.keyCode)){var d=a(this);if(b.preventDefault(),b.stopPropagation(),!d.is(".disabled, :disabled")){var f=c(d),g=f.hasClass("open");if(!g||g&&27==b.keyCode)return 27==b.which&&f.find(e).focus(),d.click();var h=" li:not(.divider):visible a",i=f.find("[role=menu]"+h+", [role=listbox]"+h);if(i.length){var j=i.index(i.filter(":focus"));38==b.keyCode&&j>0&&j--,40==b.keyCode&&j<i.length-1&&j++,~j||(j=0),i.eq(j).focus()}}}};var g=a.fn.dropdown;a.fn.dropdown=function(b){return this.each(function(){var c=a(this),d=c.data("bs.dropdown");d||c.data("bs.dropdown",d=new f(this)),"string"==typeof b&&d[b].call(c)})},a.fn.dropdown.Constructor=f,a.fn.dropdown.noConflict=function(){return a.fn.dropdown=g,this},a(document).on("click.bs.dropdown.data-api",b).on("click.bs.dropdown.data-api",".dropdown form",function(a){a.stopPropagation()}).on("click.bs.dropdown.data-api",e,f.prototype.toggle).on("keydown.bs.dropdown.data-api",e+", [role=menu], [role=listbox]",f.prototype.keydown)}(jQuery),+function(a){"use strict";var b=function(b,c){this.options=c,this.$element=a(b),this.$backdrop=this.isShown=null,this.options.remote&&this.$element.find(".modal-content").load(this.options.remote,a.proxy(function(){this.$element.trigger("loaded.bs.modal")},this))};b.DEFAULTS={backdrop:!0,keyboard:!0,show:!0},b.prototype.toggle=function(a){return this[this.isShown?"hide":"show"](a)},b.prototype.show=function(b){var c=this,d=a.Event("show.bs.modal",{relatedTarget:b});this.$element.trigger(d),this.isShown||d.isDefaultPrevented()||(this.isShown=!0,this.escape(),this.$element.on("click.dismiss.bs.modal",'[data-dismiss="modal"]',a.proxy(this.hide,this)),this.backdrop(function(){var d=a.support.transition&&c.$element.hasClass("fade");c.$element.parent().length||c.$element.appendTo(document.body),c.$element.show().scrollTop(0),d&&c.$element[0].offsetWidth,c.$element.addClass("in").attr("aria-hidden",!1),c.enforceFocus();var e=a.Event("shown.bs.modal",{relatedTarget:b});d?c.$element.find(".modal-dialog").one(a.support.transition.end,function(){c.$element.focus().trigger(e)}).emulateTransitionEnd(300):c.$element.focus().trigger(e)}))},b.prototype.hide=function(b){b&&b.preventDefault(),b=a.Event("hide.bs.modal"),this.$element.trigger(b),this.isShown&&!b.isDefaultPrevented()&&(this.isShown=!1,this.escape(),a(document).off("focusin.bs.modal"),this.$element.removeClass("in").attr("aria-hidden",!0).off("click.dismiss.bs.modal"),a.support.transition&&this.$element.hasClass("fade")?this.$element.one(a.support.transition.end,a.proxy(this.hideModal,this)).emulateTransitionEnd(300):this.hideModal())},b.prototype.enforceFocus=function(){a(document).off("focusin.bs.modal").on("focusin.bs.modal",a.proxy(function(a){this.$element[0]===a.target||this.$element.has(a.target).length||this.$element.focus()},this))},b.prototype.escape=function(){this.isShown&&this.options.keyboard?this.$element.on("keyup.dismiss.bs.modal",a.proxy(function(a){27==a.which&&this.hide()},this)):this.isShown||this.$element.off("keyup.dismiss.bs.modal")},b.prototype.hideModal=function(){var a=this;this.$element.hide(),this.backdrop(function(){a.removeBackdrop(),a.$element.trigger("hidden.bs.modal")})},b.prototype.removeBackdrop=function(){this.$backdrop&&this.$backdrop.remove(),this.$backdrop=null},b.prototype.backdrop=function(b){var c=this.$element.hasClass("fade")?"fade":"";if(this.isShown&&this.options.backdrop){var d=a.support.transition&&c;if(this.$backdrop=a('<div class="modal-backdrop '+c+'" />').appendTo(document.body),this.$element.on("click.dismiss.bs.modal",a.proxy(function(a){a.target===a.currentTarget&&("static"==this.options.backdrop?this.$element[0].focus.call(this.$element[0]):this.hide.call(this))},this)),d&&this.$backdrop[0].offsetWidth,this.$backdrop.addClass("in"),!b)return;d?this.$backdrop.one(a.support.transition.end,b).emulateTransitionEnd(150):b()}else!this.isShown&&this.$backdrop?(this.$backdrop.removeClass("in"),a.support.transition&&this.$element.hasClass("fade")?this.$backdrop.one(a.support.transition.end,b).emulateTransitionEnd(150):b()):b&&b()};var c=a.fn.modal;a.fn.modal=function(c,d){return this.each(function(){var e=a(this),f=e.data("bs.modal"),g=a.extend({},b.DEFAULTS,e.data(),"object"==typeof c&&c);f||e.data("bs.modal",f=new b(this,g)),"string"==typeof c?f[c](d):g.show&&f.show(d)})},a.fn.modal.Constructor=b,a.fn.modal.noConflict=function(){return a.fn.modal=c,this},a(document).on("click.bs.modal.data-api",'[data-toggle="modal"]',function(b){var c=a(this),d=c.attr("href"),e=a(c.attr("data-target")||d&&d.replace(/.*(?=#[^\s]+$)/,"")),f=e.data("bs.modal")?"toggle":a.extend({remote:!/#/.test(d)&&d},e.data(),c.data());c.is("a")&&b.preventDefault(),e.modal(f,this).one("hide",function(){c.is(":visible")&&c.focus()})}),a(document).on("show.bs.modal",".modal",function(){a(document.body).addClass("modal-open")}).on("hidden.bs.modal",".modal",function(){a(document.body).removeClass("modal-open")})}(jQuery),+function(a){"use strict";var b=function(a,b){this.type=this.options=this.enabled=this.timeout=this.hoverState=this.$element=null,this.init("tooltip",a,b)};b.DEFAULTS={animation:!0,placement:"top",selector:!1,template:'<div class="tooltip"><div class="tooltip-arrow"></div><div class="tooltip-inner"></div></div>',trigger:"hover focus",title:"",delay:0,html:!1,container:!1},b.prototype.init=function(b,c,d){this.enabled=!0,this.type=b,this.$element=a(c),this.options=this.getOptions(d);for(var e=this.options.trigger.split(" "),f=e.length;f--;){var g=e[f];if("click"==g)this.$element.on("click."+this.type,this.options.selector,a.proxy(this.toggle,this));else if("manual"!=g){var h="hover"==g?"mouseenter":"focusin",i="hover"==g?"mouseleave":"focusout";this.$element.on(h+"."+this.type,this.options.selector,a.proxy(this.enter,this)),this.$element.on(i+"."+this.type,this.options.selector,a.proxy(this.leave,this))}}this.options.selector?this._options=a.extend({},this.options,{trigger:"manual",selector:""}):this.fixTitle()},b.prototype.getDefaults=function(){return b.DEFAULTS},b.prototype.getOptions=function(b){return b=a.extend({},this.getDefaults(),this.$element.data(),b),b.delay&&"number"==typeof b.delay&&(b.delay={show:b.delay,hide:b.delay}),b},b.prototype.getDelegateOptions=function(){var b={},c=this.getDefaults();return this._options&&a.each(this._options,function(a,d){c[a]!=d&&(b[a]=d)}),b},b.prototype.enter=function(b){var c=b instanceof this.constructor?b:a(b.currentTarget)[this.type](this.getDelegateOptions()).data("bs."+this.type);return clearTimeout(c.timeout),c.hoverState="in",c.options.delay&&c.options.delay.show?void(c.timeout=setTimeout(function(){"in"==c.hoverState&&c.show()},c.options.delay.show)):c.show()},b.prototype.leave=function(b){var c=b instanceof this.constructor?b:a(b.currentTarget)[this.type](this.getDelegateOptions()).data("bs."+this.type);return clearTimeout(c.timeout),c.hoverState="out",c.options.delay&&c.options.delay.hide?void(c.timeout=setTimeout(function(){"out"==c.hoverState&&c.hide()},c.options.delay.hide)):c.hide()},b.prototype.show=function(){var b=a.Event("show.bs."+this.type);if(this.hasContent()&&this.enabled){if(this.$element.trigger(b),b.isDefaultPrevented())return;var c=this,d=this.tip();this.setContent(),this.options.animation&&d.addClass("fade");var e="function"==typeof this.options.placement?this.options.placement.call(this,d[0],this.$element[0]):this.options.placement,f=/\s?auto?\s?/i,g=f.test(e);g&&(e=e.replace(f,"")||"top"),d.detach().css({top:0,left:0,display:"block"}).addClass(e),this.options.container?d.appendTo(this.options.container):d.insertAfter(this.$element);var h=this.getPosition(),i=d[0].offsetWidth,j=d[0].offsetHeight;if(g){var k=this.$element.parent(),l=e,m=document.documentElement.scrollTop||document.body.scrollTop,n="body"==this.options.container?window.innerWidth:k.outerWidth(),o="body"==this.options.container?window.innerHeight:k.outerHeight(),p="body"==this.options.container?0:k.offset().left;e="bottom"==e&&h.top+h.height+j-m>o?"top":"top"==e&&h.top-m-j<0?"bottom":"right"==e&&h.right+i>n?"left":"left"==e&&h.left-i<p?"right":e,d.removeClass(l).addClass(e)}var q=this.getCalculatedOffset(e,h,i,j);this.applyPlacement(q,e),this.hoverState=null;var r=function(){c.$element.trigger("shown.bs."+c.type)};a.support.transition&&this.$tip.hasClass("fade")?d.one(a.support.transition.end,r).emulateTransitionEnd(150):r()}},b.prototype.applyPlacement=function(b,c){var d,e=this.tip(),f=e[0].offsetWidth,g=e[0].offsetHeight,h=parseInt(e.css("margin-top"),10),i=parseInt(e.css("margin-left"),10);isNaN(h)&&(h=0),isNaN(i)&&(i=0),b.top=b.top+h,b.left=b.left+i,a.offset.setOffset(e[0],a.extend({using:function(a){e.css({top:Math.round(a.top),left:Math.round(a.left)})}},b),0),e.addClass("in");var j=e[0].offsetWidth,k=e[0].offsetHeight;if("top"==c&&k!=g&&(d=!0,b.top=b.top+g-k),/bottom|top/.test(c)){var l=0;b.left<0&&(l=-2*b.left,b.left=0,e.offset(b),j=e[0].offsetWidth,k=e[0].offsetHeight),this.replaceArrow(l-f+j,j,"left")}else this.replaceArrow(k-g,k,"top");d&&e.offset(b)},b.prototype.replaceArrow=function(a,b,c){this.arrow().css(c,a?50*(1-a/b)+"%":"")},b.prototype.setContent=function(){var a=this.tip(),b=this.getTitle();a.find(".tooltip-inner")[this.options.html?"html":"text"](b),a.removeClass("fade in top bottom left right")},b.prototype.hide=function(){function b(){"in"!=c.hoverState&&d.detach(),c.$element.trigger("hidden.bs."+c.type)}var c=this,d=this.tip(),e=a.Event("hide.bs."+this.type);return this.$element.trigger(e),e.isDefaultPrevented()?void 0:(d.removeClass("in"),a.support.transition&&this.$tip.hasClass("fade")?d.one(a.support.transition.end,b).emulateTransitionEnd(150):b(),this.hoverState=null,this)},b.prototype.fixTitle=function(){var a=this.$element;(a.attr("title")||"string"!=typeof a.attr("data-original-title"))&&a.attr("data-original-title",a.attr("title")||"").attr("title","")},b.prototype.hasContent=function(){return this.getTitle()},b.prototype.getPosition=function(){var b=this.$element[0];return a.extend({},"function"==typeof b.getBoundingClientRect?b.getBoundingClientRect():{width:b.offsetWidth,height:b.offsetHeight},this.$element.offset())},b.prototype.getCalculatedOffset=function(a,b,c,d){return"bottom"==a?{top:b.top+b.height,left:b.left+b.width/2-c/2}:"top"==a?{top:b.top-d,left:b.left+b.width/2-c/2}:"left"==a?{top:b.top+b.height/2-d/2,left:b.left-c}:{top:b.top+b.height/2-d/2,left:b.left+b.width}},b.prototype.getTitle=function(){var a,b=this.$element,c=this.options;return a=b.attr("data-original-title")||("function"==typeof c.title?c.title.call(b[0]):c.title)},b.prototype.tip=function(){return this.$tip=this.$tip||a(this.options.template)},b.prototype.arrow=function(){return this.$arrow=this.$arrow||this.tip().find(".tooltip-arrow")},b.prototype.validate=function(){this.$element[0].parentNode||(this.hide(),this.$element=null,this.options=null)},b.prototype.enable=function(){this.enabled=!0},b.prototype.disable=function(){this.enabled=!1},b.prototype.toggleEnabled=function(){this.enabled=!this.enabled},b.prototype.toggle=function(b){var c=b?a(b.currentTarget)[this.type](this.getDelegateOptions()).data("bs."+this.type):this;c.tip().hasClass("in")?c.leave(c):c.enter(c)},b.prototype.destroy=function(){clearTimeout(this.timeout),this.hide().$element.off("."+this.type).removeData("bs."+this.type)};var c=a.fn.tooltip;a.fn.tooltip=function(c){return this.each(function(){var d=a(this),e=d.data("bs.tooltip"),f="object"==typeof c&&c;(e||"destroy"!=c)&&(e||d.data("bs.tooltip",e=new b(this,f)),"string"==typeof c&&e[c]())})},a.fn.tooltip.Constructor=b,a.fn.tooltip.noConflict=function(){return a.fn.tooltip=c,this}}(jQuery),+function(a){"use strict";var b=function(a,b){this.init("popover",a,b)};if(!a.fn.tooltip)throw new Error("Popover requires tooltip.js");b.DEFAULTS=a.extend({},a.fn.tooltip.Constructor.DEFAULTS,{placement:"right",trigger:"click",content:"",template:'<div class="popover"><div class="arrow"></div><h3 class="popover-title"></h3><div class="popover-content"></div></div>'}),b.prototype=a.extend({},a.fn.tooltip.Constructor.prototype),b.prototype.constructor=b,b.prototype.getDefaults=function(){return b.DEFAULTS},b.prototype.setContent=function(){var a=this.tip(),b=this.getTitle(),c=this.getContent();a.find(".popover-title")[this.options.html?"html":"text"](b),a.find(".popover-content")[this.options.html?"string"==typeof c?"html":"append":"text"](c),a.removeClass("fade top bottom left right in"),a.find(".popover-title").html()||a.find(".popover-title").hide()},b.prototype.hasContent=function(){return this.getTitle()||this.getContent()},b.prototype.getContent=function(){var a=this.$element,b=this.options;return a.attr("data-content")||("function"==typeof b.content?b.content.call(a[0]):b.content)},b.prototype.arrow=function(){return this.$arrow=this.$arrow||this.tip().find(".arrow")},b.prototype.tip=function(){return this.$tip||(this.$tip=a(this.options.template)),this.$tip};var c=a.fn.popover;a.fn.popover=function(c){return this.each(function(){var d=a(this),e=d.data("bs.popover"),f="object"==typeof c&&c;(e||"destroy"!=c)&&(e||d.data("bs.popover",e=new b(this,f)),"string"==typeof c&&e[c]())})},a.fn.popover.Constructor=b,a.fn.popover.noConflict=function(){return a.fn.popover=c,this}}(jQuery),+function(a){"use strict";function b(c,d){var e,f=a.proxy(this.process,this);this.$element=a(a(c).is("body")?window:c),this.$body=a("body"),this.$scrollElement=this.$element.on("scroll.bs.scroll-spy.data-api",f),this.options=a.extend({},b.DEFAULTS,d),this.selector=(this.options.target||(e=a(c).attr("href"))&&e.replace(/.*(?=#[^\s]+$)/,"")||"")+" .nav li > a",this.offsets=a([]),this.targets=a([]),this.activeTarget=null,this.refresh(),this.process()}b.DEFAULTS={offset:10},b.prototype.refresh=function(){var b=this.$element[0]==window?"offset":"position";this.offsets=a([]),this.targets=a([]);{var c=this;this.$body.find(this.selector).map(function(){var d=a(this),e=d.data("target")||d.attr("href"),f=/^#./.test(e)&&a(e);return f&&f.length&&f.is(":visible")&&[[f[b]().top+(!a.isWindow(c.$scrollElement.get(0))&&c.$scrollElement.scrollTop()),e]]||null}).sort(function(a,b){return a[0]-b[0]}).each(function(){c.offsets.push(this[0]),c.targets.push(this[1])})}},b.prototype.process=function(){var a,b=this.$scrollElement.scrollTop()+this.options.offset,c=this.$scrollElement[0].scrollHeight||this.$body[0].scrollHeight,d=c-this.$scrollElement.height(),e=this.offsets,f=this.targets,g=this.activeTarget;if(b>=d)return g!=(a=f.last()[0])&&this.activate(a);if(g&&b<=e[0])return g!=(a=f[0])&&this.activate(a);for(a=e.length;a--;)g!=f[a]&&b>=e[a]&&(!e[a+1]||b<=e[a+1])&&this.activate(f[a])},b.prototype.activate=function(b){this.activeTarget=b,a(this.selector).parentsUntil(this.options.target,".active").removeClass("active");var c=this.selector+'[data-target="'+b+'"],'+this.selector+'[href="'+b+'"]',d=a(c).parents("li").addClass("active");d.parent(".dropdown-menu").length&&(d=d.closest("li.dropdown").addClass("active")),d.trigger("activate.bs.scrollspy")};var c=a.fn.scrollspy;a.fn.scrollspy=function(c){return this.each(function(){var d=a(this),e=d.data("bs.scrollspy"),f="object"==typeof c&&c;e||d.data("bs.scrollspy",e=new b(this,f)),"string"==typeof c&&e[c]()})},a.fn.scrollspy.Constructor=b,a.fn.scrollspy.noConflict=function(){return a.fn.scrollspy=c,this},a(window).on("load",function(){a('[data-spy="scroll"]').each(function(){var b=a(this);b.scrollspy(b.data())})})}(jQuery),+function(a){"use strict";var b=function(b){this.element=a(b)};b.prototype.show=function(){var b=this.element,c=b.closest("ul:not(.dropdown-menu)"),d=b.data("target");if(d||(d=b.attr("href"),d=d&&d.replace(/.*(?=#[^\s]*$)/,"")),!b.parent("li").hasClass("active")){var e=c.find(".active:last a")[0],f=a.Event("show.bs.tab",{relatedTarget:e});if(b.trigger(f),!f.isDefaultPrevented()){var g=a(d);this.activate(b.parent("li"),c),this.activate(g,g.parent(),function(){b.trigger({type:"shown.bs.tab",relatedTarget:e})})}}},b.prototype.activate=function(b,c,d){function e(){f.removeClass("active").find("> .dropdown-menu > .active").removeClass("active"),b.addClass("active"),g?(b[0].offsetWidth,b.addClass("in")):b.removeClass("fade"),b.parent(".dropdown-menu")&&b.closest("li.dropdown").addClass("active"),d&&d()}var f=c.find("> .active"),g=d&&a.support.transition&&f.hasClass("fade");g?f.one(a.support.transition.end,e).emulateTransitionEnd(150):e(),f.removeClass("in")};var c=a.fn.tab;a.fn.tab=function(c){return this.each(function(){var d=a(this),e=d.data("bs.tab");e||d.data("bs.tab",e=new b(this)),"string"==typeof c&&e[c]()})},a.fn.tab.Constructor=b,a.fn.tab.noConflict=function(){return a.fn.tab=c,this},a(document).on("click.bs.tab.data-api",'[data-toggle="tab"], [data-toggle="pill"]',function(b){b.preventDefault(),a(this).tab("show")})}(jQuery),+function(a){"use strict";var b=function(c,d){this.options=a.extend({},b.DEFAULTS,d),this.$window=a(window).on("scroll.bs.affix.data-api",a.proxy(this.checkPosition,this)).on("click.bs.affix.data-api",a.proxy(this.checkPositionWithEventLoop,this)),this.$element=a(c),this.affixed=this.unpin=this.pinnedOffset=null,this.checkPosition()};b.RESET="affix affix-top affix-bottom",b.DEFAULTS={offset:0},b.prototype.getPinnedOffset=function(){if(this.pinnedOffset)return this.pinnedOffset;this.$element.removeClass(b.RESET).addClass("affix");var a=this.$window.scrollTop(),c=this.$element.offset();return this.pinnedOffset=c.top-a},b.prototype.checkPositionWithEventLoop=function(){setTimeout(a.proxy(this.checkPosition,this),1)},b.prototype.checkPosition=function(){if(this.$element.is(":visible")){var c=a(document).height(),d=this.$window.scrollTop(),e=this.$element.offset(),f=this.options.offset,g=f.top,h=f.bottom;"top"==this.affixed&&(e.top+=d),"object"!=typeof f&&(h=g=f),"function"==typeof g&&(g=f.top(this.$element)),"function"==typeof h&&(h=f.bottom(this.$element));var i=null!=this.unpin&&d+this.unpin<=e.top?!1:null!=h&&e.top+this.$element.height()>=c-h?"bottom":null!=g&&g>=d?"top":!1;if(this.affixed!==i){this.unpin&&this.$element.css("top","");var j="affix"+(i?"-"+i:""),k=a.Event(j+".bs.affix");this.$element.trigger(k),k.isDefaultPrevented()||(this.affixed=i,this.unpin="bottom"==i?this.getPinnedOffset():null,this.$element.removeClass(b.RESET).addClass(j).trigger(a.Event(j.replace("affix","affixed"))),"bottom"==i&&this.$element.offset({top:c-h-this.$element.height()}))}}};var c=a.fn.affix;a.fn.affix=function(c){return this.each(function(){var d=a(this),e=d.data("bs.affix"),f="object"==typeof c&&c;e||d.data("bs.affix",e=new b(this,f)),"string"==typeof c&&e[c]()})},a.fn.affix.Constructor=b,a.fn.affix.noConflict=function(){return a.fn.affix=c,this},a(window).on("load",function(){a('[data-spy="affix"]').each(function(){var b=a(this),c=b.data();c.offset=c.offset||{},c.offsetBottom&&(c.offset.bottom=c.offsetBottom),c.offsetTop&&(c.offset.top=c.offsetTop),b.affix(c)})})}(jQuery);
\ No newline at end of file
diff --git a/mutalyzer/website/templates/static/js/generator.js b/mutalyzer/website/templates/static/js/generator.js
index 7971a98fb00b488008277d0aff2f16b6b2727084..04ea449ccafc16091241efa1bb3acb8c2fb423a3 100644
--- a/mutalyzer/website/templates/static/js/generator.js
+++ b/mutalyzer/website/templates/static/js/generator.js
@@ -555,7 +555,9 @@ function variantOK(){
}
function show(id){
- document.getElementById(id).style.display = "";
+ var el = document.getElementById(id);
+ if (el) el.style.display = "";
+ else alert(id);
}
function hide(id){
@@ -620,17 +622,18 @@ function addVariant() {
var variantnmbr = variants.length;
var newvar = newVariantField("sub");
variants[variants.length] = newvar;
- var newvariant = document.createElement('fieldset');
- newvariant.setAttribute("id", "variant"+variantnmbr);
+ var newvariant = document.createElement('div');
+ newvariant.setAttribute("class", "");
+ newvariant.setAttribute("id", "variant"+variantnmbr);
//populate variant with variant template
var variantHTML = document.getElementById("varianttemplate").innerHTML;
- var finalHTML = "<legend>Variant "+(variantnmbr+1);
+ var finalHTML = "<h4>Variant "+(variantnmbr+1);
if(variantnmbr>0){
finalHTML += " <a onclick=\"removeVariant("+variantnmbr+");\""+
" class=\"remove\">remove</a> ";
}
- finalHTML += "</legend>";
+ finalHTML += "</h4>";
finalHTML += variantHTML.replace(/\{NMBR\}/g, variantnmbr);
diff --git a/mutalyzer/website/templates/static/js/html5shiv.min.js b/mutalyzer/website/templates/static/js/html5shiv.min.js
new file mode 100644
index 0000000000000000000000000000000000000000..448cebd79e723cefaffcd75f2b2f693e352361f8
--- /dev/null
+++ b/mutalyzer/website/templates/static/js/html5shiv.min.js
@@ -0,0 +1,8 @@
+/*
+ HTML5 Shiv v3.7.0 | @afarkas @jdalton @jon_neal @rem | MIT/GPL2 Licensed
+*/
+(function(l,f){function m(){var a=e.elements;return"string"==typeof a?a.split(" "):a}function i(a){var b=n[a[o]];b||(b={},h++,a[o]=h,n[h]=b);return b}function p(a,b,c){b||(b=f);if(g)return b.createElement(a);c||(c=i(b));b=c.cache[a]?c.cache[a].cloneNode():r.test(a)?(c.cache[a]=c.createElem(a)).cloneNode():c.createElem(a);return b.canHaveChildren&&!s.test(a)?c.frag.appendChild(b):b}function t(a,b){if(!b.cache)b.cache={},b.createElem=a.createElement,b.createFrag=a.createDocumentFragment,b.frag=b.createFrag();
+a.createElement=function(c){return!e.shivMethods?b.createElem(c):p(c,a,b)};a.createDocumentFragment=Function("h,f","return function(){var n=f.cloneNode(),c=n.createElement;h.shivMethods&&("+m().join().replace(/[\w\-]+/g,function(a){b.createElem(a);b.frag.createElement(a);return'c("'+a+'")'})+");return n}")(e,b.frag)}function q(a){a||(a=f);var b=i(a);if(e.shivCSS&&!j&&!b.hasCSS){var c,d=a;c=d.createElement("p");d=d.getElementsByTagName("head")[0]||d.documentElement;c.innerHTML="x<style>article,aside,dialog,figcaption,figure,footer,header,hgroup,main,nav,section{display:block}mark{background:#FF0;color:#000}template{display:none}</style>";
+c=d.insertBefore(c.lastChild,d.firstChild);b.hasCSS=!!c}g||t(a,b);return a}var k=l.html5||{},s=/^<|^(?:button|map|select|textarea|object|iframe|option|optgroup)$/i,r=/^(?:a|b|code|div|fieldset|h1|h2|h3|h4|h5|h6|i|label|li|ol|p|q|span|strong|style|table|tbody|td|th|tr|ul)$/i,j,o="_html5shiv",h=0,n={},g;(function(){try{var a=f.createElement("a");a.innerHTML="<xyz></xyz>";j="hidden"in a;var b;if(!(b=1==a.childNodes.length)){f.createElement("a");var c=f.createDocumentFragment();b="undefined"==typeof c.cloneNode||
+"undefined"==typeof c.createDocumentFragment||"undefined"==typeof c.createElement}g=b}catch(d){g=j=!0}})();var e={elements:k.elements||"abbr article aside audio bdi canvas data datalist details dialog figcaption figure footer header hgroup main mark meter nav output progress section summary template time video",version:"3.7.0",shivCSS:!1!==k.shivCSS,supportsUnknownElements:g,shivMethods:!1!==k.shivMethods,type:"default",shivDocument:q,createElement:p,createDocumentFragment:function(a,b){a||(a=f);
+if(g)return a.createDocumentFragment();for(var b=b||i(a),c=b.frag.cloneNode(),d=0,e=m(),h=e.length;d<h;d++)c.createElement(e[d]);return c}};l.html5=e;q(f)})(this,document);
diff --git a/mutalyzer/website/templates/static/js/interface.js b/mutalyzer/website/templates/static/js/interface.js
index 5d83b1f2df6cef9d5693dd4883fcbc5ec817bf3c..bc55ed80fd62f5f4bd2eb45ea755982a6d6e5b46 100644
--- a/mutalyzer/website/templates/static/js/interface.js
+++ b/mutalyzer/website/templates/static/js/interface.js
@@ -28,7 +28,8 @@ function updateVisibility() {
//Toggle the build option in the batch.html page
function changeBatch(sel) {
- var opt = sel.options[sel.selectedIndex].value;
+ var opt = $(sel).val();
+ // var opt = sel.options[sel.selectedIndex].value;
if(opt=='position-converter') {
document.getElementById('assembly_name_or_alias').style.display = "";
} else {
@@ -46,7 +47,7 @@ function toggle_visibility(id) {
}
function onloadBatch() {
- changeBatch(document.getElementById('job_type'));
+ changeBatch($('input[name="job_type"]:checked'));
}
function clearField(form, fieldName) {
@@ -56,3 +57,12 @@ function clearField(form, fieldName) {
}
}
}
+
+$(document).ready(function() {
+ $('.example-input').on('click', function() {
+ $('.example-target').val($(this).text());
+ });
+ $('.example-input-2').on('click', function() {
+ $('.example-target-2').val($(this).text());
+ });
+})
diff --git a/mutalyzer/website/templates/static/js/jquery-1.10.2.min.js b/mutalyzer/website/templates/static/js/jquery.min.js
similarity index 100%
rename from mutalyzer/website/templates/static/js/jquery-1.10.2.min.js
rename to mutalyzer/website/templates/static/js/jquery.min.js
diff --git a/mutalyzer/website/templates/static/js/respond.min.js b/mutalyzer/website/templates/static/js/respond.min.js
new file mode 100644
index 0000000000000000000000000000000000000000..80a7b69dcce544dfa87ae851d92acdae0e93fb0f
--- /dev/null
+++ b/mutalyzer/website/templates/static/js/respond.min.js
@@ -0,0 +1,5 @@
+/*! Respond.js v1.4.2: min/max-width media query polyfill * Copyright 2013 Scott Jehl
+ * Licensed under https://github.com/scottjehl/Respond/blob/master/LICENSE-MIT
+ * */
+
+!function(a){"use strict";a.matchMedia=a.matchMedia||function(a){var b,c=a.documentElement,d=c.firstElementChild||c.firstChild,e=a.createElement("body"),f=a.createElement("div");return f.id="mq-test-1",f.style.cssText="position:absolute;top:-100em",e.style.background="none",e.appendChild(f),function(a){return f.innerHTML='­<style media="'+a+'"> #mq-test-1 { width: 42px; }</style>',c.insertBefore(e,d),b=42===f.offsetWidth,c.removeChild(e),{matches:b,media:a}}}(a.document)}(this),function(a){"use strict";function b(){u(!0)}var c={};a.respond=c,c.update=function(){};var d=[],e=function(){var b=!1;try{b=new a.XMLHttpRequest}catch(c){b=new a.ActiveXObject("Microsoft.XMLHTTP")}return function(){return b}}(),f=function(a,b){var c=e();c&&(c.open("GET",a,!0),c.onreadystatechange=function(){4!==c.readyState||200!==c.status&&304!==c.status||b(c.responseText)},4!==c.readyState&&c.send(null))};if(c.ajax=f,c.queue=d,c.regex={media:/@media[^\{]+\{([^\{\}]*\{[^\}\{]*\})+/gi,keyframes:/@(?:\-(?:o|moz|webkit)\-)?keyframes[^\{]+\{(?:[^\{\}]*\{[^\}\{]*\})+[^\}]*\}/gi,urls:/(url\()['"]?([^\/\)'"][^:\)'"]+)['"]?(\))/g,findStyles:/@media *([^\{]+)\{([\S\s]+?)$/,only:/(only\s+)?([a-zA-Z]+)\s?/,minw:/\([\s]*min\-width\s*:[\s]*([\s]*[0-9\.]+)(px|em)[\s]*\)/,maxw:/\([\s]*max\-width\s*:[\s]*([\s]*[0-9\.]+)(px|em)[\s]*\)/},c.mediaQueriesSupported=a.matchMedia&&null!==a.matchMedia("only all")&&a.matchMedia("only all").matches,!c.mediaQueriesSupported){var g,h,i,j=a.document,k=j.documentElement,l=[],m=[],n=[],o={},p=30,q=j.getElementsByTagName("head")[0]||k,r=j.getElementsByTagName("base")[0],s=q.getElementsByTagName("link"),t=function(){var a,b=j.createElement("div"),c=j.body,d=k.style.fontSize,e=c&&c.style.fontSize,f=!1;return b.style.cssText="position:absolute;font-size:1em;width:1em",c||(c=f=j.createElement("body"),c.style.background="none"),k.style.fontSize="100%",c.style.fontSize="100%",c.appendChild(b),f&&k.insertBefore(c,k.firstChild),a=b.offsetWidth,f?k.removeChild(c):c.removeChild(b),k.style.fontSize=d,e&&(c.style.fontSize=e),a=i=parseFloat(a)},u=function(b){var c="clientWidth",d=k[c],e="CSS1Compat"===j.compatMode&&d||j.body[c]||d,f={},o=s[s.length-1],r=(new Date).getTime();if(b&&g&&p>r-g)return a.clearTimeout(h),h=a.setTimeout(u,p),void 0;g=r;for(var v in l)if(l.hasOwnProperty(v)){var w=l[v],x=w.minw,y=w.maxw,z=null===x,A=null===y,B="em";x&&(x=parseFloat(x)*(x.indexOf(B)>-1?i||t():1)),y&&(y=parseFloat(y)*(y.indexOf(B)>-1?i||t():1)),w.hasquery&&(z&&A||!(z||e>=x)||!(A||y>=e))||(f[w.media]||(f[w.media]=[]),f[w.media].push(m[w.rules]))}for(var C in n)n.hasOwnProperty(C)&&n[C]&&n[C].parentNode===q&&q.removeChild(n[C]);n.length=0;for(var D in f)if(f.hasOwnProperty(D)){var E=j.createElement("style"),F=f[D].join("\n");E.type="text/css",E.media=D,q.insertBefore(E,o.nextSibling),E.styleSheet?E.styleSheet.cssText=F:E.appendChild(j.createTextNode(F)),n.push(E)}},v=function(a,b,d){var e=a.replace(c.regex.keyframes,"").match(c.regex.media),f=e&&e.length||0;b=b.substring(0,b.lastIndexOf("/"));var g=function(a){return a.replace(c.regex.urls,"$1"+b+"$2$3")},h=!f&&d;b.length&&(b+="/"),h&&(f=1);for(var i=0;f>i;i++){var j,k,n,o;h?(j=d,m.push(g(a))):(j=e[i].match(c.regex.findStyles)&&RegExp.$1,m.push(RegExp.$2&&g(RegExp.$2))),n=j.split(","),o=n.length;for(var p=0;o>p;p++)k=n[p],l.push({media:k.split("(")[0].match(c.regex.only)&&RegExp.$2||"all",rules:m.length-1,hasquery:k.indexOf("(")>-1,minw:k.match(c.regex.minw)&&parseFloat(RegExp.$1)+(RegExp.$2||""),maxw:k.match(c.regex.maxw)&&parseFloat(RegExp.$1)+(RegExp.$2||"")})}u()},w=function(){if(d.length){var b=d.shift();f(b.href,function(c){v(c,b.href,b.media),o[b.href]=!0,a.setTimeout(function(){w()},0)})}},x=function(){for(var b=0;b<s.length;b++){var c=s[b],e=c.href,f=c.media,g=c.rel&&"stylesheet"===c.rel.toLowerCase();e&&g&&!o[e]&&(c.styleSheet&&c.styleSheet.rawCssText?(v(c.styleSheet.rawCssText,e,f),o[e]=!0):(!/^([a-zA-Z:]*\/\/)/.test(e)&&!r||e.replace(RegExp.$1,"").split("/")[0]===a.location.host)&&("//"===e.substring(0,2)&&(e=a.location.protocol+e),d.push({href:e,media:f})))}w()};x(),c.update=x,c.getEmValue=t,a.addEventListener?a.addEventListener("resize",b,!1):a.attachEvent&&a.attachEvent("onresize",b)}}(this);
\ No newline at end of file
diff --git a/mutalyzer/website/templates/syntax-checker.html b/mutalyzer/website/templates/syntax-checker.html
index 9efe75ebbc662e88247ff43dac0881711b98f87c..75c353ce544e5fd345569a38255139d8d83db96c 100644
--- a/mutalyzer/website/templates/syntax-checker.html
+++ b/mutalyzer/website/templates/syntax-checker.html
@@ -1,47 +1,50 @@
{% extends "base.html" %}
{% set active_page = "syntax-checker" %}
-{% set page_title = "Syntax Checker" %}
+{% set page_title = "Syntax checker" %}
+<!-- {% set page_titles = "Syntax Checker" %} -->
{% block content %}
+ {% if description %}
+ <h3>Variant syntax checker results</h3>
+ {% if parse_error %}
+ <div class="alert alert-danger">
+ <h4>There were errors</h4>
+ <ul>
+ {% for m in messages %}
+ <li title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</li>
+ {% endfor %}
+ </ul>
+ <h5>Details of the parse error</h5>
+ <pre>{{- parse_error[0] }}<br>{{- parse_error[1] }}</pre>
+ <p>The "^" indicates the position where the error occurred.</p>
+ </div>
+ {% else %}
+ <div class="alert alert-success">
+ The syntax of this variant is OK!
+ </div>
+ {% endif %}
+ <br>
+ {% endif %}
+ <p>
+ Please insert the mutation name using the <a href="http://www.hgvs.org/mutnomen" title="Human Genome Variation Society standard variant nomenclature" alt="Human Genome Variation Society standard variant nomenclature">HGVS</a> format:<br>
+ <code><accession number>.<version number>(<gene symbol>):<sequence type>.<variant description></code>
+ </p>
+
+ <p>
+ Example: <code class="example-input">AB026906.1:c.274G>T</code>
+ </p>
-<div style="border: 1px solid grey; background-color: aliceblue; padding: 20px;">
- <div>
- Please insert the mutation name using the
- <span class = "helper" title =
- "Human Genome Variation Society standard variant nomenclature">
- <a href="http://www.hgvs.org/mutnomen">HGVS</a> format</span>:<br>
- <accession number>.<version
- number>(<gene symbol>):<sequence
- type>.<variant description>
- </div><br>
- Example: AB026906.1:c.274G>T<br>
- <br>
- <form action="{{ url_for('.syntax_checker') }}" method="get">
- <input type="text" name="description" value="{{ description }}" style="width:100%"><br>
- <input type="submit" value="Submit">
- <input type="button" value="Clear field" onclick="clearField(this.form, 'description');">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/SyntaxChecker">Help</a>
- </form>
-</div>
-<br>
-{% if description %}
- <h3>Variant syntax checker results:</h3>
- {% if parse_error %}
- <div class="messages">
- {% for m in messages %}
- <p class="{{ m.class }}" title="{{ m.level }} (origin: {{ m.origin }})">{{ m.description }}</p>
- {% endfor %}
- <p>{{ summary }}</p>
- <br>
- </div>
- <h4>Details of the parse error:</h4>
- <pre>{{- parse_error[0] }}<br>{{- parse_error[1] }}</pre>
- <p>The "^" indicates the position where the error occurred.</p>
- {% else %}
- <p>The syntax of this variant is OK!</p>
- {% endif %}
- <br>
-{% endif %}
-
+ <form class="form" action="{{ url_for('.syntax_checker') }}" method="get">
+ <div class="form-group">
+ <label for="description">HGVS Description</label>
+ <input class="form-control form-pre example-target" type="text" name="description" value="{{ description }}" placeholder="Mutation name using HGVS format">
+ </div>
+ <div class="form-group button-group">
+ <input type="submit" class="btn btn-primary" value="Check syntax">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/SyntaxChecker" target="new" class="btn btn-default pull-right">Help</a>
+ <input type="reset" class="btn btn-default pull-right" value="Undo">
+ </div>
+ </form>
+
{% endblock content %}
diff --git a/mutalyzer/website/templates/webservices.html b/mutalyzer/website/templates/webservices.html
index 3303d92c93d9d434ea34ed517af182171775935a..ea5c24b4538f434f50c1f2b41511c44c13e8059d 100644
--- a/mutalyzer/website/templates/webservices.html
+++ b/mutalyzer/website/templates/webservices.html
@@ -41,26 +41,18 @@ the <span class="helper" title="Human Genome Variation Society standard variant
</ul>
<p>
-Here is an example that could be used for
-<a href="{{ url_for('.downloads', filename='textmining.py') }}">text
- mining</a> on a <a href="{{ url_for('.downloads',
- filename='textmining_sample.txt') }}">sample</a> input file.
+Here is an example that could be used for <a href="{{ url_for('.downloads', filename='textmining.py') }}">text mining</a> on a <a href="{{ url_for('.downloads', filename='textmining_sample.txt') }}">sample</a> input file.
</p>
<h3>HTTP/RPC+JSON web service</h3>
<p>
-The HTTP/RPC+JSON web service is experimental and currently undocumented.
-It can be called using HTTP GET requests on
-<code>{{ json_root_url }}/method?param=value</code>
-where <code>method</code> is the name of the method to be called and method
-parameters are expected as <code>param=value</code> query string
-parameters. Responses are JSON-encoded.
+The HTTP/RPC+JSON web service is experimental and currently undocumented. It can be called using HTTP GET requests on <code>{{ json_root_url }}/method?param=value</code> where <code>method</code> is the name of the method to be called and method parameters are expected as <code>param=value</code> query string parameters. Responses are JSON-encoded.
</p>
<p>
-Example: <a href="{{ json_root_url }}/checkSyntax?variant=AB026906.1:c.274del"><tt>checkSyntax?variant=AB026906.1:c.274del</tt></a>
-</p>
+Example:
+<pre><a href="{{ json_root_url }}/checkSyntax?variant=AB026906.1:c.274del">checkSyntax?variant=AB026906.1:c.274del</pre></a>
<p>
For now, you can work from this example using the above mentioned
diff --git a/tests/test_website.py b/tests/test_website.py
index fd0f02e7725b2cd1dc53b6231a9ac01d70a4caca..a7fa1b1dc6a5cce119897309930522e32d40c2c8 100644
--- a/tests/test_website.py
+++ b/tests/test_website.py
@@ -137,8 +137,7 @@ class TestWebsite(MutalyzerTest):
assert '0 Errors' in r.data
assert '0 Warnings' in r.data
assert 'Raw variant 1: deletion of 1' in r.data
- assert '<a href="#bottom" class="hornav">go to bottom</a>' in r.data
- assert '<input type="text" name="description" value="NM_002001.2:g.1del" style="width:100%">' in r.data
+ assert '<input class="form-control form-pre example-target" type="text" name="description" id="hgvs" value="NM_002001.2:g.1del" placeholder="Mutation name using HGVS format">' in r.data
def test_check_invalid(self):
"""
@@ -148,7 +147,7 @@ class TestWebsite(MutalyzerTest):
query_string={'description': 'NM_002001.2'})
assert '1 Error' in r.data
assert '0 Warnings' in r.data
- assert 'Details of the parse error' in r.data
+ assert 'The "^" indicates the position where the error occurred' in r.data
@fix(database, cache('NP_064445.1'))
def test_check_protein_reference(self):