From 48bb332db0d8e6b89dea8957d1c4cdf16ce5c964 Mon Sep 17 00:00:00 2001
From: "J.F.J. Laros" <j.f.j.laros@lumc.nl>
Date: Mon, 14 Jun 2010 08:40:40 +0000
Subject: [PATCH] Commit to do a merge with web_dev. This version is not
suitable for distribution as it is under heavy development.
Most modules will have minor changes because of a difference in set up of both
the Db and Config module.
install.sh:
- Added functionality to enable the cron restart of the Batch Checker.
- Added the auto-generation of a .htaccess file.
- Added permission settings.
mutalyzer.conf:
- Added configuration options for the Scheduler, File and GenRecord modules.
Db.txt:
- Described how to make the new ChrName tables for hg18 and hg19.
errorcodes.txt:
- Added classifications to the messages.
doc:
- Made a set up for the documentation.
TechnicalReference:
- This will be a technical document that describes the internals of the
project. It is only meant for developers.
API:
- This is a description of the API, it is auto generated by the mkapidoc.sh
script. Also only meant for developers.
Mutalyzer.py:
- Added a new roll function that will always find both boundaries.
- Implemented a new protein naming scheme.
- Fixed the trimming of a delins.
- Rewrote the processing of a variant.
- Moved post processing of the GenBank record to the GenRecord module.
- Moved the crossmapper instance to the GenBank module, to make one instance
per transcript variant.
- Moved the naming of a variant to the GenBank module, as is strongly
interacts with the crossmapper instance.
- Moved the constructCDS function to the GenRecord module.
handler.py:
- Added functionality for the batch checker (retrieve results).
- Added functionality for the genbank uploader (retrieve GenBank files).
webservice.py:
- Modified to work with the new Db module.
UCSC_update.py:
- Modified to work with the new Db module.
GenRecord.py:
- Replaced the dictionary structure with a nested list structure to make
iteration more convenient.
- Added names to the Locus and Gene objects.
- Added all information needed to do a crossmapping in the Locus object.
- Wrote functions to find Loci and Genes.
- Wrote a function that expands a description of a variant (coupled to a Locus).
Mutator.py:
- Added documentation.
Parser.py:
- Added documentation.
Web.py:
- Added documentation.
- Added a function that checks whether a string is an e-mail address.
Scheduler.py:
- Implemented a batch scheduler that uses a MySQL database for queueing.
File.py:
- Implemented a CSV, XLS and ODS parser for use in the Scheduler module.
Output.py:
- Added documentation.
Mapper.py:
- Modified the complex object initialisation.
Config.py:
- Made subclasses to configure the separate modules.
Db.py:
- Added documentation.
- Split the Db modules into different classes, according to functionality, they
all inherit the query function from the Db base class.
- Added chromosome accession number to name conversion functions and vice versa.
- Added functionality for the batch checker.
Crossmap.py:
- Added documentation.
Retriever.py:
- Added documentation.
- Added fall back functionality when searching for a gene.
index.py:
- Added a batch submit interface.
batch.html:
- The layout of the batch submit interface.
git-svn-id: https://humgenprojects.lumc.nl/svn/mutalyzer/trunk@30 eb6bd6ab-9ccd-42b9-aceb-e2899b4a52f1
---
Db.txt | 78 +-
doc/API/api.conf | 105 ++
doc/API/mkapidoc.sh | 5 +
doc/TechnicalReference/Makefile | 37 +
doc/TechnicalReference/TechnicalReference.tex | 69 ++
doc/TechnicalReference/bibliography.bib | 0
errorcodes.txt | 59 +-
install.sh | 46 +-
mutalyzer.conf | 48 +-
src/BatchChecker.py | 4 +-
src/Modules/Config.py | 186 ++--
src/Modules/Crossmap.py | 10 +
src/Modules/Db.py | 660 ++++++++-----
src/Modules/File.py | 322 ++++++
src/Modules/GenRecord.py | 373 +++++--
src/Modules/Mapper.py | 86 +-
src/Modules/Misc.py | 5 +
src/Modules/Mutator.py | 154 +--
src/Modules/Output.py | 319 +++---
src/Modules/Parser.py | 32 +-
src/Modules/Retriever.py | 213 ++--
src/Modules/Scheduler.py | 85 +-
src/Modules/Web.py | 18 +
src/Modules/__init__.py | 14 +
src/Mutalyzer.py | 927 ++++++++----------
src/UCSC_update.py | 26 +-
src/VarInfo.py | 4 +-
src/handler.py | 47 +-
src/index.py | 50 +-
src/webservice.py | 26 +-
templates/batch.html | 40 +
31 files changed, 2566 insertions(+), 1482 deletions(-)
create mode 100644 doc/API/api.conf
create mode 100644 doc/API/mkapidoc.sh
create mode 100644 doc/TechnicalReference/Makefile
create mode 100644 doc/TechnicalReference/TechnicalReference.tex
create mode 100644 doc/TechnicalReference/bibliography.bib
create mode 100644 src/Modules/File.py
create mode 100644 templates/batch.html
diff --git a/Db.txt b/Db.txt
index 3867c448..fda594a6 100644
--- a/Db.txt
+++ b/Db.txt
@@ -38,14 +38,15 @@ CREATE TABLE BatchQueue (
QueueID INT(5) PRIMARY KEY AUTO_INCREMENT,
JobID CHAR(20) NOT NULL,
AccNo CHAR(13) NOT NULL,
- Gene CHAR(20) NOT NULL,
+ Gene CHAR(20),
Variant CHAR(255) NOT NULL
);
CREATE TABLE BatchJob (
JobID CHAR(20) PRIMARY KEY,
Filter CHAR(20) NOT NULL,
- EMail CHAR(255) NOT NULL
+ EMail CHAR(255) NOT NULL,
+ FromHost Char(255) NOT NULL
);
CREATE TABLE Var (
@@ -54,3 +55,76 @@ CREATE TABLE Var (
);
INSERT INTO Var VALUES ("WatchDog", 0);
---
+
+CREATE TABLE ChrName (
+ AccNo CHAR(20) PRIMARY KEY,
+ name CHAR(20) NOT NULL
+);
+
+# hg19:
+INSERT INTO ChrName (AccNo, name) VALUES
+ ("NC_000001.10", "chr1"),
+ ("NC_000002.11", "chr2"),
+ ("NC_000003.11", "chr3"),
+ ("NC_000004.11", "chr4"),
+ ("NC_000005.9", "chr5"),
+ ("NC_000006.11", "chr6"),
+ ("NC_000007.13", "chr7"),
+ ("NC_000008.10", "chr8"),
+ ("NC_000009.11", "chr9"),
+ ("NC_000010.10", "chr10"),
+ ("NC_000011.9", "chr11"),
+ ("NC_000012.11", "chr12"),
+ ("NC_000013.10", "chr13"),
+ ("NC_000014.8", "chr14"),
+ ("NC_000015.9", "chr15"),
+ ("NC_000016.9", "chr16"),
+ ("NC_000017.10", "chr17"),
+ ("NC_000018.9", "chr18"),
+ ("NC_000019.9", "chr19"),
+ ("NC_000020.10", "chr20"),
+ ("NC_000021.8", "chr21"),
+ ("NC_000022.10", "chr22"),
+ ("NC_000023.10", "chrX"),
+ ("NC_000024.9", "chrY"),
+ ("NT_167244.1", "chr6_apd_hap1"),
+ ("NT_113891.2", "chr6_cox_hap2"),
+ ("NT_167245.1", "chr6_dbb_hap3"),
+ ("NT_167246.1", "chr6_mann_hap4"),
+ ("NT_167247.1", "chr6_mcf_hap5"),
+ ("NT_167248.1", "chr6_qbl_hap6"),
+ ("NT_167249.1", "chr6_ssto_hap7"),
+ ("NT_167250.1", "chr4_ctg9_hap1"),
+ ("NT_167251.1", "chr17_ctg5_hap1")
+;
+
+# hg18:
+INSERT INTO ChrName (AccNo, name) VALUES
+ ("NC_000001.9", "chr1"),
+ ("NC_000002.10", "chr2"),
+ ("NC_000003.10", "chr3"),
+ ("NC_000004.10", "chr4"),
+ ("NC_000005.8", "chr5"),
+ ("NC_000006.10", "chr6"),
+ ("NC_000007.12", "chr7"),
+ ("NC_000008.9", "chr8"),
+ ("NC_000009.10", "chr9"),
+ ("NC_000010.9", "chr10"),
+ ("NC_000011.8", "chr11"),
+ ("NC_000012.10", "chr12"),
+ ("NC_000013.9", "chr13"),
+ ("NC_000014.7", "chr14"),
+ ("NC_000015.8", "chr15"),
+ ("NC_000016.8", "chr16"),
+ ("NC_000017.9", "chr17"),
+ ("NC_000018.8", "chr18"),
+ ("NC_000019.8", "chr19"),
+ ("NC_000020.9", "chr20"),
+ ("NC_000021.7", "chr21"),
+ ("NC_000022.9", "chr22"),
+ ("NC_000023.9", "chrX"),
+ ("NC_000024.8", "chrY"),
+ ("NC_001807.4", "chrM"),
+ ("NT_113891.1", "chr6_cox_hap1"),
+ ("NT_113959.1", "chr22_h2_hap1")
+;
diff --git a/doc/API/api.conf b/doc/API/api.conf
new file mode 100644
index 00000000..f44efb94
--- /dev/null
+++ b/doc/API/api.conf
@@ -0,0 +1,105 @@
+[epydoc] # Epydoc section marker (required by ConfigParser)
+
+# modules
+# The list of objects to document. Objects can be named using
+# dotted names, module filenames, or package directory names.
+# Alases for this option include "objects" and "values".
+modules: ../../src/Modules, ../../src/*.py
+
+# output
+# The type of output that should be generated. Should be one
+# of: html, text, latex, dvi, ps, pdf.
+output: pdf
+
+# target
+# The path to the output directory. May be relative or absolute.
+target: api/
+
+# docformat
+# The default markup language for docstrings, for modules that do
+# not define __docformat__. Defaults to epytext.
+docformat: epytext
+
+# css
+# The CSS stylesheet for HTML output. Can be the name of a builtin
+# stylesheet, or the name of a file.
+#css: white
+
+# name
+# The documented project's name.
+name: Mutalyzer 2.0
+
+# url
+# The documented project's URL.
+url: http://www.mutalyzer.nl/2.0/
+
+# link
+# HTML code for the project link in the navigation bar. If left
+# unspecified, the project link will be generated based on the
+# project's name and URL.
+#link: <a href="somewhere">My Cool Project</a>
+
+# top
+# The "top" page for the documentation. Can be a URL, the name
+# of a module or class, or one of the special names "trees.html",
+# "indices.html", or "help.html"
+top: ../../src
+
+# help
+# An alternative help file. The named file should contain the
+# body of an HTML file; navigation bars will be added to it.
+#help: my_helpfile.html
+
+# frames
+# Whether or not to include a frames-based table of contents.
+#frames: yes
+
+# private
+# Whether or not to inclue private variables. (Even if included,
+# private variables will be hidden by default.)
+private: yes
+
+# imports
+# Whether or not to list each module's imports.
+imports: no
+
+# verbosity
+# An integer indicating how verbose epydoc should be. The default
+# value is 0; negative values will supress warnings and errors;
+# positive values will give more verbose output.
+verbosity: 0
+
+# parse
+# Whether or not parsing should be used to examine objects.
+parse: yes
+
+# introspect
+# Whether or not introspection should be used to examine objects.
+introspect: no
+
+# graph
+# The list of graph types that should be automatically included
+# in the output. Graphs are generated using the Graphviz "dot"
+# executable. Graph types include: "classtree", "callgraph",
+# "umlclass". Use "all" to include all graph types
+graph: all
+
+# dotpath
+# The path to the Graphviz "dot" executable, used to generate
+# graphs.
+dotpath: /usr/local/bin/dot
+
+# sourcecode
+# Whether or not to include syntax highlighted source code in
+# the output (HTML only).
+#sourcecode: yes
+
+# pstat
+# The name of one or more pstat files (generated by the profile
+# or hotshot module). These are used to generate call graphs.
+pstat: profile.out
+
+# separate-classes
+# Whether each class should be listed in its own section when
+# generating LaTeX or PDF output.
+separate-classes: no
diff --git a/doc/API/mkapidoc.sh b/doc/API/mkapidoc.sh
new file mode 100644
index 00000000..9ae6c00f
--- /dev/null
+++ b/doc/API/mkapidoc.sh
@@ -0,0 +1,5 @@
+#!/bin/sh
+
+epydoc --config api.conf
+mv api/api.pdf .
+rm -rf api/
diff --git a/doc/TechnicalReference/Makefile b/doc/TechnicalReference/Makefile
new file mode 100644
index 00000000..50239034
--- /dev/null
+++ b/doc/TechnicalReference/Makefile
@@ -0,0 +1,37 @@
+# General Makefile for LaTeX documents by J. F. J. Laros.
+# Last alteration on 15-10-2009.
+#
+# The packages texlive-base-bin, texlive-latex-base and ghostscript should
+# be installed.
+#
+
+LATEX = latex
+BIBTEX = bibtex
+DVIPS = dvips
+PS2PDF = ps2pdf14
+
+SRC := $(shell grep -H '\\begin{document' *.tex | cut -f 1 -d '.')
+
+BIB := $(shell grep '\\bibliography{' $(SRC).tex > /dev/null && \
+ grep '\\cite{' $(SRC).tex)
+
+all: $(SRC)
+
+$(SRC): $(SRC).tex
+ $(LATEX) $^
+ifdef BIB
+ $(BIBTEX) $(SRC)
+endif
+ $(LATEX) $^
+ $(LATEX) $^
+ $(DVIPS) $(SRC).dvi -o $(SRC).ps
+
+release: $(SRC) clean
+ $(PS2PDF) $(SRC).ps
+ rm -f $(SRC).ps
+
+clean:
+ rm -f *.aux $(SRC).bbl $(SRC).blg $(SRC).dvi $(SRC).log $(SRC).toc
+
+distclean: clean
+ rm -f $(SRC).ps $(SRC).pdf
diff --git a/doc/TechnicalReference/TechnicalReference.tex b/doc/TechnicalReference/TechnicalReference.tex
new file mode 100644
index 00000000..b0e832b5
--- /dev/null
+++ b/doc/TechnicalReference/TechnicalReference.tex
@@ -0,0 +1,69 @@
+\newcommand{\thisversion}{2.0}
+
+\documentclass{article}
+\usepackage{amssymb, amsthm, graphicx, float, textcomp}
+\title{\Huge Mutalyzer \thisversion\ Technical Reference Manual}
+\author{Jeroen F. J. Laros
+ \vspace{10pt}\\
+ Department of Human Genetics\\
+ Center for Human and Clinical Genetics\\
+ \texttt{j.f.j.laros@lumc.nl}}
+\date{\today}
+\frenchspacing
+
+\newtheorem{theorem}{Theorem}
+\newtheorem{lemma}[theorem]{Lemma}
+\newtheorem{corollary}[theorem]{Corollary}
+
+\theoremstyle{definition}
+\newtheorem{example}[theorem]{Example}
+\newtheorem{definition}[]{Definition}
+\newtheorem{remark}[theorem]{Remark}
+\newtheorem{conjecture}[theorem]{Conjecture}
+
+\begin{document}
+
+\maketitle
+\thispagestyle{empty}
+\newpage
+
+\pagenumbering{roman}
+\tableofcontents
+\newpage
+
+\pagenumbering{arabic}
+
+\section{Introduction}\label{sec:introduction}
+This document is intended for developers.
+
+\section{Modules}\label{sec:modules}
+Mutalyzer \thisversion\ blabla.
+\subsection{Config}\label{subsec:config}
+\subsection{Output}\label{subsec:output}
+\subsection{Db}\label{subsec:db}
+\subsection{Retriever}\label{subsec:retriever}
+\subsection{Mutator}\label{subsec:mutator}
+\subsection{Scheduler}\label{subsec:scheduler}
+\subsection{GenRecord}\label{subsec:genrecord}
+\subsection{Web}\label{subsec:web}
+\subsection{Misc}\label{subsec:misc}
+
+\section{Programs}\label{sec:programs}
+\subsection{Mutalyzer}\label{subsec:mutalyzer}
+\subsection{VarInfo}\label{subsec:varinfo}
+\subsection{UCSC\_Update}\label{subsec:ucsc_update}
+
+\section{Interfaces}\label{sec:interfaces}
+% handler.py
+\subsection{Web}\label{subsec:webinterface}
+% index.py
+\subsubsection{TAL}
+% templates/
+\subsection{Webservices}\label{subsec:webservinterface}
+% webservice.py
+\subsection{Command line}\label{subsec:commandline}
+
+\bibliography{bibliography}{}
+\bibliographystyle{plain}
+
+\end{document}
diff --git a/doc/TechnicalReference/bibliography.bib b/doc/TechnicalReference/bibliography.bib
new file mode 100644
index 00000000..e69de29b
diff --git a/errorcodes.txt b/errorcodes.txt
index e54c44a1..b8d0a590 100644
--- a/errorcodes.txt
+++ b/errorcodes.txt
@@ -1,34 +1,39 @@
Information:
-INFO | Information.
+INFO | N | Information.
Warnings:
-WSTART | Mutation in the start codon.
-WTXSTART | Mutation hits transcription start.
-WSPLDON | Mutation hits a splice donor site.
-WSPLACC | Mutation hits a splice acceptor site.
-WROLL | Variant position is ambiguous and not the last one was given.
-WINSDUP | Variant was described as an insertion, but it is a duplication.
-WNOMRNA | No mRNA field was found in the GenBank record.
-WNOCDS | No CDS field was found in the GenBank record.
-WNOVER | No accession version number was given.
-WHASH | Hash of a GenBank record has changed.
+WSTART | E | Mutation in the start codon.
+WTXSTART | E | Mutation hits transcription start.
+WSPLDON | E | Mutation hits a splice donor site.
+WSPLACC | E | Mutation hits a splice acceptor site.
+WROLL | D | Variant position is ambiguous and not the last one was given.
+WINSDUP | D | Variant was described as an insertion, but it is a
+ duplication.
+WNOMRNA | R | No mRNA field was found in the GenBank record.
+WNOCDS | R | No CDS field was found in the GenBank record.
+WNOCDSLIST | R | No CDS list was found in the GenBank record.
+WNOVER | R | No accession version number was given.
+WHASH | N | Hash of a GenBank record has changed.
+WNOCHANGE | D | Variant equals reference sequence.
+WNOTMINIMAL | D | A shorter description of a raw variant is possible.
Errors:
-EARGLEN | There was a discrepancy between the range and the length of the
- | optional argument.
-EREF | There was a discrepancy between the reference sequence and the
- | optional argument.
-ENOCHANGE | Mutation has no effect.
-ENOTMINIMAL | A shorter description of a raw variant is possible.
-EINSRANGE | The positions of an insertion are not consecutive.
-ENOCDS | No CDS field was found in the GenBank record and none could be
- | constructed.
+ENOVAR | D | No mutation given.
+EARGLEN | D | There was a discrepancy between the range and the length of
+ the optional argument.
+EREF | D | There was a discrepancy between the reference sequence and the
+ optional argument.
+EINSRANGE | D | The positions of an insertion are not consecutive.
+WNOCDS | R | No CDS field was found in the GenBank record and none could
+ be constructed.
+ENOGENE | R | Gene not found.
+ESTOP | R | In frame stop codon found.
Fatal errors:
-EPARSE | Nomenclature parse error.
-ERECPARSE | GenBank record parse error.
-EARG |
-EFILESIZE | The filesize is either too large or too small.
-ERETR | Could not retrieve a GenBank record.
-EARG | Error in the arguments (of a webservice).
-ERANGE | Position out of range (webservice).
+EPARSE | D | Nomenclature parse error.
+EBPARSE | D | Parse error in the submitted batch file.
+ERECPARSE | R | GenBank record parse error.
+EFILESIZE | N | The filesize is either too large or too small.
+ERETR | R | Could not retrieve a GenBank record.
+EARG | N | Error in the arguments (of a webservice).
+ERANGE | D | Position out of range (webservice).
diff --git a/install.sh b/install.sh
index 1b0fc907..71f3a7e2 100644
--- a/install.sh
+++ b/install.sh
@@ -1,22 +1,40 @@
#!/bin/sh
-script="UCSC_update.py"
-cron_entry="25 6 \* \* \* python `pwd`/src/$script"
+updateCron() {
+ cron_entry="$1 python `pwd`/src/$2.py"
+
+ if ! `crontab -l | grep "$cron_entry" > /dev/null`; then
+ echo "Updating cron entry."
+ if `crontab -l | grep $2 > /dev/null`; then
+ echo "Removing old entry."
+ crontab -l | grep -v $2 | crontab
+ fi
+ echo "Installing new entry."
+ (
+ crontab -l
+ echo $cron_entry
+ ) | crontab
+ fi
+}
if `echo $0 | grep '/' > /dev/null`; then
echo "Please run this script from the installation directory."
exit 1
fi
-if ! `crontab -l | grep "$cron_entry" > /dev/null`; then
- echo "Updating cron entry."
- if `crontab -l | grep $script > /dev/null`; then
- echo "Removing old entry."
- crontab -l | grep -v $script | crontab
- fi
- echo "Installing new entry."
- (
- crontab -l
- echo $cron_entry
- ) | crontab
-fi
+updateCron "25 6 \* \* \*" "UCSC_update"
+updateCron "*/1 \* \* \* \*" "BatchChecker"
+
+cat << EOF > .htaccess
+SetHandler mod_python
+PythonHandler src/handler
+PythonPath "sys.path + ['`pwd`/src']"
+PythonDebug On
+
+RewriteEngine on
+RewriteRule Variant_info.php Variant_info
+EOF
+
+chmod go+rx . src src/Modules templates
+chmod go+r .htaccess mutalyzer.conf src/*.py src/Modules/*.py templates/*
+chmod go+rw var
diff --git a/mutalyzer.conf b/mutalyzer.conf
index 6e3112b5..6a7950dc 100644
--- a/mutalyzer.conf
+++ b/mutalyzer.conf
@@ -3,6 +3,7 @@
#
+#
# These settings are used by the Retriever module.
#
@@ -22,6 +23,7 @@ maxDldSize = 10
minDldSize = 512
+#
# These settings are used by the Db module.
#
@@ -34,6 +36,9 @@ dbNames = "hg18", "hg19"
# MySQL username for the local databases (inernalDb and dnNames).
LocalMySQLuser = "mutalyzer"
+# Host name for the local databases.
+LocalMySQLhost = "localhost"
+
# MySQL username for the UCSC database.
RemoteMySQLuser = "genome"
@@ -47,6 +52,7 @@ UpdateInterval = 7
TempFile = "./var/UCSC_Update.txt"
+#
# These settings are used by the Output module.
#
@@ -72,6 +78,7 @@ loglevel = 3
outputlevel = 1
+#
# These settings are used by the Mutator module.
#
@@ -85,11 +92,46 @@ maxvissize = 25
flankclipsize = 6
+#
# These settings are used by the Scheduler module.
#
-# Watchdog timeout in seconds.
-watchDogTimeOut = 60
-
# Name of the batch process.
processName = "MutalyzerBatch2"
+
+# Return e-mail address.
+mailFrom = "noreply@humgen.nl"
+
+# Location of the mail template.
+mailMessage = "./mail.txt"
+
+# Subject of the message.
+mailSubject = "Result of Mutalyzer batch check."
+
+# Location of the results.
+resultsDir = "./var/cache"
+
+
+#
+# These settings are used by the File module.
+#
+
+# Amount of bytes to be read for determining the file type.
+bufSize = 32768
+
+# The obligatory header in batch request files.
+header = "AccNo", "Genesymbol", "Mutation"
+
+# Directory for temporary files.
+tempDir = "./var"
+
+
+#
+# These settings are used by the GenRecord module.
+#
+
+# Number of upstream nucleotides when searching for a transcript.
+upstream = 5000
+
+# Number of downstream nucleotides when searching for a transcript.
+downstream = 2000
diff --git a/src/BatchChecker.py b/src/BatchChecker.py
index da992a89..b22e740f 100644
--- a/src/BatchChecker.py
+++ b/src/BatchChecker.py
@@ -7,11 +7,11 @@ if len(sys.argv[0].split('/')) > 2 :
os.chdir(sys.argv[0].rsplit('/', 2)[0])
from Modules import Config
-from Modules import Db
+from Modules.Db import Batch
from Modules import Scheduler
C = Config.Config()
-D = Db.Db("local", C.Db.internalDb, C.Db)
+D = Batch(C.Db)
S = Scheduler.Scheduler(C.Scheduler, D)
if not S.isDaemonRunning() :
diff --git a/src/Modules/Config.py b/src/Modules/Config.py
index 7e3ffa36..f8ff8d40 100644
--- a/src/Modules/Config.py
+++ b/src/Modules/Config.py
@@ -1,62 +1,137 @@
#!/usr/bin/python
+"""
+ Module for reading the config file and splitting up the variables into
+ subclasses. Each of these subclasses are used to configure a specific
+ module.
+
+ Public classes:
+ Config ; Read the configuration file and store the data in subclasses.
+"""
+
class Config() :
"""
- Read the configuration file and store the data.
-
- Public variables:
- # Used by the Retriever module:
- email ; Email address used for Entrez.
- cache ; Location of the cache directory.
- cachesize ; Maximum size of the cache directory in bytes.
- maxDldSize ; Maximum size of a GenBank record in bytes.
- minDldSize ; Minimum size of a GenBank record in bytes.
-
- # Used by the Db module:
- internalDb ; Name of the internal database.
- dbNames ; Name of the mapping databases
- LocalMySQLuser ; Username for the local databases.
- RemoteMySQLuser ; Username for the remote UCSC database.
- RemoteMySQLhost ; Hostname of the UCSC database server.
- UpdateInterval ; Time window (in days) to search for updates.
- TempFile ; Location for downloaded updates.
-
- # Used by the Output module:
- log ; Name and location of the logfile.
- datestring ; Prefix for log messages.
-
- # Used by the Mutator module:
- flanksize ; Length of the flanking sequences in the
- visualisation.
- maxvissize ; Maximum length of the variation in the
- visualisation.
- flankclipsize ; Length of the inserted/deleted flanks.
+ Read the configuration file and store the data in subclasses.
+ Public subclasses:
+ Retriever ; Container for the Retriever configuration variables.
+ Db ; Container for the Db configuration variables.
+ Output ; Container for the Output configuration variables.
+ Mutator ; Container for the Mutator configuration variables.
+ Scheduler ; Container for the Scheduler configuration variables.
+ File ; Container for the File configuration variables.
+ GenRecord ; Container for the File configuration variables.
Special Methods:
- __init__ ; Read the configuration file.
+ __init__ ; Read the configuration file and initialise the
+ subclasses.
"""
class Retriever() :
+ """
+ Container class for the Retriever configuration variables.
+
+ Public variables:
+ email ; Email address used for Entrez.
+ cache ; Location of the cache directory.
+ cachesize ; Maximum size of the cache directory in bytes.
+ maxDldSize ; Maximum size of a GenBank record in bytes.
+ minDldSize ; Minimum size of a GenBank record in bytes.
+ """
+
pass
#Retriever
class Db() :
- pass
+ """
+ Container class for the Db configuration variables.
+
+ Public variables:
+ internalDb ; Name of the internal database.
+ dbNames ; Name of the mapping databases
+ LocalMySQLuser ; Username for the local databases.
+ LocalMySQLhost ; Hostname of the local databases.
+
+ RemoteMySQLuser ; Username for the remote UCSC database.
+ RemoteMySQLhost ; Hostname of the UCSC database server.
+ UpdateInterval ; Time window (in days) to search for
+ updates.
+ TempFile ; Location for downloaded updates.
+ """
#Db
class Output() :
+ """
+ Container class for the Output configuration variables.
+
+ Public variables:
+ log ; Name and location of the logfile.
+ datestring ; Prefix for log messages.
+ loglevel ; Default level for logging.
+ outputlevel ; Default level for output.
+ """
+
pass
#Output
class Mutator() :
+ """
+ Container class for the Mutator configuration variables.
+
+ Public variables:
+ flanksize ; Length of the flanking sequences in the
+ visualisation.
+ maxvissize ; Maximum length of the variation in the
+ visualisation.
+ flankclipsize ; Length of the inserted/deleted flanks.
+ """
+
pass
#Mutator
class Scheduler() :
+ """
+ Container class for the Scheduler configuration variables.
+
+ Public variables:
+ processName ; Name of the scheduler in the process list.
+ mailFrom ; Return e-mail address.
+ mailMessage ; Template e-mail.
+ mailSubject ; Subject of the e-mail.
+ resultsDir ; Location of the results.
+ """
+
pass
#Scheduler
+ class File() :
+ """
+ Container class for the File configuration variables.
+
+ Public variables:
+ bufSize ; Amount of bytes to be read for determining the file
+ type.
+ header ; The obligatory header in batch request files.
+ tempDir ; Directory for temporary files.
+ """
+
+ pass
+ #File
+
+ class GenRecord() :
+ """
+ Container class for the GenRecord configuration variables.
+
+ Public variables:
+ upstream ; Number of upstream nucleotides when searching for a
+ transcript.
+ downstream ; Number of downstream nucleotides when searching for a
+ transcript.
+ """
+
+ pass
+ #File
+
def __init__(self) :
"""
Initialise the class with variables read from the configuration
@@ -64,33 +139,12 @@ class Config() :
hard coded constant is used (the name and path to the configuration
file).
- Public variables (altered):
- # Used by the Retriever module:
- email ; Email address used for Entrez.
- cache ; Location of the cache directory.
- cachesize ; Maximum size of the cache directory in bytes.
- maxDldSize ; Maximum size of a GenBank record in bytes.
- minDldSize ; Minimum size of a GenBank record in bytes.
-
- # Used by the Db module:
- internalDb ; Name of the internal database.
- dbNames ; Name of the mapping databases
- LocalMySQLuser ; Username for the local databases.
- RemoteMySQLuser ; Username for the remote UCSC database.
- RemoteMySQLhost ; Hostname of the UCSC database server.
- UpdateInterval ; Time window (in days) to search for updates.
- TempFile ; Location for downloaded updates.
-
- # Used by the Output module:
- log ; Name and location of the logfile.
- datestring ; Prefix for log messages.
-
- # Used by the Mutator module:
- flanksize ; Length of the flanking sequences in the
- visualisation.
- maxvissize ; Maximum length of the variation in the
- visualisation.
- flankclipsize ; Length of the inserted/deleted flanks.
+ Public subclasses (altered):
+ Retriever ; Initialised with Retriever configuration variables.
+ Db ; Initialised with Db configuration variables.
+ Output ; Initialised with Output configuration variables.
+ Mutator ; Initialised with Mutator configuration variables.
+ Scheduler ; Initialised with Scheduler configuration variables.
"""
from configobj import ConfigObj # ConfigObj()
@@ -106,7 +160,9 @@ class Config() :
# Set the variables needed by the Db module.
self.Db.internalDb = config["internalDb"]
self.Db.dbNames = config["dbNames"]
+
self.Db.LocalMySQLuser = config["LocalMySQLuser"]
+ self.Db.LocalMySQLhost = config["LocalMySQLhost"]
self.Db.RemoteMySQLuser = config["RemoteMySQLuser"]
self.Db.RemoteMySQLhost = config["RemoteMySQLhost"]
self.Db.UpdateInterval = int(config["UpdateInterval"])
@@ -124,8 +180,20 @@ class Config() :
self.Mutator.flankclipsize = int(config["flankclipsize"])
# Set the variables needed by the Scheduler module.
- self.Scheduler.watchDogTimeOut = int(config["watchDogTimeOut"])
self.Scheduler.processName = config["processName"]
+ self.Scheduler.mailFrom = config["mailFrom"]
+ self.Scheduler.mailMessage = config["mailMessage"]
+ self.Scheduler.mailSubject = config["mailSubject"]
+ self.Scheduler.resultsDir = config["resultsDir"]
+
+ # Set the variables needed by the File module.
+ self.File.bufSize = int(config["bufSize"])
+ self.File.header = config["header"]
+ self.File.tempDir = config["tempDir"]
+
+ # Set the variables needed by the GenRecord module.
+ self.File.upstream = int(config["upstream"])
+ self.File.downstream = int(config["downstream"])
#__init__
#Config
diff --git a/src/Modules/Crossmap.py b/src/Modules/Crossmap.py
index 58e336b5..37ccf01e 100644
--- a/src/Modules/Crossmap.py
+++ b/src/Modules/Crossmap.py
@@ -1,5 +1,15 @@
#!/usr/bin/python
+"""
+ Module for conversion from genomic coordinates to coding sequence
+ orientated coordinates and vice versa.
+ The conversions are done based upon a list of splice sites, the CDS start
+ and stop and the orientation of a transcript.
+
+ Public classes:
+ Crossmap ; Convert from g. to c. or n. notation or vice versa.
+"""
+
class Crossmap() :
"""
Convert from g. to c. or n. notation or vice versa.
diff --git a/src/Modules/Db.py b/src/Modules/Db.py
index a1abc211..ada5573a 100644
--- a/src/Modules/Db.py
+++ b/src/Modules/Db.py
@@ -1,13 +1,34 @@
#!/usr/bin/python
+"""
+ Module for database access.
+ The Db class is a superclass of the rest of the classes and should not be
+ used as such. The superclass mainly consists of a wrapper for SQL
+ statements.
+
+
+ Public classes:
+ Db ; Log in to a database and keep it open for queries.
+ Mapping ; Mapping of transcripts and genes.
+ Remote ; Retrieving updates for the mapping databases.
+ Update ; Updating the mapping databases.
+ Cache ; Cache administration.
+ Batch ; Batch checker.
+"""
+
import MySQLdb # connect(), escape_string()
import types # TupleType
-import time
+import time # strftime()
+import os # os.remove()
-#from Output import Output
-import os # os.remove()
+from Modules import Misc # ID()
-from Modules import Misc
+#
+# Note that compound queries are split into single queries because of a bug
+# in MySQLdb. The functions load_Update(), merge_cdsUpdates() and
+# merge_Update (search for MYSQL_BUG in this file) are affected and may be
+# rewritten when this bug is fixed.
+#
class Db() :
"""
@@ -17,116 +38,30 @@ class Db() :
__db ; Interface to the database.
Special methods:
- __init__(config, where) ; Do the login.
-
- Private methods:
- __query(statement) ; General query function.
+ __init__(dbName, mySqlUser, mySqlHost) ; Do the login.
Public methods:
- # For mapping.
- get_protAcc(mrnaAcc) ; Query the database for a protein ID.
- get_NM_info(mrnaAcc) ; Retrieve various data for an NM number.
- get_NM_version(mrnaAcc) ; Get the version number of an accession
- number.
- get_Transcripts(chrom, ; Get a list of transcripts, given a
- position, chromosome and a range.
- overlap)
- get_GeneName(mrnaAcc) ; Get the gene name, given an NM number.
- isChrom(name) ; Check whether we know this name to be
- a chromosome name.
-
- # For updating mapping information
- get_Update() ; Retrieve new mapping info from the UCSC.
- load_Update() ; Load new mapping info into the local
- database.
- count_Updates() ; Count the number of entries in the new
- mapping info table.
- backup_cdsUpdates() ; Make a backup of updates that overwrite
- the old mapping info.
- count_cdsUpdates() ; Count the number of updates that
- overwrite the old mapping info.
- merge_cdsUpdates() ; Merge the backup of old mapping info
- with the other old info.
- merge_Update() ; Merge the new mapping info from the
- UCSC with what we already have.
-
- # For cache administration.
- insertGB(AccNo, GI, md5, ; Insert info about a GenBank record.
- ChrAccVer,
- ChrStart,
- ChrStop,
- orientation,
- url)
- updateHash(AccNo, md5) ; Update the hash of an accession number.
- getGBFromLoc(ChrAccVer, ; Get the accession number from slicing
- ChrStart, information.
- ChrStop,
- orientation)
- getGBFromHash(md5) ; Get the accession number from its hash.
- getGBFromGI(GI) ; Get the accession number from its GI
- number.
- getLoc(AccNo) ; Get the slicing information of an
- accession number.
- getHash(AccNo) ; Get the hash of a GenBank record.
- getUrl(AccNo) ; Get the URL of an accession number.
-
- Inherited from Output.Config:
- internalDb ; Name of the internal database.
- RemoteMySQLuser ; MySQL username for the UCSC database.
- RemoteMySQLhost ; Host name for the UCSC database.
- LocalMySQLuser ; MySQL username for the local databases.
- UpdateInterval ; The size of the time window.
- TempFile ; The name and location of the temporary file. This
- file is created if it doesn't exist and is
- overwritten if it does exist. The function
- load_Update() will remove this file.
+ query(statement) ; General query function.
"""
- #
- # Note that compound queries are split into single queries because of a bug
- # in MySQLdb. The functions load_Update(), merge_cdsUpdates() and
- # merge_Update (search for MYSQL_BUG in this file) are affected and may be
- # rewritten when this bug is fixed.
- #
-
- def __init__(self, where, dbName, config) :
+ def __init__(self, dbName, mySqlUser, mySqlHost) :
"""
- Log in to the database. The username and the name of the
- database are given in the configuration file.
+ Log in to the database.
Arguments:
- where ; A switch to see which database to use:
- local ; Use the database on localhost.
- remote ; Use the UCSC database.
- dbName ; The name of the database to use (hg18 or hg19).
+ dbName ; The name of the database to use.
+ mySqlUser ; User name for the database.
+ mySqlHost ; Host name for the database.
Private variables (altered):
__db ; The interface to the database.
-
- Inherited variables from Output.Config:
- internalDb ; Name of the internal database.
- RemoteMySQLuser ; MySQL username for the UCSC database.
- RemoteMySQLhost ; Host name for the UCSC database.
- LocalMySQLuser ; MySQL username for the local databases.
"""
- #Output.__init__(self, __file__)
- self.__config = config
-
- self.opened = False
- if dbName in self.__config.dbNames or dbName == self.__config.internalDb :
- if where == "remote" :
- self.__db = MySQLdb.connect(user = self.__config.RemoteMySQLuser,
- db = dbName,
- host = self.__config.RemoteMySQLhost)
- else :
- self.__db = MySQLdb.connect(user = self.__config.LocalMySQLuser,
- db = dbName)
- self.opened = True
- #if
+ self.__db = MySQLdb.connect(user = mySqlUser, db = dbName,
+ host = mySqlHost)
#__init__
- def __query(self, statement) :
+ def query(self, statement) :
"""
Query the database.
@@ -167,11 +102,47 @@ class Db() :
cursor.close()
return result
- #__query
+ #query
+#Db
+
+class Mapping(Db) :
+ """
+ Database functions for mapping of transcripts and genes.
+
+ Special methods:
+ __init__(build, config) ; Initialise the class.
+
+ Public methods:
+ get_protAcc(mrnaAcc) ; Query the database for a protein ID.
+ get_NM_info(mrnaAcc) ; Retrieve various data for an NM number.
+ get_NM_version(mrnaAcc) ; Get the version number of an accession
+ number.
+ get_Transcripts(chrom, ; Get a list of transcripts, given a
+ position, chromosome and a range.
+ overlap)
+ get_GeneName(mrnaAcc) ; Get the gene name, given an NM number.
+ isChrom(name) ; Check whether we know this name to be
+ a chromosome name.
+
+ Inherited methods from Db:
+ query(statement) ; General query function.
+
+ SQL tables from dbNames:
+ map ; Accumulated mapping info.
+ """
+
+ def __init__(self, build, config) :
+ """
+ Initialise the Db parent class. Use the local database for a
+ certain build.
- #
- # These methods are used for mapping.
- #
+ Arguments:
+ build ; The version of the mapping database.
+ config ; Configuration variables.
+ """
+
+ Db.__init__(self, build, config.LocalMySQLuser, config.LocalMySQLhost)
+ #__init__
def get_protAcc(self, mrnaAcc) :
"""
@@ -193,7 +164,7 @@ class Db() :
WHERE acc = %s;
""", mrnaAcc
- return self.__query(statement)[0][0]
+ return self.query(statement)[0][0]
#get_protAcc
def get_NM_info(self, mrnaAcc) :
@@ -222,7 +193,7 @@ class Db() :
WHERE acc = %s;
""", mrnaAcc
- return self.__query(statement)[0]
+ return self.query(statement)[0]
#get_NM_info
def get_NM_version(self, mrnaAcc) :
@@ -245,7 +216,7 @@ class Db() :
WHERE acc = %s;
""", mrnaAcc
- ret = self.__query(statement)
+ ret = self.query(statement)
if ret :
return int(ret[0][0])
return 0
@@ -295,7 +266,7 @@ class Db() :
#else
ret = [] # Convert the results to a normal list.
- for i in self.__query(statement) :
+ for i in self.query(statement) :
ret.append(i[0] + '.' + str(self.get_NM_version(i[0])))
return ret
#get_Transcripts
@@ -320,7 +291,7 @@ class Db() :
WHERE acc = %s;
""", mrnaAcc
- return self.__query(statement)[0][0]
+ return self.query(statement)[0][0]
#get_GeneName
def isChrom(self, name) :
@@ -344,14 +315,96 @@ class Db() :
WHERE chrom = %s;
""", name
- if int(self.__query(statement)[0][0]) > 0 :
+ if int(self.query(statement)[0][0]) > 0 :
return True
return False
#isChrom
- #
- # These methods are used for updating the mapping information.
- #
+ def chromName(self, accNo) :
+ """
+ Get the name of a chromosome, given an accession number.
+
+ Arguments:
+ accNo ; The accession number of a chromosome.
+
+ SQL tables from dbNames:
+ ChrName ; Assembly release notes.
+
+ Returns:
+ string ; The name of a chromosome.
+ """
+
+ statement = """
+ SELECT name
+ FROM ChrName
+ WHERE AccNo = %s;
+ """, accNo
+
+ return self.query(statement)[0][0]
+ #chromName
+
+ def chromAcc(self, name) :
+ """
+ Get the accession number of a chromosome, given a name.
+
+ Arguments:
+ name ; The name of a chromosome.
+
+ SQL tables from dbNames:
+ ChrName ; Assembly release notes.
+
+ Returns:
+ string ; The accession number of a chromosome.
+ """
+
+ statement = """
+ SELECT AccNo
+ FROM ChrName
+ WHERE name = %s;
+ """, name
+
+ return self.query(statement)[0][0]
+ #chromAcc
+#Mapper
+
+class Remote(Db) :
+ """
+ Database functions for retrieving updates for the mapping databases.
+
+ Special methods:
+ __init__(config) ; Initialise the class.
+
+ Public methods:
+ get_Update() ; Retrieve new mapping info from the UCSC.
+
+ Inherited methods from Db:
+ query(statement) ; General query function.
+
+ SQL tables from dbNames:
+ gbStatus ; acc -> version mapping (NM to NM + version),
+ type, modDate
+ refGene ; name -> geneName mapping (NM to gene name),
+ txStart, txEnd, cdsStart, cdsEnd, exonStarts,
+ exonEnds, chrom, strand.
+ refLink ; mrnaAcc -> protAcc mapping (NM to NP).
+ """
+
+ def __init__(self, build, config) :
+ """
+ Initialise the Db parent class. Use the remote database for a
+ certain build.
+
+ Arguments:
+ build ; The version of the mapping database.
+ config ; Configuration variables.
+
+ Private variables (altered):
+ __config ; Configuration variables.
+ """
+
+ self.__config = config
+ Db.__init__(self, build, config.RemoteMySQLuser, config.RemoteMySQLhost)
+ #__init__
def get_Update(self) :
"""
@@ -364,13 +417,6 @@ class Db() :
the load_Update() function.
- Inherited variables from Output.Config:
- UpdateInterval ; The size of the time window.
- TempFile ; The name and location of the temporary file.
- This file is created if it doesn't exist and
- is overwritten if it does exist. The function
- load_Update() will remove this file.
-
SQL tables from dbNames:
gbStatus ; acc -> version mapping (NM to NM + version),
type, modDate
@@ -394,7 +440,7 @@ class Db() :
handle = open(self.__config.TempFile, "w")
# Convert the results to a tab delimited file.
- for i in self.__query(statement) :
+ for i in self.query(statement) :
for j in i :
handle.write(str(j) + chr(0x09)) # 0x09 is a TAB.
handle.write('\n')
@@ -402,6 +448,53 @@ class Db() :
handle.close()
#get_Update
+#Remote
+
+class Update(Db) :
+ """
+ Database functions for updating the mapping databases.
+
+ Public methods:
+ load_Update() ; Load new mapping info into the local database.
+ count_Updates() ; Count the number of entries in the new
+ mapping info table.
+ backup_cdsUpdates() ; Make a backup of updates that overwrite the
+ old mapping info.
+ count_cdsUpdates() ; Count the number of updates that overwrite
+ the old mapping info.
+ merge_cdsUpdates() ; Merge the backup of old mapping info with the
+ other old info.
+ merge_Update() ; Merge the new mapping info from the UCSC with
+ what we already have.
+
+ Inherited methods from Db:
+ query(statement) ; General query function.
+
+ SQL tables from dbNames:
+ map ; Accumulated mapping info.
+ map_temp ; Newly found data.
+ map_new ; Merge of map_temp and map.
+ map_cdsBackup_temp ; Entries that were updated without an increment
+ of the version number.
+ map_cdsBackup ; Merge of map_cdsBackup_temp and itself.
+ """
+
+ def __init__(self, build, config) :
+ """
+ Initialise the Db parent class. Use the remote database for a
+ certain build.
+
+ Arguments:
+ build ; The version of the mapping database.
+ config ; Configuration variables.
+
+ Private variables (altered):
+ __config ; Configuration variables.
+ """
+
+ self.__config = config
+ Db.__init__(self, build, config.LocalMySQLuser, config.LocalMySQLhost)
+ #__init__
def load_Update(self) :
"""
@@ -409,12 +502,6 @@ class Db() :
configuration file) created by the get_Update() function and import
it in the local database.
- Inherited variables from Config:
- TempFile ; The name and location of the temporary file. This
- file is created by the get_Update() function. After
- the local import is complete, this file will be
- removed.
-
SQL tables from dbNames (altered):
map_temp ; Created and loaded with data from TempFile.
@@ -428,13 +515,13 @@ class Db() :
statement = """
CREATE TABLE map_temp LIKE map;
""", None
- self.__query(statement)
+ self.query(statement)
statement = """
LOAD DATA LOCAL INFILE %s
INTO TABLE map_temp;
""", self.__config.TempFile
- self.__query(statement)
+ self.query(statement)
os.remove(self.__config.TempFile)
#load_Update
@@ -457,7 +544,7 @@ class Db() :
FROM map_temp;
""", None
- return int(self.__query(statement)[0][0])
+ return int(self.query(statement)[0][0])
#count_Updates
def backup_cdsUpdates(self) :
@@ -490,7 +577,7 @@ class Db() :
);
""", None
- self.__query(statement)
+ self.query(statement)
#backup_cdsUpdates
def count_cdsUpdates(self) :
@@ -514,7 +601,7 @@ class Db() :
FROM map_cdsBackup_temp;
""", None
- return int(self.__query(statement)[0][0])
+ return int(self.query(statement)[0][0])
#count_cdsUpdates
def merge_cdsUpdates(self) :
@@ -537,12 +624,12 @@ class Db() :
SELECT *
FROM map_cdsBackup_temp;
""", None
- self.__query(statement)
+ self.query(statement)
statement = """
DROP TABLE map_cdsBackup_temp;
""", None
- self.__query(statement)
+ self.query(statement)
#merge_cdsUpdates
def merge_Update(self) :
@@ -574,38 +661,83 @@ class Db() :
AND map.txStart = map_temp.txStart
);
""", None
- self.__query(statement)
+ self.query(statement)
statement = """
DROP TABLE map;
""", None
- self.__query(statement)
+ self.query(statement)
statement = """
CREATE TABLE map
SELECT *
FROM map_new;
""", None
- self.__query(statement)
+ self.query(statement)
statement = """
DROP TABLE map_new;
""", None
- self.__query(statement)
+ self.query(statement)
statement = """
DROP TABLE map_temp;
""", None
- self.__query(statement)
+ self.query(statement)
#merge_Update
+#Update
- #
- # These methods are used for cache administration.
- #
+class Cache(Db) :
+ """
+ Database functions for cache administration.
- def insertGB(self, AccNo, GI, md5, ChrAccVer, ChrStart,
+ Special methods:
+ __init__(config) ; Initialise the class.
+
+ Public methods:
+ insertGB(accNo, GI, ; Insert info about a GenBank record.
+ fileHash,
+ ChrAccVer,
+ ChrStart,
+ ChrStop,
+ orientation,
+ url)
+ updateHash(accNo, ; Update the hash of an accession number.
+ fileHash)
+ getGBFromLoc(ChrAccVer, ; Get the accession number from slicing
+ ChrStart, information.
+ ChrStop,
+ orientation)
+ getGBFromHash(fileHash) ; Get the accession number from its hash.
+ getGBFromGI(GI) ; Get the accession number from its GI
+ number.
+ getLoc(accNo) ; Get the slicing information of an
+ accession number.
+ getHash(accNo) ; Get the hash of a GenBank record.
+ getUrl(accNo) ; Get the URL of an accession number.
+
+ Inherited methods from Db:
+ query(statement) ; General query function.
+
+ SQL tables from internalDb:
+ GBInfo ; Information about cached and uploaded GenBank files.
+ """
+
+ def __init__(self, config) :
+ """
+ Initialise the Db parent class. Use the internalDb.
+
+ Arguments:
+ config ; Configuration variables.
+ """
+
+ Db.__init__(self, config.internalDb, config.LocalMySQLuser,
+ config.LocalMySQLhost)
+ #__init__
+
+ def insertGB(self, accNo, GI, fileHash, ChrAccVer, ChrStart,
ChrStop, orientation, url) :
"""
Insert information about a GenBank record in the internal database.
- The AccNo and md5 arguments are mandatory.
+ The accNo and fileHash arguments are mandatory.
- If the record is a normal RefSeq, then the GI number should be
provided.
- If the record is a chromosome slice, then the ChrAccVer,
@@ -616,9 +748,9 @@ class Db() :
is assumed to be uploaded.
Arguments:
- AccNo ; The name associated with this record.
+ accNo ; The name associated with this record.
GI ; The GI number (if available).
- md5 ; The md5sum of the content of the record.
+ fileHash ; The hash of the content of the record.
ChrAccVer ; The accession number of the chromosome (if
available).
ChrStart ; The start of the record in chromosomal
@@ -637,18 +769,19 @@ class Db() :
statement = """
INSERT INTO GBInfo
VALUES (%s, %s, %s, %s, %s, %s, %s, %s);
- """, (AccNo, GI, md5, ChrAccVer, ChrStart, ChrStop, orientation, url)
+ """, (accNo, GI, fileHash, ChrAccVer, ChrStart, ChrStop, orientation,
+ url)
- self.__query(statement)
+ self.query(statement)
#insertGB
- def updateHash(self, AccNo, md5) :
+ def updateHash(self, accNo, fileHash) :
"""
Update the hash of an accession number.
Arguments:
- AccNo ; The accession number of a GenBank record.
- hash ; The hash of a GenBank record.
+ accNo ; The accession number of a GenBank record.
+ fileHash ; The hash of a GenBank record.
SQL tables from internalDb (altered):
GBInfo ; Information about cached and uploaded GenBank files.
@@ -658,9 +791,9 @@ class Db() :
UPDATE GBInfo
SET hash = %s
WHERE AccNo = %s;
- """, (md5, AccNo)
+ """, (fileHash, accNo)
- self.__query(statement)
+ self.query(statement)
#updateHash
def getGBFromLoc(self, ChrAccVer, ChrStart, ChrStop, orientation) :
@@ -692,18 +825,18 @@ class Db() :
AND orientation = %s;
""", (ChrAccVer, ChrStart, ChrStop, orientation)
- ret = self.__query(statement)
+ ret = self.query(statement)
if ret :
return ret[0][0]
return None
#getGBFromLoc
- def getGBFromHash(self, md5) :
+ def getGBFromHash(self, fileHash) :
"""
Get the accession number from its hash.
Arguments:
- hash ; The hash of a GenBank record.
+ fileHash ; The hash of a GenBank record.
SQL tables from internalDb:
GBInfo ; Information about cached and uploaded GenBank files.
@@ -716,9 +849,9 @@ class Db() :
SELECT AccNo
FROM GBInfo
WHERE hash = %s;
- """, md5
+ """, fileHash
- ret = self.__query(statement)
+ ret = self.query(statement)
if ret :
return ret[0][0]
return None
@@ -745,19 +878,19 @@ class Db() :
WHERE GI = %s;
""", GI
- ret = self.__query(statement)
+ ret = self.query(statement)
if ret :
return ret[0][0]
return None
#getGBFromGI
- def getLoc(self, AccNo) :
+ def getLoc(self, accNo) :
"""
Get the slicing information of an accession number, typically this
only affects UD numbers.
Arguments:
- AccNo ; The accession number of a genbank record.
+ accNo ; The accession number of a genbank record.
SQL tables from internalDb:
GBInfo ; Information about cached and uploaded GenBank files.
@@ -775,20 +908,20 @@ class Db() :
SELECT ChrAccVer, ChrStart, ChrStop, orientation
FROM GBInfo
WHERE AccNo = %s;
- """, AccNo
+ """, accNo
- ret = self.__query(statement)
+ ret = self.query(statement)
if ret :
return list(ret[0])
return None
#getLoc
- def getHash(self, AccNo) :
+ def getHash(self, accNo) :
"""
Get the hash of a GenBank record identified by an accession number.
Arguments:
- AccNo ; The accession number of a genbank record.
+ accNo ; The accession number of a genbank record.
SQL tables from internalDb:
GBInfo ; Information about cached and uploaded GenBank files.
@@ -801,21 +934,21 @@ class Db() :
SELECT hash
FROM GBInfo
WHERE AccNo = %s;
- """, AccNo
+ """, accNo
- ret = self.__query(statement)
+ ret = self.query(statement)
if ret :
return ret[0][0]
return None
#getHash
- def getUrl(self, AccNo) :
+ def getUrl(self, accNo) :
"""
Get the URL of an accession number, typically this only affects
uploaded UD numbers.
Arguments:
- AccNo ; The accession number of a genbank record.
+ accNo ; The accession number of a genbank record.
SQL tables from internalDb:
GBInfo ; Information about cached and uploaded GenBank files.
@@ -828,61 +961,89 @@ class Db() :
SELECT url
FROM GBInfo
WHERE AccNo = %s;
- """, AccNo
+ """, accNo
- ret = self.__query(statement)
+ ret = self.query(statement)
if ret :
return ret[0][0]
return None
#getHash
- def getGI(self, AccNo) :
+ def getGI(self, accNo) :
"""
+ Get the GI number that is connected to the accession number.
+
+ Arguments:
+ accNo ; The accession number.
+
+ SQL tables from internalDb:
+ GBInfo ; Information about cached and uploaded GenBank files.
"""
+
statement = """
SELECT GI
FROM GBInfo
WHERE AccNo = %s;
- """, AccNo
+ """, accNo
- ret = self.__query(statement)
+ ret = self.query(statement)
if ret :
return ret[0][0]
return None
#getGI
+#Cache
- #
- # These methods are for the batch checker.
- #
+class Batch(Db) :
+ """
+ Database functions for the batch checker.
- def getWatchDogTimer(self) :
- """
- """
+ Special methods:
+ __init__(config) ; Initialise the class.
- statement = """
- SELECT Value
- FROM Var
- WHERE Name = "WatchDog";
- """, None
+ Public methods:
+ isJobListEmpty() ; See if there are active jobs.
+ addJob(outputFilter, ; Add a job and give it a unique ID.
+ email,
+ fromHost)
+ getJobs() ; Get a list of active jobs.
+ removeJob(jobID) ; Remove a job and return information about
+ the job submitter.
+ addToQueue(jobID, ; Add a request belonging to a certain job to
+ accNo, the queue.
+ gene,
+ variant)
+ getFromQueue(jobID) ; Get a request belonging to a certain job
+ from the queue.
+
+ Inherited methods from Db:
+ query(statement) ; General query function.
- return int(self.__query(statement)[0][0])
- #getWatchDogTimer
+ SQL tables from internalDb:
+ BatchJob ; Job information.
+ BatchQueue ; Requests.
+ """
- def setWatchDogTimer(self) :
- """
+ def __init__(self, config) :
"""
+ Initialise the Db parent class. Use the internalDb.
- statement = """
- UPDATE Var
- SET Value = %s
- WHERE Name = "WatchDog";
- """, time.strftime("%s")
+ Arguments:
+ config ; Configuration variables.
+ """
- self.__query(statement)
- #setWatchDogTimer
+ Db.__init__(self, config.internalDb, config.LocalMySQLuser,
+ config.LocalMySQLhost)
+ #__init__
def isJobListEmpty(self) :
"""
+ See if there are active jobs.
+
+ SQL tables from internalDb:
+ BatchJob ; Job information.
+
+ Returns:
+ boolean ; False if there are active jobs, True otherwise.
"""
statement = """
@@ -890,13 +1051,24 @@ class Db() :
FROM BatchJob;
""", None
- if int(self.__query(statement)[0][0]) :
+ if int(self.query(statement)[0][0]) :
return False
return True
#isJobListEmpty
- def addJob(self, output_filter, email) :
+ def addJob(self, outputFilter, email, fromHost) :
"""
+ Add a job and give it a unique ID.
+
+ Arguments:
+ outputFilter ; Output settings for all requests in this job.
+ email ; Contact information of the submitter.
+
+ SQL tables from internalDb (altered):
+ BatchJob ; Job information.
+
+ Returns:
+ int ; A job ID.
"""
M = Misc.Misc()
@@ -904,15 +1076,22 @@ class Db() :
del M
statement = """
INSERT INTO BatchJob
- VALUES (%s, %s, %s);
- """, (jobID, output_filter, email)
+ VALUES (%s, %s, %s, %s);
+ """, (jobID, outputFilter, email, fromHost)
- self.__query(statement)
+ self.query(statement)
return jobID
#addJob
def getJobs(self) :
"""
+ Get a list of active jobs.
+
+ SQL tables from internalDb:
+ BatchJob ; Job information.
+
+ Returns:
+ list ; List of job IDs.
"""
statement = """
@@ -921,46 +1100,85 @@ class Db() :
""", None
ret = []
- for i in self.__query(statement) :
+ for i in self.query(statement) :
ret.append(i[0])
return ret
#getJobs
def removeJob(self, jobID) :
"""
- """
+ Remove a job (because the queue for this job is empty) and return
+ information needed to alert the job submitter.
+
+ Arguments:
+ jobID ; Identifier of a job.
+
+ SQL tables from internalDb (altered):
+ BatchJob ; Job information.
+ Returns:
+ triple ; Data for the job submitter.
+ """
+
+ # First retrieve all information about this job.
statement = """
- SELECT EMail
+ SELECT EMail, Filter, FromHost
FROM BatchJob
WHERE JobID = %s;
""", jobID
- eMail = self.__query(statement)[0][0]
+ data = self.query(statement)[0]
+ # Remove the job.
statement = """
DELETE
FROM BatchJob
WHERE JobID = %s;
""", jobID
- self.__query(statement)
- return eMail
+ self.query(statement)
+ return data
#removeJob
- def addToQueue(self, jobID, AccNo, Gene, Variant) :
+ def addToQueue(self, jobID, accNo, gene, variant) :
"""
+ Add a request belonging to a certain job to the queue.
+
+ Arguments:
+ jobID ; Identifier of a job.
+ accNo ; The accession number of a request.
+ gene ; The gene and transcript variant information.
+ variant ; The variant.
+
+ SQL tables from internalDb (altered):
+ BatchQueue ; Requests.
"""
+ # The first value (QueueID) will be auto increased by MySQL.
statement = """
INSERT INTO BatchQueue
VALUES (%s, %s, %s, %s, %s);
- """, (None, jobID, AccNo, Gene, Variant)
+ """, (None, jobID, accNo, gene, variant)
- self.__query(statement)
+ self.query(statement)
#addToQueue
def getFromQueue(self, jobID) :
"""
+ Get a request belonging to a certain job from the queue. If a
+ request is found, remove it from the queue and return it. Otherwise
+ return nothing.
+
+ Arguments:
+ jobID ; Identifier of a job.
+
+ SQL tables from internalDb (altered):
+ BatchQueue ; Requests.
+
+ Returns:
+ triple:
+ accNo ; The accession number of a request.
+ gene ; The gene and transcript variant information.
+ variant ; The variant.
"""
statement = """
@@ -971,35 +1189,27 @@ class Db() :
LIMIT 1;
""", jobID
- results = self.__query(statement)
+ results = self.query(statement)
if results :
- queueID, accNo, gene, variant = results[0]
+ jobID, accNo, gene, variant = results[0]
else :
return None
+ # We have found a request, so remove it from the queue.
statement = """
DELETE
FROM BatchQueue
WHERE QueueID = %s;
- """, queueID
+ """, jobID
- self.__query(statement)
+ self.query(statement)
return accNo, gene, variant
#getFromQueue
-#Db
+#Batch
#
# Unit test.
#
if __name__ == "__main__" :
- # Get the username / db from the config file.
- D = Db("local")
-
- # Do some basic testing (will crash if MySQL is not set up properly.
- D.get_protAcc("NM_002001")
- D.get_NM_info("NM_002001")
- D.get_NM_version("NM_002001")
- D.get_Transcripts("chr1", 159272155, 159272155, 0)
- D.get_GeneName("NM_002001")
- del D
+ pass
#if
diff --git a/src/Modules/File.py b/src/Modules/File.py
new file mode 100644
index 00000000..713b399b
--- /dev/null
+++ b/src/Modules/File.py
@@ -0,0 +1,322 @@
+#!/usr/bin/python
+
+"""
+ Module for parsing CSV files and spreadsheets.
+
+ Public classes:
+ File ; Parse CSV files and spreadsheets.
+"""
+
+import magic # open(), MAGIC_MIME, MAGIC_NONE
+import csv # Sniffer(), reader(), Error
+import xlrd # open_workbook()
+import zipfile # ZipFile()
+import xml.dom.minidom # parseString()
+import os # remove()
+import types # UnicodeType
+
+from Modules import Misc
+
+class File() :
+ """
+ Parse CSV files and spreadsheets.
+
+ Private variables:
+ __config ; Configuration variables.
+ __output ; The Output object.
+
+ Special methods:
+ __init__(config, output) ; Initialse the class.
+
+ Private methods:
+ __tempFileWrapper(func, ; Call func() with a filename.
+ handle)
+ __getMimeType(handle) ; Get the mime type of a stream.
+ __parseCsvFile(handle) ; Parse a CSV file.
+ __parseXlsFile(handle) ; Parse an Excel file.
+ __parseOdsFile(handle) ; Parse an OpenDocument Spreadsheet file.
+ __checkBatchFormat(job) ; Check a batch job and sanitize it.
+
+ Public methods:
+ parseFileRaw(handle) ; Parse a stream with the appropriate parser.
+ parseBatchFile(handle) ; Parse a stream with the appropriate parser
+ and sanitize the output.
+ """
+
+ def __init__(self, config, output) :
+ """
+ Initialise the class.
+
+ Private variables (altered):
+ __config ; Initialised with configuration variables.
+ __output ; Set to the Output object.
+ """
+
+ self.__config = config
+ self.__output = output
+ #__init__
+
+ def __tempFileWrapper(self, func, handle) :
+ """
+ Make a temporary file, put the content of a stream in it and pass
+ the filename to a general function. Return whatever this function
+ returns.
+
+ Arguments:
+ func ; A general function that needs a file name as argument.
+ handle ; A stream.
+
+ Returns:
+ unknown ; The output of func().
+ """
+
+ # Generate an unique filename in the tempDir directory.
+ MiscInstance = Misc.Misc()
+ fileName = self.__config.tempDir + '/' + str(MiscInstance.ID())
+ del MiscInstance
+
+ # Dump the content of the stream pointed to by handle into the file.
+ handle.seek(0)
+ writeHandle = open(fileName, "w")
+ writeHandle.write(handle.read())
+ writeHandle.close()
+
+ # Open the file with func().
+ ret = func(fileName)
+ os.remove(fileName)
+
+ return ret
+ #__tempFileWrapper
+
+ def __getMimeType(self, handle) :
+ """
+ Get the mime type of a stream by inspecting a fixed number of bytes.
+ The stream is not rewinded after use.
+
+ Arguments:
+ handle ; A handle to a stream.
+
+ Private variables:
+ __config ; The bufSize configuration variables.
+
+ Returns:
+ string ; The mime type of a file.
+ """
+
+ handle.seek(0)
+ buf = handle.read(self.__config.bufSize)
+
+ MagicInstance = magic.open(magic.MAGIC_MIME)
+ MagicInstance.load()
+ mimeType = MagicInstance.buffer(buf).split(';')[0]
+ MagicInstance.close()
+ MagicInstance = magic.open(magic.MAGIC_NONE)
+ MagicInstance.load()
+ description = MagicInstance.buffer(buf)
+ del MagicInstance
+
+ return mimeType, description
+ #__getMimeType
+
+ def __parseCsvFile(self, handle) :
+ """
+ Parse a CSV file.
+ The stream is not rewinded after use.
+
+ Arguments:
+ handle ; A handle to a stream.
+
+ Private variables:
+ __config ; The bufSize configuration variables.
+
+ Returns:
+ list ; A list of lists.
+ """
+
+ handle.seek(0)
+ buf = handle.read(self.__config.bufSize)
+
+ try :
+ dialect = csv.Sniffer().sniff(buf)
+ except csv.Error, e :
+ self.__output.addMessage(__file__, 4, "EBPARSE", e)
+ return None
+ #except
+
+ handle.seek(0)
+ reader = csv.reader(handle, dialect)
+
+ ret = []
+ for i in reader :
+ ret.append(i)
+
+ return ret
+ #__parseCsvFile
+
+ def __parseXlsFile(self, handle) :
+ """
+ Parse an Excel file.
+ The stream is not rewinded after use.
+
+ Arguments:
+ handle ; A handle to a stream.
+
+ Returns:
+ list ; A list of lists.
+ """
+
+ workBook = self.__tempFileWrapper(xlrd.open_workbook, handle)
+ sheet = workBook.sheet_by_index(0)
+
+ ret = []
+ for i in range(sheet.nrows) :
+ row = []
+ for j in sheet.row_values(i) :
+ if type(j) == types.UnicodeType : # Convert the data to strings.
+ row.append(j.encode("utf8"))
+ else :
+ row.append(str(j))
+ #for
+ ret.append(row)
+ #for
+
+ del sheet, workBook
+
+ return ret
+ #__parseXlsFile
+
+ def __parseOdsFile(self, handle) :
+ """
+ Parse an OpenDocument Spreadsheet file.
+ The stream is not rewinded after use.
+
+ Arguments:
+ handle ; A handle to a stream.
+
+ Returns:
+ list ; A list of lists.
+
+ """
+
+ zipFile = self.__tempFileWrapper(zipfile.ZipFile, handle)
+ doc = xml.dom.minidom.parseString(zipFile.read("content.xml"))
+ zipFile.close()
+
+ ret = []
+ for i in doc.getElementsByTagName("table:table-row") :
+ row = []
+ for j in i.getElementsByTagName("table:table-cell") :
+ c = j.getElementsByTagName("text:p")
+ if c :
+ row.append(c[0].lastChild.data.encode("utf8"))
+ #if
+ #for
+ ret.append(row)
+ #for
+
+ return ret
+ #__parseOdsFile
+
+ def __checkBatchFormat(self, job) :
+ """
+ Check if a job is of the correct format.
+ - Each row should consist of three elements.
+ - The first and the last element should be non-zero.
+ - The first line should be the header defined in the config file.
+ - Silently ignore all empty lines.
+
+ Arguments:
+ job ; list of lists.
+
+ Private variables:
+ __config ; The header configuration variable.
+
+ Returns:
+ list ; A sanitised list of lists (without a header or empty
+ lines).
+ """
+
+ if job[0] != self.__config.header :
+ self.__output.addMessage(__file__, 4, "EBPARSE",
+ "Header not valid.")
+ return None
+ #if
+
+ for i in range(0, len(job)) :
+ if job[i] : # Non empty line.
+ if len(job[i]) == 3 :
+ if job[i][0] or job[i][1] or job[i][2] : # Non empty line.
+ if not job[i][0] :
+ self.__output.addMessage(__file__, 4, "EBPARSE",
+ "The first column may not be empty in line " \
+ "%i." % i)
+ return None
+ #if
+ if not job[i][2] :
+ self.__output.addMessage(__file__, 4, "EBPARSE",
+ "The last column may not be empty in line " \
+ "%i." % i)
+ return None
+ #if
+ #if
+ #if
+ else :
+ self.__output.addMessage(__file__, 4, "EBPARSE",
+ "Wrong amount of columns in line %i.\n" % i)
+ return None
+ #else
+ #if
+ #for
+
+ # All tests are passed, now we do some trimming.
+ ret = []
+ for i in range(1, len(job)) :
+ if job[i] and job[i] != ['', '', ''] :
+ ret.append(job[i])
+
+ return ret
+ #__checkBatchFormat
+
+ def parseFileRaw(self, handle) :
+ """
+ Check which format a stream has and parse it with the appropriate
+ parser if the stream is recognised.
+
+ Arguments:
+ handle ; A handle to a stream.
+
+ Returns:
+ list ; A list of lists, None if an error occured.
+ """
+
+ mimeType = self.__getMimeType(handle)
+ if mimeType[0] == "text/plain" :
+ return self.__parseCsvFile(handle)
+ if mimeType[0] == "application/vnd.ms-office" :
+ return self.__parseXlsFile(handle)
+ if mimeType == ("application/octet-stream",
+ "OpenDocument Spreadsheet") :
+ return self.__parseOdsFile(handle)
+
+ return None
+ #parseFile
+
+ def parseBatchFile(self, handle) :
+ """
+ Check which format a stream has and parse it with the appropriate
+ parser if the stream is recognised.
+
+ Arguments:
+ handle ; A handle to a stream.
+
+ Returns:
+ list ; A sanitised list of lists (without a header or empty
+ lines), or None if an error occured.
+ """
+
+ job = self.parseFileRaw(handle)
+ if job :
+ return self.__checkBatchFormat(job)
+ return None
+ #parseBatchFile
+#File
diff --git a/src/Modules/GenRecord.py b/src/Modules/GenRecord.py
index e8d21872..9af23978 100644
--- a/src/Modules/GenRecord.py
+++ b/src/Modules/GenRecord.py
@@ -1,6 +1,23 @@
#!/usr/bin/python
-class Plist(object) :
+import Crossmap
+import Bio
+
+"""
+ Module to convert a GenBank record to a nested dictionary consisting of
+ a list of genes, which itself consists of a list of loci. This structure
+ makes it possible to iterate over genes and transcripts without having to
+ search for them each time.
+
+ Public classes:
+ PList ; Store a general location and a list of splice sites.
+ Locus ; Store data about the mRNA and CDS splice sites.
+ Gene ; Store a list of Locus objects and the orientation.
+ Record ; Store a geneList and other additional information.
+ GenRecord ; Convert a GenBank record to a nested dictionary.
+"""
+
+class PList(object) :
"""
A position list object, to store a general location and a list of
specific splice sites (if available).
@@ -30,9 +47,9 @@ class Plist(object) :
"""
self.location = []
- self.list = []
+ self.positionList = []
#__init__
-#plist
+#PList
class Locus(object) :
"""
@@ -47,26 +64,42 @@ class Locus(object) :
exon ; A position list object.
"""
- def __init__(self) :
+ def __init__(self, name) :
"""
Initialise the class.
Public variables (altered):
- mRNA ; A position list object.
- CDS ; A position list object.
- exon ; A position list object.
- CM ; A Crossmap object.
+ mRNA ; A position list object.
+ CDS ; A position list object.
+ location ;
+ exon ; A position list object.
+ txTable ; The translation table.
+ CM ; A Crossmap object.
"""
+ self.name = name
self.mRNA = None
self.CDS = None
self.location = []
self.exon = None
self.txTable = 1
self.CM = None
-
+ self.transcriptID = None
+ self.proteinID = None
+ self.molType = 'c'
+ self.description = ""
#__init__
-#locus
+
+ def addToDescription(self, rawVariant) :
+ """
+ """
+
+ if self.description :
+ self.description = "%s;%s" % (self.description, rawVariant)
+ else :
+ self.description = rawVariant
+ #addToDescription
+#Locus
class Gene(object) :
"""
@@ -82,7 +115,7 @@ class Gene(object) :
list ; A list of Locus objects.
"""
- def __init__(self) :
+ def __init__(self, name) :
"""
Initialise the class.
@@ -91,21 +124,32 @@ class Gene(object) :
list ; A list of Locus objects.
"""
- self.orientation = 0
- self.list = {}
+ self.name = name
+ self.orientation = 1
+ self.transcriptList = []
#__init__
-#gene
-class RecordObj(object) :
+ def findLocus(self, name) :
+ """
+ """
+
+ for i in self.transcriptList :
+ if i.name == name :
+ return i
+ return None
+ #findLocus
+#Gene
+
+class Record(object) :
"""
- A RecordObj object, to store a genelist and other additional
+ A Record object, to store a geneList and other additional
information.
Special methods:
__init__() ; Initialise the class.
Public variables:
- genelist ; List of Gene objects.
+ geneList ; List of Gene objects.
mol_type ; Variable to indicate the sequence type (DNA, RNA, ...)
organelle ; Variable to indicate whether the sequence is from the
nucleus or from an onganelle (if so, also from which
@@ -120,7 +164,7 @@ class RecordObj(object) :
Public variables (altered):
- genelist ; List of Gene objects.
+ geneList ; List of Gene objects.
mol_type ; Variable to indicate the sequence type (DNA, RNA,
...)
organelle ; Variable to indicate whether the sequence is from
@@ -130,16 +174,36 @@ class RecordObj(object) :
information is present.
"""
- self.genelist = {}
+ self.geneList = []
self.mol_type = None
self.organelle = None
- self.source = Gene()
+ self.source = Gene(None)
#__init__
-#RecordObj
+
+ def hasGene(self, name) :
+ """
+ """
+
+ for i in self.geneList :
+ if i.name == name :
+ return True
+ return False
+ #hasGene
+
+ def findGene(self, name) :
+ """
+ """
+
+ for i in self.geneList :
+ if i.name == name :
+ return i
+ return None
+ #findGene
+#Record
class GenRecord() :
"""
- Hmmmm.
+ Convert a GenBank record to a nested dictionary.
Private methods:
__location2pos(location) ;
@@ -150,6 +214,15 @@ class GenRecord() :
structured dictionary.
"""
+ def __init__(self, config, output) :
+ """
+ """
+
+ self.__config = config
+ self.__output = output
+ self.record = None
+ #__init__
+
def __location2pos(self, location) :
"""
Convert a location object to a tuple of integers.
@@ -184,6 +257,10 @@ class GenRecord() :
ret = []
for i in locationList.sub_features :
+ if i.ref : # This is a workaround for a bug in BioPython.
+ ret = None
+ break
+ #if
temp = self.__location2pos(i.location)
ret.append(temp[0])
ret.append(temp[1])
@@ -192,51 +269,74 @@ class GenRecord() :
return ret
#__locationList2posList
- """
- def __sortins(self, position, posList) :
- last = 0
-
- for i in range(0, len(posList), 2) :
- if position[0] == posList[i] :
- return posList
- if position[0] > last and position[0] < posList[i] :
- return posList[:i] + position + posList[i:]
- last = posList[i]
- #for
- return posList + position
- #__sortins
- """
+ def __constructCDS(self, mRNA, CDSpos) :
+ """
+ """
+
+ i = 1
+ ret = [CDSpos[0]]
+
+ while CDSpos[0] > mRNA[i] :
+ i += 2
+
+ j = i
+ while CDSpos[1] > mRNA[j] :
+ j += 2
+
+ ret.extend(mRNA[i:j])
+ ret.append(CDSpos[1])
- def record2dict(self, record) :
- recordDict = RecordObj()
- #recordDict.genelist = {}
+ return ret
+ #__constructCDS
+
+ def __maybeInvert(self, gene, string) :
+ """
+ """
+
+ if gene.orientation == -1 :
+ return Bio.Seq.reverse_complement(string)
+ return string
+ #__maybeInvert
+
+ def parseRecord(self, record) :
+ """
+ Convert a GenBank record to a nested dictionary.
+
+ Arguments:
+ record ; A GenBank record.
+
+ Returns:
+ dict ; A nested dictionary.
+ """
+
+ self.record = Record()
for i in record.features :
if i.qualifiers :
if i.type == "source" :
if i.qualifiers.has_key("organelle") :
- recordDict.organelle = i.qualifiers["organelle"][0]
+ self.record.organelle = i.qualifiers["organelle"][0]
if i.qualifiers.has_key("mol_type") :
- recordDict.mol_type = i.qualifiers["mol_type"][0]
+ self.record.mol_type = i.qualifiers["mol_type"][0]
- #recordDict["null"] = Gene()
- recordDict.source.orientation = 1
- recordDict.source.list["001"] = Locus()
- recordDict.source.list["001"].CDS = Plist()
- recordDict.source.list["001"].CDS.location = \
- self.__location2pos(i.location)
+ fakeGene = Locus("001")
+ self.record.source.transcriptList.append(fakeGene)
+ fakeGene.CDS = PList()
+ fakeGene.CDS.location = self.__location2pos(i.location)
+ #if
if i.qualifiers.has_key("gene") :
gene = i.qualifiers["gene"][0]
- if not recordDict.genelist.has_key(gene) :
- recordDict.genelist[gene] = Gene()
+
+ GeneInstance = self.record.findGene(gene)
+ if not GeneInstance :
+ GeneInstance = Gene(gene)
+ self.record.geneList.append(GeneInstance)
+ #if
+
if i.type == "gene" :
if i.strand :
- recordDict.genelist[gene].orientation = i.strand
- else :
- recordDict.genelist[gene].orientation = 1
-
- recordDict.genelist[gene].location = \
- self.__location2pos(i.location)
+ GeneInstance.orientation = i.strand
+ GeneInstance.location = self.__location2pos(i.location)
#if
# Look if there is a locus tag present, if not, give it the
@@ -244,73 +344,152 @@ class GenRecord() :
locus_tag = "001"
if i.qualifiers.has_key("locus_tag") :
locus_tag = i.qualifiers["locus_tag"][0][-3:]
- if not recordDict.genelist[gene].list.has_key(locus_tag) :
- recordDict.genelist[gene].list[locus_tag] = Locus()
+
+ LocusInstance = GeneInstance.findLocus(locus_tag)
+ if not LocusInstance :
+ LocusInstance = Locus(locus_tag)
+ GeneInstance.transcriptList.append(LocusInstance)
+ #if
if i.type == "mRNA" :
- recordDict.genelist[gene].list[locus_tag].mRNA = Plist()
- recordDict.genelist[gene].list[locus_tag].mRNA.location = \
- self.__location2pos(i.location)
- recordDict.genelist[gene].list[locus_tag].mRNA.list = \
- self.__locationList2posList(i)
+ PListInstance = PList()
+ LocusInstance.mRNA = PListInstance
+
+ posList = self.__locationList2posList(i)
+ if posList != None :
+ PListInstance.location = \
+ self.__location2pos(i.location)
+ PListInstance.positionList = posList
+ #if
+
#if
if i.type == "CDS" :
- recordDict.genelist[gene].list[locus_tag].CDS = Plist()
- recordDict.genelist[gene].list[locus_tag].CDS.location = \
- self.__location2pos(i.location)
- recordDict.genelist[gene].list[locus_tag].CDS.list = \
+ PListInstance = PList()
+ LocusInstance.CDS = PListInstance
+
+ PListInstance.location = self.__location2pos(i.location)
+ PListInstance.positionList = \
self.__locationList2posList(i)
+
if i.qualifiers.has_key("transl_table") :
- recordDict.genelist[gene].list[locus_tag].txTable = \
+ LocusInstance.txTable = \
int(i.qualifiers["transl_table"][0])
#if
if i.type == "exon" :
- if not recordDict.genelist[gene].list[locus_tag].exon :
- recordDict.genelist[gene].list[locus_tag].exon = Plist()
- recordDict.genelist[gene].list[locus_tag].exon.list.extend(
+ if not LocusInstance.exon :
+ PListInstance = PList()
+ LocusInstance.exon = PListInstance
+ #if
+ PListInstance.positionList.extend(
self.__location2pos(i.location))
+ #if
#if
#if
#for
- return recordDict
- #record2dict
-
- def printRecordDict(self, d, record) :
- for i in d :
- print i
- print " Orientation: " + str(d[i].orientation)
- for j in d[i].list :
- print " Locus: " + str(j)
- if d[i].list[j].mRNA :
- print " mRNA: "
- print " " + str(d[i].list[j].mRNA.location)
- if d[i].list[j].mRNA.list :
- print " " + str(d[i].list[j].mRNA.list)
- print splice(record, d[i].list[j].mRNA.list)
+ # Now we have gathered all information.
+ for i in self.record.geneList :
+ for j in i.transcriptList :
+ if not j.mRNA :
+ if not j.exon:
+ self.__output.addMessage(__file__, 2, "WNOMRNA",
+ "No mRNA field found for gene %s, transcript " \
+ "variant %s in GenBank record %s, constructing " \
+ "it from CDS." % (i.name, j.name, record.id))
+ if j.CDS :
+ if not j.CDS.positionList :
+ self.__output.addMessage(__file__, 2,
+ "WNOCDSLIST", "No CDS list found for " \
+ "gene %s, transcript variant %s in " \
+ "GenBank record %s, constructing it from " \
+ "CDS location." % (i.name, j.name,
+ record.id))
+ j.mRNA = j.CDS
+ j.mRNA.positionList = j.CDS.location
+ #if
+ else :
+ j.mRNA = j.CDS
+ #if
+ else :
+ self.__output.addMessage(__file__, 2, "WNOCDS",
+ "No CDS found for gene %s, transcript " \
+ "variant %s in GenBank record %s, " \
+ "constructing it from genelocation." % (
+ i.name, j.name, record.id))
+ j.CDS = GenRecord.Locus()
+ j.CDS.location = j.location
+ j.mRNA = j.CDS
+ j.mRNA.positionList = i.location
+ j.molType = 'n'
+ #else
#if
else :
- print splice(record, d[i].list[j].mRNA.location)
+ self.__output.addMessage(__file__, 2, "WNOMRNA",
+ "No mRNA field found for gene %s, transcript " \
+ "variant %s in GenBank record %s, constructing " \
+ "it from gathered exon information." % (
+ i.name, j.name, record.id))
+ j.mRNA = j.exon
+ #else
+ #if
+ if not j.mRNA.positionList :
+ j.mRNA.positionList = j.mRNA.location
+ if j.CDS :
+ if not j.CDS.positionList :
+ self.__output.addMessage(__file__, 2, "WNOCDS",
+ "No CDS list found for gene %s, transcript " \
+ "variant %s in GenBank record %s, constructing " \
+ "it from mRNA list and CDS location." % (i.name,
+ j.name, record.id))
+ if j.mRNA.positionList :
+ j.CDS.positionList = self.__constructCDS(
+ j.mRNA.positionList, j.CDS.location)
+ else :
+ j.CDS.positionList = self.__constructCDS(
+ j.mRNA.location, j.CDS.location)
+ #if
+ j.CM = Crossmap.Crossmap(j.mRNA.positionList,
+ j.CDS.location, i.orientation)
#if
- if d[i].list[j].CDS :
- print " CDS: "
- print " " + str(d[i].list[j].CDS.location)
- if d[i].list[j].CDS.list :
- print " " + str(d[i].list[j].CDS.list)
- print splice(record, d[i].list[j].CDS.list)
+ else :
+ j.molType = 'n'
+ if j.mRNA.positionList :
+ j.CM = Crossmap.Crossmap(j.mRNA.positionList,
+ [], i.orientation)
+ else :
+ j.description = '?'
+ #else
+ #for
+ #for
+ #parseRecord
+
+ def name(self, start, stop, varType, arg1, arg2) :
+ """
+ """
+
+ for i in self.record.geneList :
+ for j in i.transcriptList :
+ if j.CM :
+ if varType != "subst" :
+ if start != stop :
+ j.addToDescription("%s_%s%s%s" % (j.CM.g2c(start),
+ j.CM.g2c(stop), varType,
+ self.__maybeInvert(i, arg1)))
+ else :
+ j.addToDescription("%s%s%s" % (j.CM.g2c(start),
+ varType, self.__maybeInvert(i, arg1)))
#if
else :
- print splice(record, d[i].list[j].CDS.location)
+ j.addToDescription("%s%c>%c" % (j.CM.g2c(start),
+ self.__maybeInvert(i, arg1),
+ self.__maybeInvert(i, arg2)))
#if
#for
#for
- #printRecordDict
+ #name
#GenRecord
if __name__ == "__main__" :
R = GenRecord()
- bla = R._GenRecord__sortins([10, 20], [4, 5])
- print R._GenRecord__sortins([1, 2], bla)
- print R._GenRecord__sortins([8, 9], bla)
del R
#if
diff --git a/src/Modules/Mapper.py b/src/Modules/Mapper.py
index dbb836c1..a03e7005 100644
--- a/src/Modules/Mapper.py
+++ b/src/Modules/Mapper.py
@@ -30,7 +30,7 @@ from soaplib.serializers.primitive import String, Integer
from soaplib.serializers.clazz import ClassSerializer
class Mapping(ClassSerializer) :
- '''
+ """
Extended ClassSerializer object with mixed types of attributes
Attributes:
@@ -41,49 +41,69 @@ class Mapping(ClassSerializer) :
start_g ; Define the type of start_g value.
end_g ; Define the type of end_g value.
mutationType ; Define the type of mutation type
- '''
- class types :
- startmain = Integer
- startoffset = Integer
- endmain = Integer
- endoffset = Integer
- start_g = Integer
- end_g = Integer
+ """
+
+ class types() :
+ """
+ Types are defined here for the TC module.
+ """
+
+ startmain = Integer
+ startoffset = Integer
+ endmain = Integer
+ endoffset = Integer
+ start_g = Integer
+ end_g = Integer
mutationType = String
#types
-#Mapping
-# Any comments on the following statement??
-Mapping.typecode = TC.Struct(Mapping,
- [ TC.Integer('startmain'),
- TC.Integer('startoffset'),
- TC.Integer('endmain'),
- TC.Integer('endoffset'),
- TC.Integer('start_g'),
- TC.Integer('end_g'),
- TC.String('mutationType') ],
- 'Mapping')
+ def __init__(self) :
+ """
+ Types are defined here for the soaplib module.
+ """
+
+ self.typecode = TC.Struct(Mapping, [
+ TC.Integer('startmain'),
+ TC.Integer('startoffset'),
+ TC.Integer('endmain'),
+ TC.Integer('endoffset'),
+ TC.Integer('start_g'),
+ TC.Integer('end_g'),
+ TC.String('mutationType')
+ ], 'Mapping')
+ #__init__
+#Mapping
class Transcript(ClassSerializer) :
- '''
+ """
Extended ClassSerializer object with mixed types of attributes
Attributes:
trans_start ; Define the type of trans_start
trans_stop ; Define the type of trans_stop
CDS_stop ; Define the type of CDS_stop
- '''
- class types :
+ """
+
+ class types() :
+ """
+ """
+
trans_start = Integer
- trans_stop = Integer
- CDS_stop = Integer
+ trans_stop = Integer
+ CDS_stop = Integer
#types
+
+ def __init__(self) :
+ """
+ """
+
+ self.typecode = TC.Struct(Transcript, [
+ TC.Integer('trans_start'),
+ TC.Integer('trans_stop'),
+ TC.Integer('CDS_stop')
+ ], 'Transcript')
+ #__init__
#Transcript
-Transcript.typecode = TC.Struct(Transcript,
- [ TC.Integer('trans_start'),
- TC.Integer('trans_stop'),
- TC.Integer('CDS_stop') ],
- 'Transcript')
def __sl2il(l) :
"""
@@ -132,7 +152,7 @@ def __process(LOVD_ver, build, acc, var, Conf, O) :
# Make a connection to the MySQL database with the username / db
# information from the configuration file.
#Database = Db.Db("local", O) # Open the database.
- Database = Db.Db("local", build, Conf.Db)
+ Database = Db.Mapping(build, Conf.Db)
# Get the rest of the input variables.
@@ -199,7 +219,7 @@ def __process(LOVD_ver, build, acc, var, Conf, O) :
#__process
def conversionToCoding(offset, main, trans_start, trans_stop, CDS_stop) :
- '''
+ """
Converts c. (non-star) positions to c. numbered (star and +-) positions
Arguments:
@@ -216,7 +236,7 @@ def conversionToCoding(offset, main, trans_start, trans_stop, CDS_stop) :
(intronic position, +- notation)
cMain ; The main coordinate of a position in c. (star) notation.
- '''
+ """
cOffset = ""
cMain = main
if offset != "0" :
diff --git a/src/Modules/Misc.py b/src/Modules/Misc.py
index 98c08953..8f76dfc0 100644
--- a/src/Modules/Misc.py
+++ b/src/Modules/Misc.py
@@ -1,3 +1,8 @@
+#!/usr/bin/python
+
+"""
+"""
+
import time
class Misc() :
diff --git a/src/Modules/Mutator.py b/src/Modules/Mutator.py
index bdafa981..2893365c 100644
--- a/src/Modules/Mutator.py
+++ b/src/Modules/Mutator.py
@@ -1,6 +1,18 @@
#!/usr/bin/python
-#from Output import Output
+"""
+ Module for mutating a string.
+
+ Mutations are described in the original coordinates. These coordinates are
+ transfered to the mutated coordinates with the aid of an internal shift
+ list, which keeps track of the sizes of changes. Using the original
+ coordinates greatly simplifies combined mutations in a variant.
+
+ The original as well as the mutated string are stored.
+
+ Public classes:
+ Mutator ; Mutate a string and register all shift points.
+"""
class Mutator() :
"""
@@ -50,25 +62,26 @@ class Mutator() :
Initialise the class with the original string.
Arguments:
- orig ; The original string before mutation.
+ orig ; The original string before mutation.
+ config ; Configuration variables.
+ output ; The output object.
Private variables (altered):
- __shift ; Initialised to the empty list.
+ __config ; Initialised with the configuration variables.
+ __output ; Initialised with the output object.
+ __shift ; Initialised to the empty list.
Public variables (altered):
orig ; Initialised to the parameter orig.
mutated ; Initialised to the parameter orig.
"""
- #Output.__init__(self, __file__)
self.__config = config
self.__output = output
-
self.__shift = []
+
self.orig = orig
self.mutated = orig
-
- #self.output.createOutputNode("visualisation", 1) # Info message.
#__init__
def __sortins(self, tuple) :
@@ -122,6 +135,11 @@ class Mutator() :
pos2 ; The second interbase position of the deletion.
ins ; The insertion.
+ Private variables:
+ __config ; The variables maxvissize, flanksize and flankclipsize
+ are used in the visualisation.
+ __output ; Visualisation information is added.
+
Public variables (altered):
mutated ; This string will reflect the result of the given
delins.
@@ -135,24 +153,21 @@ class Mutator() :
odel = self.orig[pos1:pos2]
if len(odel) > self.__config.maxvissize :
odel = "%s [%ibp] %s" % (odel[:self.__config.flankclipsize],
- len(odel) - self.__config.flankclipsize * 2,
- odel[-self.__config.flankclipsize:])
+ len(odel) - self.__config.flankclipsize * 2,
+ odel[-self.__config.flankclipsize:])
bp1 = self.shiftpos(pos1)
bp2 = self.shiftpos(pos2)
lmflank = self.mutated[max(bp1 - self.__config.flanksize, 0):bp1]
rmflank = self.mutated[bp2:bp2 + self.__config.flanksize]
- #print
insvis = ins
if len(ins) > self.__config.maxvissize :
insvis = "%s [%ibp] %s" % (ins[:self.__config.flankclipsize],
- len(ins) - self.__config.flankclipsize * 2,
- ins[-self.__config.flankclipsize:])
+ len(ins) - self.__config.flankclipsize * 2,
+ ins[-self.__config.flankclipsize:])
fill = abs(len(odel) - len(insvis))
if len(odel) > len(ins) :
- #print "%s %s %s" % (loflank, odel, roflank)
- #print "%s %s%s %s" % (lmflank, insvis, '-' * fill, rmflank)
self.__output.addOutput("visualisation",
"%s %s %s" % (loflank, odel, roflank))
self.__output.addOutput("visualisation",
@@ -160,8 +175,6 @@ class Mutator() :
rmflank))
#if
else :
- #print "%s %s%s %s" % (loflank, odel, '-' * fill, roflank)
- #print "%s %s %s" % (lmflank, insvis, rmflank)
self.__output.addOutput("visualisation",
"%s %s%s %s" % (loflank, odel, '-' * fill,
roflank))
@@ -175,19 +188,6 @@ class Mutator() :
self.mutated = self.mutated[:self.shiftpos(pos1)] + ins + \
self.mutated[self.shiftpos(pos2):]
self.__sortins([pos1 + 1, len(ins) + pos1 - pos2])
-
- """
- from Bio import pairwise2
- po1 = max(pos1 - 25, 0) # Bug fix for mutations at the
- pm1 = max(self.shiftpos(pos1) - 25, 0) # start of a sequence.
-
- alignments = pairwise2.align.globalms(self.orig[po1:pos2 + 25],
- self.mutated[pm1:self.shiftpos(pos2) + 25],
- 1, -1, -2, -1)
- print
- print alignments[0][0]
- print alignments[0][1]
- """
#__mutate
def shiftpos(self, position) :
@@ -248,13 +248,16 @@ class Mutator() :
Arguments:
pos1 ; The first nucleotide of the range to be deleted.
pos2 ; The last nucleotide of the range to be deleted.
+
+ Private variables:
+ __output ; Visualisation information is added.
"""
if pos1 == pos2 :
self.__output.addOutput("visualisation", "deletion of %i" % pos1)
else :
self.__output.addOutput("visualisation", "deletion of %i to %i" % (
- pos1, pos2))
+ pos1, pos2))
self.__mutate(pos1 - 1, pos2, '')
#delM
@@ -266,10 +269,13 @@ class Mutator() :
pos ; The interbase position where the insertion should take
place.
ins ; The insertion, a string.
+
+ Private variables:
+ __output ; Visualisation information is added.
"""
- self.__output.addOutput("visualisation", "insertion between %i and %i" % (
- pos, pos + 1))
+ self.__output.addOutput("visualisation",
+ "insertion between %i and %i" % (pos, pos + 1))
self.__mutate(pos, pos, ins)
#insM
@@ -294,6 +300,9 @@ class Mutator() :
Arguments:
pos ; The position where the substitution should take place.
nuc ; The new nucleotide.
+
+ Private variables:
+ __output ; Visualisation information is added.
"""
self.__output.addOutput("visualisation", "substitution at %i" % pos)
@@ -340,84 +349,3 @@ class Mutator() :
if __name__ == "__main__" :
pass
#if
-"""
-import sys
-
-def ladder() :
- length = 79
-
- for i in range(length) :
- sys.stdout.write(str((i + 1) / 10))
- sys.stdout.write("\n")
- for i in range(length) :
- sys.stdout.write(str((i + 1) % 10))
- sys.stdout.write("\n")
-#ladder
-
-M = Mutator("AAAGCCACCAGTTTCTTCCATGTGTTTTCACTCGCTTCGAAAAATTTAGGTAGGCTCTAGATATC")
-
-M.invM(44, 50)
-print "Inv 44 50"
-ladder()
-print M.orig
-print M.mutated
-
-M.delinsM(34, 38, "TTTAAAATTTTAA")
-print "Delins 34 38 TTTAAAATTTTAA"
-ladder()
-print M.orig
-print M.mutated
-
-M.invM(24, 30)
-print "Inv 24 30"
-ladder()
-print M.orig
-print M.mutated
-
-M.delM(10, 10)
-print "Del 10"
-ladder()
-print M.orig
-print M.mutated
-
-M.subM(5, 'T')
-print "Sub 5 T"
-ladder()
-print M.orig
-print M.mutated
-
-M.insM(7, 'G')
-print "Ins 7_8 G"
-ladder()
-print M.orig
-print M.mutated
-print M._Mutator__shift
-
-M.delM(4, 8)
-print "Del 4 8"
-ladder()
-print M.orig
-print M.mutated
-M.insM(4, "TTTA")
-print "Ins 4 TTTA"
-ladder()
-print M.orig
-print M.mutated
-M.delM(4, 8)
-print "Del 4 8"
-ladder()
-print M.orig
-print M.mutated
-M.delinsM(4, 8, "TTTAAAATTTTAA")
-print "Delins 4 8 TTTAAAATTTTAA"
-ladder()
-print M.orig
-print M.mutated
-M.invM(24, 30,)
-print "Inv 24 30"
-ladder()
-print M.orig
-print M.mutated
-
-print M.newSplice([1, 10, 20, 30, 40])
-"""
diff --git a/src/Modules/Output.py b/src/Modules/Output.py
index 84cbe63f..44cddd08 100644
--- a/src/Modules/Output.py
+++ b/src/Modules/Output.py
@@ -1,23 +1,60 @@
#!/usr/bin/python
-#from Config import Config
-from time import strftime
+"""
+ Module for storing output and messages.
+ Output is stored as a named list that can be expanded.
+ Messages can be retrieved at a later time to provide flexibility. Message
+ levels are defined to increase or decrease the amount of logging and ouput.
+ The position of the log file, as well as the levels are defined in the
+ configuration file.
+
+ Message levels:
+ -1 : Log ; Specifically log a message.
+ 0 : Debug ; Debug information.
+ 1 : Info ; Info.
+ 2 : Warning ; Regular warnings.
+ 3 : Error ; Serious errors that can be compensated for.
+ 4 : Fatal ; Errors that are not recoverable.
+ 5 : Off ; Can be used as a log/output level to turn off output.
+
+ Public classes:
+ Message ; Container class for message variables.
+ Output ; Output interface for errors, warnings and logging.
+"""
+
+import time # strftime()
-class Node() :
- """
+class Message() :
"""
+ Container class for message variables.
- def __init__(self, level) :
- self.message = []
- self.level = level
- #__init__
-#Node
+ Special methods:
+ __init__(origin, level, code, description) ; Make a message object.
-class Message() :
- """
+ Public variables:
+ origin ; Name of the module creating this object.
+ level ; Importance of the message.
+ code ; The error code of the message.
+ description ; A description of the message.
"""
def __init__(self, origin, level, code, description) :
+ """
+ Make a new message object.
+
+ Arguments:
+ origin ; Name of the module creating this object.
+ level ; Importance of the message.
+ code ; The error code of the message.
+ description ; A description of the message.
+
+ Public variables (altered):
+ origin ; Name of the module creating this object.
+ level ; Importance of the message.
+ code ; The error code of the message.
+ description ; A description of the message.
+ """
+
self.origin = origin
self.level = level
self.code = code
@@ -25,39 +62,41 @@ class Message() :
#__init__
#Message
-#class Empty() :
-# def __len__(self) :
-# return 0
-
class Output() :
"""
Provide an output interface for errors, warnings and logging purposes.
Private variables:
+ __config ; Configuration variables.
+ __outputdata ; The output dictionary.
+ __messages ; The messages list.
__instance ; The name of the module that made this object.
__loghandle ; The handle of the log file.
- __datestring ; Format of the prefix for log messages.
__errors ; The number of errors that have been processed.
__warnings ; The number of warnings that have been processed.
Special methods:
- __init__(config, instance) ; Initialise the class with variables
+ __init__(instance, config) ; Initialise the class with variables
from the config file and the calling
module.
- __del__() ; Close the logfile.
+ __del__() ; Close the logfile and clean up.
Private methods:
__niceName(filename) ; Strip the path and the extention from a
filename.
+ __levelToName(level) ; Convert a log level to a readable string.
Public methods:
- ErrorMsg(filename, message) ; Print an error message to standard
- output and log it.
- WarningMsg(filename, message) ; Print an error message to standard
- output.
- LogMsg(filename, message) ; Log a message.
- Summary() ; Print a summary of the number of
- errors and warnings.
+ addMessage(filename, ; Add a message to the message list.
+ level,
+ code,
+ description)
+ getMessages() ; Print all messages that exceed the
+ configured output level.
+ addOutput(name, data) ; Add output to the output dictionary.
+ getOutput(name) ; Retrieve data from the output dictionary.
+ Summary() ; Print a summary of the number of errors
+ and warnings.
"""
def __init__(self, instance, config) :
@@ -66,26 +105,21 @@ class Output() :
config file and the calling module.
Arguments:
- config ; The configuration object.
instance ; The filename of the module that created this object.
-
- Public variables(altered):
- outputdata ; The output list.
+ config ; The configuration object.
Private variables (altered):
+ __config ; Configuration variables.
+ __outputdata ; The output dictionary.
+ __messages ; The messages list.
__instance ; Initialised with the name of the module that
created this object.
__loghandle ; Initialised as the handle of the log file
defined in the configuration file.
- __datestring ; Format of the prefix for log messages.
__errors ; Initialised to 0.
__warnings ; Initialised to 0.
-
- Inherited variables from Config:
- log ; Location of the log file.
"""
- #Config.__init__(self)
self.__config = config
self.__outputData = {}
self.__messages = []
@@ -93,26 +127,18 @@ class Output() :
self.__loghandle = open(self.__config.log, "a")
self.__errors = 0
self.__warnings = 0
-
-
- #self.createOutputNode("debug", 0)
- #self.createOutputNode("info", 1)
- #self.createOutputNode("warnings", 2)
- #self.createOutputNode("errors", 3)
- #self.createOutputNode("fatalerrors", 4)
- #self.createOutputNode("log", 5)
#__init__
def __del__(self) :
"""
- Clean up the output list and close the log file.
+ Clean up the output dictionary, the messages list and close the log
+ file.
- Public variables(altered):
- outputdata ; The output list.
-
Private variables(altered):
- __loghandle ; The handle of the log file defined in the
- configuration file.
+ __loghandle ; The handle of the log file defined in the
+ configuration file.
+ __outputdata ; The output dictionary.
+ __messages ; The messages list.
"""
self.__loghandle.close()
@@ -138,6 +164,13 @@ class Output() :
def __levelToName(self, level) :
"""
+ Convert a log level to a readable string.
+
+ Arguments:
+ level ; A log level (an integer between -1 and 5).
+
+ Returns:
+ string ; A readable description of the log level.
"""
if level == 0 :
@@ -153,63 +186,79 @@ class Output() :
return ""
#__levelToName
- #def addToOutputNode(self, filename, name, code, message) :
- # """
- # """
-
- # niceName = self.__niceName(filename)
-
- # self.__outputData[name].message.append(Message(niceName, code, message))
-
- # level = self.__outputData[name].level
- # if level >= self.__config.loglevel :
- # prefix = ""
- # if level == 2 :
- # prefix = "Warning: "
- # if level == 3 :
- # prefix = "Error: "
- # if level == 4 :
- # prefix = "Fatal: "
- # self.__loghandle.write(strftime(self.__config.datestring + ' ') + \
- # "%s (%s) %s: %s%s\n" % (self.__instance,
- # niceName, code, prefix, message))
- # self.__loghandle.flush()
- # #if
- ##addToOutputNode
-
def addMessage(self, filename, level, code, description) :
"""
+ Add a message to the message list.
+ If the level exceeds the configured loglevel or if the level is -1,
+ then the message is also logged.
+ If the severity equals 2, then the number of warnings is inreased,
+ if it exceeds 2, then the number of errors is increased.
+
+ Arguments:
+ filename ; Name of the calling module.
+ level ; Severity of the message.
+ code ; Error code of the message.
+ description ; Description of the message.
+
+ Private variables:
+ __messages ; The messages list.
+ __instance ; Module that created the Output object.
+ __config ; The variables loglevel and datestring are used.
+ __loghandle ; Handle to the log file.
+
+ Private variables (altered):
+ __warnings ; Increased by one if the severity equals 2.
+ __errors ; Increased by one if the severity exceeds 2.
"""
niceName = self.__niceName(filename)
+ # Append a new message object to the messages list.
self.__messages.append(Message(niceName, level, code, description))
if level == 2 :
self.__warnings += 1
if level > 2 :
self.__errors += 1
+
+ # Log the message if the message is important enough, or if it is only
+ # meant to be logged (level -1).
if level > self.__config.loglevel or level == -1 :
- self.__loghandle.write(strftime(self.__config.datestring + ' ') + \
- "%s (%s) %s: %s%s\n" % (self.__instance,
- niceName, code, self.__levelToName(level),
- description))
+ self.__loghandle.write(time.strftime(
+ self.__config.datestring + ' ') + "%s (%s) %s: %s%s\n" % (
+ self.__instance, niceName, code, self.__levelToName(level),
+ description))
self.__loghandle.flush()
#if
#addMessage
def getMessages(self) :
"""
+ Print all messages that exceed the configured output level.
+
+ Private variables:
+ __messages ; The messages list.
+ __config ; The variable outputlevel is used.
"""
for i in self.__messages :
if i.level > self.__config.outputlevel :
- print "%s (%s): %s" % (self.__levelToName(i.level), i.origin,
- i.description)
+ print "%s(%s): %s" % (self.__levelToName(i.level), i.origin,
+ i.description)
#getMessages
def addOutput(self, name, data) :
"""
+ If the output dictionary already has a node with the specified
+ name, the list that this name points to is expanded with the data.
+ Otherwise create a node and assign a list containing the data.
+
+ Arguments:
+ name ; Name of a node in the output dictionary.
+ data ; The data to be stored at this node.
+
+ Private variables:
+ __outputData ; The output dictionary.
"""
if self.__outputData.has_key(name) :
@@ -220,6 +269,13 @@ class Output() :
def getOutput(self, name) :
"""
+ Return a list of data from the output dictionary.
+
+ Arguments:
+ name ; Name of a node in the output dictionary.
+
+ Private variables:
+ __outputData ; The output dictionary.
"""
if self.__outputData.has_key(name) :
@@ -227,94 +283,6 @@ class Output() :
return None
#getOutput
-
- #def createOutputNode(self, name, level) :
- # """
- # """
-
- # self.__outputData[name] = Node(level)
- ##createOutputNode
-
- #def getData(self, name) :
- # """
- # """
-
- # if self.__outputData.has_key(name) and \
- # self.__outputData[name].level >= self.__config.outputlevel :
- # return self.__outputData[name].message
- # return []
- ##getdata
-
- #'''
- #def getMsg(self, name) :
- # """
- # """
-
- # if self.__outputData[name].serverity >= self.__config.outputlevel :
- # return
- ##getMsg
-
- #def ErrorMsg(self, filename, message) :
- # """
- # Print an error message to standard output and log it.
-
- # Arguments:
- # filename ; The file where the error originated.
- # message ; The error message.
-
- # Private variables (altered):
- # __errors ; Increased by one.
- # """
-
- # print "Error (%s): %s" % (self.__niceName(filename), message)
- # self.LogMsg(filename, "Error: " + message)
- # #self.addData(filename, "test", "error", "5", message)
- # self.__errors += 1
- ##ErrorMsg
-
- #def WarningMsg(self, filename, message) :
- # """
- # Print an error message to standard output.
-
- # Arguments:
- # filename ; The file where the warning originated.
- # message ; The warning message.
-
- # Private variables (altered):
- # __warnings ; Increased by one.
- # """
-
- # print "Warning (%s): %s" % (self.__niceName(filename), message)
- # #self.addData(filename, "test", "warning", "5", message)
- # self.__warnings += 1
- ##WarningMsg
-
- #def LogMsg(self, filename, message) :
- # """
- # Log a message to the log file defined in the configuration file.
-
- # Arguments:
- # filename ; The file where the logging request originated.
- # message ; The message to be logged.
-
- # Private variables:
- # __loghandle ; The handle of the log file defined in the
- # configuration file.
- # __instance ; The name of the module that created this output
- # object.
-
- # Inherited variables from Config:
- # datestring ; Format of the prefix for log messages.
- # """
-
-
- # self.__loghandle.write(strftime(self.__config.datestring + ' ') + \
- # "%s (%s): %s\n" % (self.__instance, self.__niceName(filename),
- # message))
- # self.__loghandle.flush()
- ##LogMsg
- #'''
-
def Summary(self) :
"""
Print a summary of the number of errors and warnings.
@@ -322,6 +290,12 @@ class Output() :
Private variables:
__errors ; The number of errors.
__warnings ; The number of warnings.
+
+ Returns:
+ triple:
+ integer ; Number of errors.
+ integer ; Number of warnings.
+ string ; Summary.
"""
e_s = 's'
@@ -331,8 +305,8 @@ class Output() :
if self.__warnings == 1 :
w_s = ''
- print "%i Error%s, %i Warning%s." % (self.__errors, e_s,
- self.__warnings, w_s)
+ return self.__errors, self.__warnings, "%i Error%s, %i Warning%s." % (
+ self.__errors, e_s, self.__warnings, w_s)
#Summary
#Output
@@ -340,12 +314,5 @@ class Output() :
# Unit test.
#
if __name__ == "__main__" :
- import Config
-
- C = Config.Config()
-
- O = Output(__file__, C.Output)
-
- O.WarningMsg(__file__, "Ja, er ging wat mis.")
- del O
+ pass
#if
diff --git a/src/Modules/Parser.py b/src/Modules/Parser.py
index 09726036..b3e18dea 100644
--- a/src/Modules/Parser.py
+++ b/src/Modules/Parser.py
@@ -1,6 +1,16 @@
#!/usr/bin/python
-#from Output import Output
+"""
+ Module for parting a variant described using the HGVS nomenclature.
+
+ A context-free parser is defined here, the nomenclature rules are specified
+ in BNF, which is used (with some minor modifications) as source of this
+ module.
+
+ Public classes:
+ Nomenclatureparser ; Parse an input string.
+"""
+
from pyparsing import *
class Nomenclatureparser() :
@@ -285,10 +295,7 @@ class Nomenclatureparser() :
__output ; Set to the output object.
"""
- #self.__output = output
- #Output.__init__(self, __file__)
- self.output = output
-
+ self.__output = output
ParserElement.enablePackrat() # Speed up parsing considerably.
#__init__
@@ -314,19 +321,14 @@ class Nomenclatureparser() :
try :
return self.Var.parseString(variant, parseAll = True)
except ParseException, err :
- self.output.addMessage(__file__, 4, "EPARSE", str(err))
+ self.__output.addMessage(__file__, 4, "EPARSE", str(err))
- # Print the input.
- #print variant
- #self.output.createOutputNode("parseError", 4) # Fatal error.
- #self.output.addOutput("nomenclatureparser", variant)
- self.output.addMessage(__file__, 4, "EPARSE", variant)
+ # Log the input.
+ self.__output.addMessage(__file__, 4, "EPARSE", variant)
- # And print the position where the parsing error occurred.
+ # And log the position where the parsing error occurred.
pos = int(str(err).split(':')[-1][:-1]) - 1
- #print pos * ' ' + '^'
- #self.output.addOutput("nomenclatureparser", pos * ' ' + '^')
- self.output.addMessage(__file__, 4, "EPARSE", pos * ' ' + '^')
+ self.__output.addMessage(__file__, 4, "EPARSE", pos * ' ' + '^')
return None
#except
diff --git a/src/Modules/Retriever.py b/src/Modules/Retriever.py
index 3b1c2e6d..08b2ca75 100644
--- a/src/Modules/Retriever.py
+++ b/src/Modules/Retriever.py
@@ -1,5 +1,16 @@
#!/usr/bin/python
+"""
+ Module for retrieving files from either the cache or the NCBI.
+
+ A hash of every retrieved file is stored in the internal database. If a
+ requested file is not found, but its hash is, we use additional information
+ to re-download the file.
+
+ Public classes:
+ Retriever ; Retrieve a record from either the cache or the NCBI.
+"""
+
import os # path.isfile(), link() path.isdir(), path.mkdir(),
# walk(), path.getsize(), path.join(), stat(), remove()
import bz2 # BZ2Compressor(), BZ2File()
@@ -9,10 +20,7 @@ import StringIO # StringIO()
from Bio import SeqIO # read()
from Bio import Entrez # efetch(), read(), esearch(), esummary()
-import Misc
-
-#from Output import Output
-#from Db import Db
+from Modules import Misc
class Retriever() :
"""
@@ -24,8 +32,10 @@ class Retriever() :
cachesize ; Maximum size of the cache.
Special methods:
- __init__(config) ; Use variables from the configuration file to
- initialise the class private variables.
+ __init__(config, ; Use variables from the configuration file to
+ output, initialise the class private variables.
+ database)
+
Private methods:
__foldersize(folder) ; Return the size of a folder.
@@ -68,8 +78,6 @@ class Retriever() :
cache ; The directory where the records are stored.
"""
- #Db.__init__(self, "local", "mutalyzer")
-
self.__config = config
self.__output = output
self.__database = database
@@ -91,8 +99,8 @@ class Retriever() :
folder_size = 0
for (path, dirs, files) in os.walk(folder) :
- for file in files :
- folder_size += os.path.getsize(os.path.join(path, file))
+ for fileName in files :
+ folder_size += os.path.getsize(os.path.join(path, fileName))
return folder_size
#__foldersize
@@ -259,13 +267,14 @@ class Retriever() :
name, GI = self.__write(raw_data, name, 1)
if name : # Processing went okay.
currentmd5sum = self.__database.getHash(name)
- md5sum = self.__calcHash(raw_data)
- if md5sum != currentmd5sum :
- self.__output.addMessage(__file__, -1, "WHASH",
- "Warning: Hash of %s changed from %s to %s." % (
- name, currentmd5sum, md5sum))
- self.__database.updateHash(name, md5sum)
- #if
+ if currentmd5sum :
+ md5sum = self.__calcHash(raw_data)
+ if md5sum != currentmd5sum :
+ self.__output.addMessage(__file__, -1, "WHASH",
+ "Warning: Hash of %s changed from %s to %s." % (
+ name, currentmd5sum, md5sum))
+ self.__database.updateHash(name, md5sum)
+ #if
else :
self.__database.insertGB(name, GI,
self.__calcHash(raw_data), None, 0, 0, 0, None)
@@ -353,6 +362,9 @@ class Retriever() :
organism ; The organism in which we search.
upstream ; Number of upstream nucleotides for the slice.
downstream ; Number of downstream nucleotides for the slice.
+
+ Returns:
+
"""
# Search the NCBI for a specific gene in an organism.
@@ -361,41 +373,53 @@ class Retriever() :
searchresult = Entrez.read(handle)
handle.close()
- # FIXME
- if len(searchresult["IdList"]) > 1 :
- print "Hmmmmm."
- return None
- #if
+ ChrAccVer = None # We did not find anything yet.
+ aliases = [] # A list of aliases in case we find them.
+ for i in searchresult["IdList"] : # Inspect all results.
+ handle = Entrez.esummary(db = "gene", id = i)
+ summary = Entrez.read(handle)
+ handle.close()
+ if summary[0]["NomenclatureSymbol"] == gene : # Found it.
+ ChrAccVer = summary[0]["GenomicInfo"][0]["ChrAccVer"]
+ ChrLoc = summary[0]["GenomicInfo"][0]["ChrLoc"]
+ ChrStart = summary[0]["GenomicInfo"][0]["ChrStart"]
+ ChrStop = summary[0]["GenomicInfo"][0]["ChrStop"]
+ break;
+ #if
- # Get summary information for the first search hit.
- handle = Entrez.esummary(db = "gene", id = searchresult["IdList"][0])
- summary = Entrez.read(handle)
- handle.close()
- if not len(summary[0]["GenomicInfo"]) :
- print "No mapping information found."
- #FIXME Output and stuff.
- return
+ # Collect official symbols that has this gene as alias in case we
+ # can not find anything.
+ if gene in summary[0]["OtherAliases"] and \
+ summary[0]["NomenclatureSymbol"] :
+ aliases.append(summary[0]["NomenclatureSymbol"]);
+ #for
+
+ if not ChrAccVer : # We did not find any genes.
+ if aliases :
+ self.__output.addMessage(__file__, 4, "ENOGENE",
+ "Gene %s not found, found aliases: %s" % (gene, aliases))
+ return None
+ #if
+ self.__output.addMessage(__file__, 4, "ENOGENE",
+ "Gene %s not found." % gene)
+ return None
#if
- ChrAccVer = summary[0]["GenomicInfo"][0]["ChrAccVer"] # Extract the mapping
- ChrLoc = summary[0]["GenomicInfo"][0]["ChrLoc"] # information.
- ChrStart = summary[0]["GenomicInfo"][0]["ChrStart"]
- ChrStop = summary[0]["GenomicInfo"][0]["ChrStop"]
-
+
# Figure out the orientation of the gene.
orientation = "1"
if ChrStart > ChrStop : # Swap start and stop.
orientation = "2"
temp = ChrStart
ChrStart = ChrStop - downstream # Also take care of the flanking
- ChrStop = temp + upstream # sequences.
+ ChrStop = temp + upstream + 1 # sequences.
#if
else :
- ChrStart -= upstream
- ChrStop += downstream
+ ChrStart -= upstream - 1
+ ChrStop += downstream + 2
#else
# And retrieve the slice.
- self.retrieveslice(ChrAccVer, ChrStart, ChrStop, orientation)
+ return self.retrieveslice(ChrAccVer, ChrStart, ChrStop, orientation)
#retrievegene
def downloadrecord(self, url) :
@@ -544,120 +568,11 @@ class Retriever() :
return record
#loadrecord
-
- #'''
- #def loadrecord_old(self, identifier) :
- # """
- # Return a record from either the cache or the NCBI.
- # If a file is retrieved from the NCBI, a hard link is made to its
- # alternative name (GI when an accession number is given and vice
- # versa). If no version is given, it will be retrieved and the
- # record will be renamed.
- # After downloading a file, the cache is checked for overflows by
- # calling the __cleancache() function.
- # The files are stored in compressed format in the cache.
-
- # Variables:
- # identifier ; Either an accession number or a GI number.
-
- # Inherited variables from Config:
- # cache ; The directory where the record is stored.
- # email ; The email address which we give to the NCBI.
- # output ; The output object.
-
- # Returns:
- # SeqRecord ; The record that was requested.
- # """
-
- # # If a GI is given, remove the "GI" or "GI:" part.
- # if (identifier[:2] == "GI") :
- # if (identifier[2] == ':') :
- # name = identifier[3:]
- # else :
- # name = identifier[2:]
- # #if
- # else :
- # name = identifier
- #
- # # Make a filename based upon the identifier.
- # filename = self.__nametofile(name)
- #
- # # If the filename is not present, retrieve it from the NCBI.
- # if not os.path.isfile(filename) :
- # Loc = self.__database.getLoc(name) # Look in the UD database
- # if not Loc : # Never seen this name before.
- # net_handle = \
- # Entrez.efetch(db = "nucleotide", id = name, rettype = "gb")
- # raw_data = net_handle.read()
- # net_handle.close()
- # # Check if the record is empty or not.
- # if raw_data != "\n" :
- # self.__write(raw_data, filename, 1)
- # else :
- # self.__output.addMessage(__file__, 4, "ERETR",
- # "Could not retrieve %s." % name)
- # return None
- # #if
- # else : # We know the name.
- # self.retrieveslice(*Loc)
- # #if
- #
- # # Now we have the file, so we can parse it.
- # file_handle = bz2.BZ2File(filename, "r")
- # try :
- # record = SeqIO.read(file_handle, "genbank")
- # except ValueError :
- # self.__output.addMessage(__file__, 4, "ERECPARSE",
- # "Could not parse %s, purging." % filename)
- # os.remove(filename)
- # file_handle.close()
- # return None
- # #except
-
- # file_handle.close()
-
- # if name[:3] == "UD_" : # No renaming is needed.
- # return record
-
- # # If a GI is supplied, find out the accession number (plus version)
- # # and vice versa.
- # if name != record.annotations["gi"] :
- # altfilename = self.__nametofile(record.annotations["gi"])
- # altfilename2 = self.__nametofile(record.id)
- # #if
- # else :
- # altfilename = self.__nametofile(record.id)
- #
- # # If the alternative filename is not present yet, make a hard link.
- # if not os.path.isfile(altfilename) :
- # os.link(filename, altfilename)
-
- # # If the other alternative filename is not present (no version was
- # # given), rename the file. If it already exists, remove the file.
- # if filename != altfilename2 :
- # if not os.path.isfile(altfilename2) :
- # os.rename(filename, altfilename2)
- # else :
- # os.remove(filename)
-
- # self.__output.addMessage(__file__, 2, "WNOVRE",
- # "No version number is given, using %s. Please use version numbers to reduce " \
- # "downloading overhead." % record.id)
- # #if
-
- # return record
- ##loadrecord
- #'''
#Retriever
#
# Unit test.
#
if __name__ == "__main__" :
- # Get the location of the cache, the cachesize and the email address from
- # the config file.
- R = Retriever()
-
- R.loadrecord("AB026906.1") # Retrieve a GenBank record.
- del R
+ pass
#if
diff --git a/src/Modules/Scheduler.py b/src/Modules/Scheduler.py
index 5899ada1..d83d9090 100644
--- a/src/Modules/Scheduler.py
+++ b/src/Modules/Scheduler.py
@@ -1,27 +1,79 @@
#!/usr/bin/python
+"""
+ Public classes:
+ Scheduler ;
+"""
+
import time
-import Config
-import Db
import subprocess
import psutil
import os
+import smtplib
+from email.mime.text import MIMEText
+
+from Modules import Config
+from Modules import Output
+from Modules import Db
+
+import Mutalyzer
class Scheduler() :
"""
+ Special methods:
+ __init__(config, database) ;
+
+ Public methods:
+ isDaemonRunning() ;
+ process() ;
+ addJob(outputFilter, eMail, queue, fromHost) ;
+
"""
def __init__(self, config, database) :
"""
+ Arguments:
+ config ;
+ database ;
"""
self.__config = config
self.__database = database
#__init__
+ def __sendMail(self, mailTo, url) :
+ """
+ Send an e-mail containing an url to a batch job submitter.
+
+ Arguments:
+ mailTo ; The batch job submitter.
+ url ; The url containing the results.
+
+ Private variables:
+ __config ; The variables mailMessage, mailSubject and mailFrom
+ are used.
+ """
+
+ handle = open(self.__config.mailMessage)
+ message = MIMEText(handle.read() % url)
+ handle.close()
+
+ message["Subject"] = self.__config.mailSubject
+ message["From"] = self.__config.mailFrom
+ message["To"] = mailTo
+
+ smtpInstance = smtplib.SMTP()
+ smtpInstance.connect()
+ smtpInstance.sendmail(self.__config.mailFrom, mailTo,
+ message.as_string())
+ smtpInstance.quit()
+ #__sendMail
+
def isDaemonRunning(self) :
"""
+ Returns:
+ True if an other scheduler is already running, False otherwise.
"""
myPid = os.getpid()
@@ -42,23 +94,40 @@ class Scheduler() :
for i in jobList :
results = self.__database.getFromQueue(i)
if results :
- print i, results
+ if results[1] :
+ cmd = "%s(%s):%s" % results
+ else :
+ cmd = "%s:%s" % (results[0], results[2])
+ C = Config.Config()
+ O = Output.Output(__file__, C.Output)
+ Mutalyzer.process(cmd, C, O)
+ handle = open("%s/Results_%s.txt" % (
+ self.__config.resultsDir, i), "a")
+ handle.write(str(O.getOutput("variantdescription")))
+ handle.close()
+ del O, C
+ #if
else :
- eMail = self.__database.removeJob(i)
- print "Job %s finished, email %s file %s" % (i, eMail, i)
- time.sleep(1)
+ eMail, stuff, fromHost = self.__database.removeJob(i)
+ #print "Job %s finished, email %s file %s" % (i, eMail, i)
+ self.__sendMail(eMail, "%sResults_%s.txt" % (fromHost, i))
+ #else
#for
jobList = self.__database.getJobs()
#while
#process
- def addJob(self, outputFilter, eMail, queue) :
+ def addJob(self, outputFilter, eMail, queue, fromHost) :
"""
+ Arguments:
+ outputFilter ;
+ eMail ;
+ queue ;
"""
print "called addjob"
jobList = self.__database.getJobs()
- jobID = self.__database.addJob(outputFilter, eMail)
+ jobID = self.__database.addJob(outputFilter, eMail, fromHost)
for i in queue :
self.__database.addToQueue(jobID, *i)
subprocess.Popen([self.__config.processName, "src/BatchChecker.py"],
diff --git a/src/Modules/Web.py b/src/Modules/Web.py
index 99c398f2..95bb681d 100644
--- a/src/Modules/Web.py
+++ b/src/Modules/Web.py
@@ -1,6 +1,14 @@
#!/usr/bin/python
+"""
+ Module that provides general functions used by the web interfaces.
+
+ Public classes:
+ Web ; General functions used by the web interfaces.
+"""
+
import sys # sys.stdout
+import re # match
from cStringIO import StringIO # StringIO() getvalue()
class Web() :
@@ -153,4 +161,14 @@ class Web() :
return s
#read
+
+ def isEMail(self, eMail) :
+ """
+ """
+
+ if re.match("^[a-zA-Z0-9._%-]+@[a-zA-Z0-9._%-]+.[a-zA-Z]{2,6}$",
+ eMail) :
+ return True
+ return False
+ #isEmail
#Web
diff --git a/src/Modules/__init__.py b/src/Modules/__init__.py
index e69de29b..10629c42 100644
--- a/src/Modules/__init__.py
+++ b/src/Modules/__init__.py
@@ -0,0 +1,14 @@
+"""
+ Public modules:
+ Config ;
+ Crossmap ;
+ Db ;
+ GenRecord ;
+ Misc ;
+ Mutator ;
+ Output ;
+ Parser ;
+ Retriever ;
+ Scheduler ;
+ Web ;
+"""
diff --git a/src/Mutalyzer.py b/src/Mutalyzer.py
index 15c6693c..b46379a6 100644
--- a/src/Mutalyzer.py
+++ b/src/Mutalyzer.py
@@ -1,17 +1,28 @@
#!/usr/bin/python
+"""
+ The nomenclature checker.
+"""
+
+import sys
+import math
+import types
+import Bio
+
+import Bio.Seq
+from Bio.Seq import Seq
+from Bio.Alphabet import IUPAC
+from Bio.SeqUtils import seq3
+
from Modules import Retriever
from Modules import GenRecord
from Modules import Crossmap
from Modules import Parser
from Modules import Db
-
-import types
+from Modules import Mutator
from Modules import Output
from Modules import Config
-import Bio.Seq
-
class newMut() :
def __init__(self) :
self.c = ""
@@ -26,6 +37,9 @@ def __order(a, b) :
#__order
def __roll(string, start, stop, orientation) :
+ """
+ """
+
pattern = string[start:stop]
if orientation == 1 :
i = stop - 1
@@ -49,8 +63,34 @@ def __roll(string, start, stop, orientation) :
#else
#__roll
+def roll2(ref, start, stop) :
+ """
+ """
+
+ pattern = ref[start:stop]
+ patternLength = len(pattern)
+
+ g_min = start - 1
+ j = patternLength - 1
+ while g_min > -1 and ref[g_min] == pattern[j % patternLength] :
+ j -= 1
+ g_min -= 1
+ #while
+ g_min += 1
+
+ g_max = stop
+ j = 0
+ while g_max < len(ref) and ref[g_max] == pattern[j % patternLength] :
+ j += 1
+ g_max += 1
+ #while
+
+ return g_min, g_max - patternLength
+#roll2
+
def __palinsnoop(string) :
- import math
+ """
+ """
revcomp = Bio.Seq.reverse_complement(string)
@@ -61,7 +101,8 @@ def __palinsnoop(string) :
#__palinsnoop
def __bprint(s) :
- import math
+ """
+ """
if not s :
return
@@ -82,6 +123,9 @@ def __bprint(s) :
#__bprint
def __PtLoc2main(Loc) :
+ """
+ """
+
main = int(Loc.Main)
if Loc.MainSgn == '-' :
main = -main
@@ -90,6 +134,9 @@ def __PtLoc2main(Loc) :
#__PtLoc2main
def __PtLoc2offset(Loc) :
+ """
+ """
+
if Loc.Offset :
offset = int(Loc.Offset)
if Loc.OffSgn == '-' :
@@ -101,22 +148,6 @@ def __PtLoc2offset(Loc) :
return offset
#__PtLoc2offset
-"""
-def IsInt(string) :
- try :
- num = int(string)
- return 1
- #try
- except ValueError :
- return 0
-#IsInt
-"""
-
-"""
-def printp(string, depth) :
- print (depth * " ") + str(string)
-"""
-
def __splice(string, splice_sites) :
"""
Construct the transcript or the coding sequence from a record and
@@ -140,6 +171,9 @@ def __splice(string, splice_sites) :
#__splice
def __nsplice(string, splice_sites, CDS, orientation) :
+ """
+ """
+
transcript = ""
if orientation == 1 :
@@ -148,94 +182,45 @@ def __nsplice(string, splice_sites, CDS, orientation) :
transcript += string[CDS[0] - 1:splice_sites[i + 1]]
else :
if splice_sites[i] > CDS[0] :
- transcript += string[splice_sites[i] - 1:splice_sites[i + 1]]
+ transcript += \
+ string[splice_sites[i] - 1:splice_sites[i + 1]]
+ #for
+ #if
else :
for i in range(0, len(splice_sites), 2) :
if CDS[1] >= splice_sites[i] and CDS[1] <= splice_sites[i + 1] :
transcript += string[splice_sites[i] - 1: CDS[1]]
else :
if splice_sites[i] < CDS[1] :
- transcript += string[splice_sites[i] - 1:splice_sites[i + 1]]
-
+ transcript += \
+ string[splice_sites[i] - 1:splice_sites[i + 1]]
+ #for
+ #else
return transcript
#__nsplice
-
-def __toProtDescr(orig, trans) :
- from Bio.SeqUtils import seq3
-
- if str(trans) == str(orig) :
- return "p.="
-
- if len(trans) > len(orig) :
- ext = abs(len(orig) - len(trans))
- return "p.*%i%sext*%i" % (len(orig) + 1, seq3(trans[len(orig)]), ext)
-
- if len(orig) > len(trans) :
- return "p.%s%i*" % (seq3(orig[len(trans)]), len(trans) + 1)
-
- i = 0
- while i < len(orig) - 1 and orig[i] == trans[i] :
- i += 1
-
- return "p.%s%i%s" % (seq3(orig[i]), i + 1, seq3(trans[i]))
-#__toProtDescr
-
-def __constructCDS(mRNA, CDSpos) :
- #print mRNA
- #print CDSpos
- i = 1
- ret = [CDSpos[0]]
-
- while CDSpos[0] > mRNA[i] :
- i += 2
-
- j = i
- while CDSpos[1] > mRNA[j] :
- j += 2
-
- ret.extend(mRNA[i:j])
- ret.append(CDSpos[1])
-
- #print ret
- return ret
-#__constructCDS
-
-"""
-def __isStringThere(ref, p1, p2, string) :
- if ref[p1 - 1:p2] == string :
- return True
- return False
-#__isStringThere
-
-def __checkStringLength(p1, p2, length) :
- if p2 - p1 + 1 == int(length) :
- return True
- return False
-#__checkStringLength
-"""
-
def __checkOptArg(ref, p1, p2, arg, M, O) :
+ """
+ """
+
if arg :
if arg.isdigit() :
length = int(arg)
interval = p2 - p1 + 1
if length != interval :
- O.addMessage(__file__, 3, "EARGLEN", "The length (%i) differed from that of " \
- "the range (%i)." % (length, interval))
+ O.addMessage(__file__, 3, "EARGLEN",
+ "The length (%i) differed from that of the range (%i)." % (
+ length, interval))
return False
#if
#if
else :
- #revcomp = reverse_complement(string)
-
ref_slice = str(ref[p1 - 1:p2])
- #if M.orientation == -1 :
- # ref_slice = Bio.Seq.reverse_complement(ref_slice)
if ref_slice != str(arg) : # FIXME more informative.
- O.addMessage(__file__, 3, "EREF", "%s not found at position c.%s (g.%i), " \
- "found %s instead." % (arg, M.g2c(p1), p1, ref_slice))
+ O.addMessage(__file__, 3, "EREF",
+ "%s not found at position c.%s (g.%i), found %s instead." \
+ % (arg, M.g2c(p1), p1, ref_slice))
return False
#if
#else
@@ -284,97 +269,186 @@ def __lcs(str1, str2) :
return __lcp(t1, t2)
#__lcs
+def findInFrameDescription(str1, str2) :
+ """
+ """
+
+ # Nothing happened.
+ if str1 == str2 :
+ return "p.(=)"
+
+ lcp = __lcp(str1, str2)
+ lcs = __lcs(str1[lcp:], str2[lcp:])
+ str1_end = len(str1) - lcs
+ str2_end = len(str2) - lcs
+
+ # Insertion / Duplication.
+ if not str1_end - lcp :
+ inLen = str2_end - lcp
+
+ if lcp - inLen >= 0 and str1[lcp - inLen:lcp] == str2[lcp:str2_end] :
+ if inLen == 1 :
+ return "p.(%s%idup)" % (seq3(str1[lcp - inLen]),
+ lcp - inLen + 1)
+ return "p.(%s%i_%s%idup)" % (seq3(str1[lcp - inLen]),
+ lcp - inLen + 1,
+ seq3(str1[lcp - 1], lcp))
+ #if
+ return "p.(%s%i_%s%iins%s)" % (seq3(str1[lcp - 1]), lcp,
+ seq3(str1[lcp]), lcp + 1,
+ seq3(str2[lcp:str2_end]))
+ #if
+
+ # Deletion.
+ if not str2_end - lcp :
+ if lcp + 1 == str1_end :
+ return "p.(%s%idel)" % (seq3(str1[lcp], lcp + 1))
+ return "p.(%s%i_%s%idel)" % (seq3(str1[lcp - 1]), lcp + 1,
+ seq3(str1[str1_end - 1]), str1_end)
+ #if
+
+ # Substitution.
+ if str1_end == str2_end and str1_end == lcp + 1 :
+ if len(str1) > len(str2) :
+ return "p.(*%i%sext*%i)" % (len(str1) + 1, seq3(str2[len(str1)]),
+ abs(len(str1) - len(str2)))
+ if len(str1) > len(str2) :
+ return "p.(%s%i*)" % (seq3(str1[len(str2)]), len(str2) + 1)
+ return "p.(%s%i%s)" % (seq3(str1[lcp]), lcp + 1, seq3(str2[lcp]))
+ #if
+
+ # InDel.
+ if lcp + 1 == str1_end :
+ return "p.(%s%idelins%s)" % (seq3(str1[lcp]), lcp + 1,
+ seq3(str2[lcp:str2_end]))
+ return "p.(%s%i_%s%idelins%s)" % (seq3(str1[lcp]), lcp + 1,
+ seq3(str1[str1_end - 1]),
+ str1_end, seq3(str2[lcp:str2_end]))
+#findInFrameDescription
+
+def findFrameShift(str1, str2) :
+ """
+ """
+
+ lcp = __lcp(str1, str2)
+
+ return "p.(%s%i%sfs*%i)" % (seq3(str1[lcp]), lcp + 1, seq3(str2[lcp]),
+ len(str2) - lcp)
+#findFrameShift
+
+def __toProtDescr(CDSStop, orig, trans) :
+ """
+ """
+
+ if CDSStop % 3 :
+ return findFrameShift(str(orig), str(trans))
+ return findInFrameDescription(str(orig), str(trans))
+#__toProtDescr
+
def __trim(string, lcp, lcs) :
- if lcp and lcs :
- return string[lcp:-lcs]
- if lcp :
- return string[lcp:]
- if lcs :
- return string[:-lcs]
- return string
+ """
+ """
+
+ return string[lcp:len(string) - lcs]
#__trim
def __rangeToC(M, g1, g2) :
+ """
+ """
+
if M.orientation == -1 :
return M.g2c(g2), M.g2c(g1)
return M.g2c(g1), M.g2c(g2)
#__rangeToC
def __maybeInvert(M, string) :
+ """
+ """
+
if M.orientation == -1 :
return Bio.Seq.reverse_complement(string)
return string
#__maybeInvert
-def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
- #start_main = __PtLoc2main(RawVar.StartLoc.PtLoc)
- start_main = M.main2int(RawVar.StartLoc.PtLoc.MainSgn +
- RawVar.StartLoc.PtLoc.Main)
- start_offset = __PtLoc2offset(RawVar.StartLoc.PtLoc)
- end_main = start_main
- end_offset = start_offset
- if RawVar.EndLoc :
- #end_main = __PtLoc2main(RawVar.EndLoc.PtLoc)
- end_main = M.main2int(RawVar.EndLoc.PtLoc.MainSgn +
- RawVar.EndLoc.PtLoc.Main)
- end_offset = __PtLoc2offset(RawVar.EndLoc.PtLoc)
- #if
-
- start_g = int(start_main)
- end_g = int(end_main)
-
- Arg1 = RawVar.Arg1
- Arg2 = RawVar.Arg2
- if RefType in ['c', 'n'] :
- start_g = M.x2g(start_main, start_offset)
- end_g = M.x2g(end_main, end_offset)
- if M.orientation == -1 :
- Arg1 = Bio.Seq.reverse_complement(RawVar.Arg1)
- Arg2 = Bio.Seq.reverse_complement(RawVar.Arg2)
- #if
- #if
-
- start_g, end_g = __order(start_g, end_g)
-
- start_c, end_c = __rangeToC(M, start_g, end_g)
- if start_c.isdigit() and 1 <= int(start_c) <= 3 or \
- end_c.isdigit() and 1 <= int(end_c) <= 3 :
- O.addMessage(__file__, 2, "WSTART", "Mutation in start codon.")
-
- # start_offset has to be calculated (not accepted from the parser)
- start_t_m, start_t_o = M.g2x(start_g)
- t_s, t_e, c_s = M.info()
- if start_t_o == -1 or start_t_o == -2 :
- if start_t_m == t_s :
- O.addMessage(__file__, 2, "WTXSTART", "Mutation hits transcription start.")
- else :
- O.addMessage(__file__, 2, "WSPLDON", "Mutation hits a splice donor site.")
- if start_t_o == 1 or start_t_o == 2 :
- O.addMessage(__file__, 2, "WSPLACC", "Mutation hits a splice acceptor site.")
-
- #print str(record.seq[start_g - 20:start_g + 20])
-
- if RawVar.MutationType in ["del", "dup", "subst", "delins"] :
- __checkOptArg(record.seq, start_g, end_g, Arg1, M, O)
+def __searchFrameShift(orig, mutated) :
+ pass
+#__searchFrameShift
+
+def __rv(MUU, record, RawVar, GenRecordInstance, RefType, O, NM) :
+ """
+ """
+
+ for i in GenRecordInstance.record.geneList :
+ for j in i.transcriptList :
+ M = j.CM
+ if j.CM :
+ start_main = j.CM.main2int(RawVar.StartLoc.PtLoc.MainSgn +
+ RawVar.StartLoc.PtLoc.Main)
+ start_offset = __PtLoc2offset(RawVar.StartLoc.PtLoc)
+ end_main = start_main
+ end_offset = start_offset
+ if RawVar.EndLoc :
+ end_main = j.CM.main2int(RawVar.EndLoc.PtLoc.MainSgn +
+ RawVar.EndLoc.PtLoc.Main)
+ end_offset = __PtLoc2offset(RawVar.EndLoc.PtLoc)
+ #if
+
+ start_g = int(start_main)
+ end_g = int(end_main)
+
+ Arg1 = RawVar.Arg1
+ Arg2 = RawVar.Arg2
+ if RefType in ['c', 'n'] :
+ start_g = j.CM.x2g(start_main, start_offset)
+ end_g = j.CM.x2g(end_main, end_offset)
+ if j.CM.orientation == -1 :
+ Arg1 = Bio.Seq.reverse_complement(RawVar.Arg1)
+ Arg2 = Bio.Seq.reverse_complement(RawVar.Arg2)
+ #if
+ #if
+
+ start_g, end_g = __order(start_g, end_g)
+
+ start_c, end_c = __rangeToC(M, start_g, end_g)
+ if start_c.isdigit() and 1 <= int(start_c) <= 3 or \
+ end_c.isdigit() and 1 <= int(end_c) <= 3 :
+ O.addMessage(__file__, 2, "WSTART",
+ "Mutation in start codon.")
+
+ # start_offset has to be calculated (not accepted from the
+ # parser)
+ start_t_m, start_t_o = j.CM.g2x(start_g)
+ t_s, t_e, c_s = j.CM.info()
+ if start_t_o == -1 or start_t_o == -2 :
+ if start_t_m == t_s :
+ O.addMessage(__file__, 2, "WTXSTART",
+ "Mutation hits transcription start.")
+ else :
+ O.addMessage(__file__, 2, "WSPLDON",
+ "Mutation hits a splice donor site.")
+ #if
+ if start_t_o == 1 or start_t_o == 2 :
+ O.addMessage(__file__, 2, "WSPLACC",
+ "Mutation hits a splice acceptor site.")
+
+ if RawVar.MutationType in ["del", "dup", "subst", "delins"] :
+ __checkOptArg(record.seq, start_g, end_g, Arg1, M, O)
+ #if
+ #for
+ #for
- global protDescr
- protDescr = False
# Substitution.
if RawVar.MutationType == "subst" :
if RawVar.Arg1 == RawVar.Arg2 :
- O.addMessage(__file__, 3, "ENOCHANGE", "No mutation given (%c>%c) at position " \
- "c.%s (g.%i)." % (RawVar.Arg1, RawVar.Arg1, M.g2c(start_g),
- start_g))
+ O.addMessage(__file__, 3, "ENOVAR",
+ "No mutation given (%c>%c) at position c.%s (g.%i)." % (
+ RawVar.Arg1, RawVar.Arg1, M.g2c(start_g), start_g))
MUU.subM(start_g, Arg2)
- NM.c += str(M.g2c(start_g)) + \
- __maybeInvert(M, record.seq[start_g - 1]) + \
- '>' + __maybeInvert(M, Arg2)
- NM.g += str(start_g) + \
- record.seq[start_g - 1] + \
- '>' + Arg2
- protDescr = True
+ GenRecordInstance.name(start_g, 0, "subst", record.seq[start_g - 1],
+ Arg2)
+ NM.g += str(start_g) + record.seq[start_g - 1] + '>' + Arg2
#if
# Deletion / Duplication.
@@ -383,10 +457,11 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
M.orientation)
if rollposstart != start_g :
rollposend = rollposstart + (end_g - start_g)
- O.addMessage(__file__, 2, "WROLL", "Sequence %s at position c.%s (g.%i) was " \
- "given, however, the HGVS notation prescribes that it should " \
- "be %s at position c.%s (g.%i)." % (
- str(record.seq[start_g - 1:end_g]), M.g2c(start_g), start_g,
+ O.addMessage(__file__, 2, "WROLL",
+ "Sequence %s at position c.%s (g.%i) was given, however, " \
+ "the HGVS notation prescribes that it should be %s at " \
+ "position c.%s (g.%i)." % (str(record.seq[start_g - 1:end_g]),
+ M.g2c(start_g), start_g,
str(record.seq[rollposstart - 1:rollposend]),
M.g2c(rollposstart), rollposstart))
start_g = rollposstart
@@ -406,7 +481,7 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
cpos = str(M.g2c(start_g))
gpos = str(start_g)
#else
- NM.c += cpos + RawVar.MutationType
+ GenRecordInstance.name(start_g, end_g, RawVar.MutationType, "", "")
NM.g += gpos + RawVar.MutationType
#if
@@ -415,20 +490,20 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
snoop = __palinsnoop(record.seq[start_g - 1:end_g])
if snoop :
if snoop == -1 :
- O.addMessage(__file__, 3, "ENOCHANGE", "Sequence %s at position c.%s (g.%i) " \
- "is a palindrome (its own reverse complement)." % (
+ O.addMessage(__file__, 2, "WNOCHANGE",
+ "Sequence %s at position c.%s (g.%i) is a palindrome " \
+ "(its own reverse complement)." % (
str(record.seq[start_g - 1:end_g]),
M.g2c(start_g), start_g))
- # Do nothing...
+ return NM
else :
- O.addMessage(__file__, 2, "ENOTMINIMAL", "Sequence %s at position c.%s (g.%i) " \
- "is a partial palindrome (the first %i " \
- "nucleotide(s) are the reverse complement of " \
- "the last one(s)), the HGVS notation " \
- "prescribes that it should be %s at position " \
- "c.%s (g.%i)." % (
- str(record.seq[start_g - 1:end_g]), M.g2c(start_g),
- start_g, snoop,
+ O.addMessage(__file__, 2, "WNOTMINIMAL",
+ "Sequence %s at position c.%s (g.%i) is a partial " \
+ "palindrome (the first %i nucleotide(s) are the reverse " \
+ "complement of the last one(s)), the HGVS notation " \
+ "prescribes that it should be %s at position c.%s " \
+ "(g.%i)." % (str(record.seq[start_g - 1:end_g]),
+ M.g2c(start_g), start_g, snoop,
str(record.seq[start_g + snoop - 1: end_g - snoop]),
M.g2c(start_g + snoop), start_g + snoop))
start_g += snoop
@@ -437,21 +512,18 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
MUU.invM(start_g, end_g)
c1, c2 = __rangeToC(M, start_g, end_g)
- NM.c += c1 + '_' + c2 + "inv"
+ #NM.c += c1 + '_' + c2 + "inv"
+ GenRecordInstance.name(start_g, end_g, "inv", "", "")
NM.g += str(start_g) + '_' + str(end_g) + "inv"
#if
# Insertion.
if RawVar.MutationType == "ins" :
if start_g + 1 != end_g :
- O.addMessage(__file__, 3, "EINSRANGE", "c.%s (g.%i) and c.%s (g.%i) are not " \
- "consecutive positions." % (
- M.g2c(start_g), start_g, M.g2c(end_g), end_g))
+ O.addMessage(__file__, 3, "EINSRANGE",
+ "c.%s (g.%i) and c.%s (g.%i) are not consecutive positions." \
+ % (M.g2c(start_g), start_g, M.g2c(end_g), end_g))
- #inserted = RawVar.Arg1
- #if M.orientation == -1 :
- # inserted = Bio.Seq.reverse_complement(RawVar.Arg1)
-
MUU.insM(start_g, Arg1)
way = M.orientation
@@ -459,14 +531,9 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
rs1 = MUU.shiftpos(start_g)
re1 = MUU.shiftpos(start_g) + l
- #rs1, re1 = __order(rs1, re1)
- #print "+++", MUU.mutated[rs1:re1], rs1, re1
-
rs2 = __roll(MUU.mutated, rs1, re1, way) - 1
- #shiftlen = ((rs2 - rs1 - l + 1) * way)
shiftlen = (((rs2 - rs1) * way) - l + 1) * way
- #print "+++", rs2, shiftlen
c1 = rs2
c2 = rs2 + ((l - 1) * way)
@@ -474,12 +541,12 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
corr = 0
if rs1 != rs2 or \
str(MUU.mutated[c1:c2 + 1]) == str(MUU.mutated[c1-l:(c2-l)+1]) :
- O.addMessage(__file__, 2, "WINSDUP", "Insertion of %s at position c.%s (g.%i) " \
- "was given, however, the HGVS notation prescribes that it " \
- "should be a duplication of %s at position c.%s (g.%i)." % (
- RawVar.Arg1, M.g2c(start_g), start_g,
- str(MUU.mutated[c1:c2 + 1]), M.g2c(start_g + shiftlen),
- start_g + shiftlen))
+ O.addMessage(__file__, 2, "WINSDUP",
+ "Insertion of %s at position c.%s (g.%i) was given, " \
+ "however, the HGVS notation prescribes that it should be a " \
+ "duplication of %s at position c.%s (g.%i)." % (RawVar.Arg1,
+ M.g2c(start_g), start_g, str(MUU.mutated[c1:c2 + 1]),
+ M.g2c(start_g + shiftlen), start_g + shiftlen))
start_g += shiftlen
end_g += shiftlen
corr = 1
@@ -487,29 +554,41 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
c1, c2 = __rangeToC(M, start_g, end_g)
if corr :
- NM.c += c1 + '_' + c2 + "dup"
+ #NM.c += c1 + '_' + c2 + "dup"
+ GenRecordInstance.name(start_g, end_g, "dup", "", "")
NM.g += str(start_g) + '_' + str(end_g) + "dup"
else :
- NM.c += c1 + '_' + c2 + "ins" + RawVar.Arg1
+ #NM.c += c1 + '_' + c2 + "ins" + RawVar.Arg1
+ GenRecordInstance.name(start_g, end_g, "ins", "", "")
NM.g += str(start_g) + '_' + str(end_g) + "ins" + Arg1
#if
+ # DelIns.
if RawVar.MutationType == "delins" :
- lcp = __lcp(RawVar.Arg1, RawVar.Arg2)
- lcs = -__lcs(RawVar.Arg1, RawVar.Arg2)
-
+ Arg1 = RawVar.Arg1
+ if not RawVar.Arg1 :
+ Arg1 = MUU.orig[start_g - 1:end_g]
+
+ lcp = __lcp(Arg1, RawVar.Arg2)
+ lcs = __lcs(Arg1, RawVar.Arg2)
+
+ if str(Arg1) == str(RawVar.Arg2) :
+ O.addMessage(__file__, 2, "WNOCHANGE",
+ "Sequence %s at position c.%s (g.%i) is identical to the " \
+ "variant." % (
+ str(record.seq[start_g - 1:end_g]),
+ M.g2c(start_g), start_g))
+ return NM
+ ins_part = RawVar.Arg2
if lcp or lcs :
- del_part = __trim(RawVar.Arg1, lcp, lcs)
+ del_part = __trim(Arg1, lcp, lcs)
ins_part = __trim(RawVar.Arg2, lcp, lcs)
- # FIXME Output stuff and such.
- print start_g + lcp, end_g - lcs
- print M.g2c(start_g + lcp), M.g2c(end_g - lcs)
- print "del%sins%s" % (del_part, ins_part)
-
- MUU.delinsM(start_g, end_g, Arg2)
+ #O.addMessage(__file__, 2, "WNOTMINIMAL",
+ # "")
- #NM.c += str(M.g2c(start_g)) + '_' + str(M.g2c(end_g)) + "delins" + RawVar.Arg2
- #NM.g += str(start_g) + '_' + str(end_g) + "delins" + RawVar.Arg2
+ start_g += lcp
+ end_g -= lcs
+ MUU.delinsM(start_g, end_g, ins_part)
if start_g != end_g :
c1, c2 = __rangeToC(M, start_g, end_g)
@@ -520,303 +599,111 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
cpos = str(M.g2c(start_g))
gpos = str(start_g)
#else
- #NM.c += cpos + "delins" + RawVar.Arg2
- #NM.g += gpos + "delins" + RawVar.Arg2
- NM.c += cpos + "delins" + __maybeInvert(M, Arg2)
- NM.g += gpos + "delins" + Arg2
+ #NM.c += cpos + "delins" + __maybeInvert(M, ins_part)
+ GenRecordInstance.name(start_g, end_g, "delins", ins_part, "")
+ NM.g += gpos + "delins" + ins_part
#if
- #print MUU.mutated[start_g - 20:start_g + 20]
return NM
#__rv
-def __ppp(MUU, record, parts, recordDict, refseq, depth, O) :
- #printp("+++ recurse +++", depth)
- #printp(repr(parts), depth)
- #printp(parts, depth)
- """
- printp(parts[4], depth)
- printp(repr(parts[4]), depth)
- printp(parts[4][0][0][0].Main, 2)
- printp(parts, depth)
- """
+def __ppp(MUU, record, parts, GenRecordInstance, refseq, depth, O) :
if parts.RefSeqAcc :
refseq = parts.RefSeqAcc
- #printp("RefSeqAcc: " + str(refseq), depth)
- #printp("RefType: " + str(parts.RefType), depth)
-
- #printp("Version: " + str(parts.Version), depth)
- if parts.Gene :
- print "Gene Symbol: " + str(parts.Gene.GeneSymbol)
- #printp("Transcript variant: " + str(parts.Gene.TransVar), depth)
- #printp("Protein isoform: " + str(parts.Gene.ProtIso), depth)
- #if
- """
- if parts.ChimeronSet :
- #printp(str(parts.ChimeronSet), depth)
- for i in parts.ChimeronSet :
- printp("ChimeronSet", depth)
- __ppp(MUU, record, i, recordDict, refseq, depth + 1, O)
- #for
- #if
- if parts.MosaicSet :
- #printp(str(parts.MosaicSet), depth)
- for i in parts.MosaicSet :
- printp("MosaicSet", depth)
- __ppp(MUU, record, i, recordDict, refseq, depth + 1, O)
- #for
- #if
- if parts.SimpleAlleleVarSet :
- #printp(str(parts.SimpleAlleleVarSet), depth)
- for i in parts.SimpleAlleleVarSet :
- printp("SimpleAlleleVarSet", depth)
- __ppp(MUU, record, i, recordDict, refseq, depth + 1, O)
- #for
- #__ppp(MUU, record, i, recordDict, refseq, depth + 1)
- #if
- if parts.MultiAlleleVars :
- printp(str(parts.MultiAlleleVars), depth)
- for i in parts.MultiAlleleVars :
- printp("MultiAlleleVars", depth)
- print repr(i)
- __ppp(MUU, record, i, recordDict, refseq, depth + 1, O)
- #for
- #if
- """
if parts.RawVar or parts.SingleAlleleVarSet :
- GS = ""
- if recordDict.genelist :
- GS = recordDict.genelist.keys()[0]
-
- if parts.Gene and parts.Gene.GeneSymbol :
- GS = parts.Gene.GeneSymbol
- #print "Gene Name: " + GS
- #O.createOutputNode("genename", 1) # Info message.
- #O.addToOutputNode(__file__, "genename", "INFO", GS)
- O.addOutput("genename", GS)
-
- transcriptvariant = "001"
- if parts.Gene and parts.Gene.TransVar :
- transcriptvariant = parts.Gene.TransVar
- #print "Transcript variant: " + transcriptvariant
- #O.createOutputNode("transcriptvariant", 1) # Info message.
- #O.addToOutputNode(__file__, "transcriptvariant", "INFO", transcriptvariant)
- O.addOutput("transcriptvariant", transcriptvariant)
- #print
-
- if recordDict.genelist :
- if recordDict.genelist.has_key(GS) :
- currentGene = recordDict.genelist[GS]
- else :
- print "No such gene %s in record." % GS
- # FIXME Output an stuff.
- return
- #else
- else :
- currentGene = recordDict.source
- W = currentGene.list[transcriptvariant]
-
- noTrans = False
- if not W.mRNA :
- if not W.exon:
- O.addMessage(__file__, 2, "WNOMRNA", "No mRNA field found for gene %s, " \
- "transcript variant %s in GenBank record %s, " \
- "constructing it from CDS." % (GS, transcriptvariant,
- record.id))
- if W.CDS :
- if not W.CDS.list :
- print "Extra warning"
- # FIXME Output and stuff.
- W.mRNA = W.CDS
- W.mRNA.list = W.CDS.location
- noTrans = True
- else :
- W.mRNA = W.CDS
- #if
- else :
- print currentGene.location
- # FIXME Output and stuff.
- W.CDS = GenRecord.Locus()
- W.CDS.location = W.location
- W.mRNA = W.CDS
- W.mRNA.list = currentGene.location
- noTrans = True
- #if
- else :
- O.addMessage(__file__, 2, "WNOMRNA", "No mRNA field found for gene %s, " \
- "transcript variant %s in GenBank record %s, " \
- "constructing it from gathered exon information." % (GS,
- transcriptvariant, record.id))
- W.mRNA = W.exon
- #if
- #print W.mRNA.list
- if not W.mRNA.list :
- W.mRNA.list = W.mRNA.location
- if W.CDS :
- if not W.CDS.list :
- O.addMessage(__file__, 2, "WNOCDS", "No CDS list found for gene %s, " \
- "transcript variant %s in GenBank record %s, " \
- "constructing it from mRNA list and CDS location." % (GS,
- transcriptvariant, record.id))
- if W.mRNA.list :
- W.CDS.list = __constructCDS(W.mRNA.list, W.CDS.location)
- #print W.mRNA.list, W.CDS.location
- #print W.CDS.list
- else :
- W.CDS.list = __constructCDS(W.mRNA.location, W.CDS.location)
- #else :
- # pass # Noncoding RNA?
-
- if parts.RefType == 'n' :
- M = Crossmap.Crossmap(
- W.mRNA.list,
- [],
- currentGene.orientation)
- else :
- if not W.CDS :
- O.addMessage(__file__, 3, "ENOCDS", "No CDS information found for gene %s, " \
- "transcript variant %s in GenBank " \
- "record %s." % (GS, transcriptvariant,
- record.id))
- return
- #if
- M = Crossmap.Crossmap(
- W.mRNA.list,
- W.CDS.location,
- currentGene.orientation)
- #else
- #print W.mRNA
-
- #print recordDict["organelle"], recordDict["mol_type"]
NM = newMut()
- NM.c = parts.RefSeqAcc
- NM.g = parts.RefSeqAcc
- if parts.Version :
- NM.c += '.' + parts.Version
- NM.g += '.' + parts.Version
- #if
- if parts.RefType == 'n' :
- NM.c += ":n."
- else :
- NM.c += ":c."
- if recordDict.organelle and recordDict.organelle == "mitochondrion" :
- NM.g += ":m."
+
+ print GenRecordInstance.record.mol_type
+ #if parts.RefType == 'n' :
+ # #NM.c += "n."
+ #else :
+ # #NM.c += "c."
+ if GenRecordInstance.record.organelle and \
+ GenRecordInstance.record.organelle == "mitochondrion" :
+ NM.g += "m."
else :
- if recordDict.genelist :
- NM.g += ":g."
- else : # EST
- NM.g += ":"
+ if GenRecordInstance.record.geneList :
+ NM.g += "g."
+ #else : # EST
+ # NM.g += ""
#else
+ GS = GenRecordInstance.record.geneList[0].name
if parts.SingleAlleleVarSet :
- NM.c += '['
+ #NM.c += '['
NM.g += '['
for i in parts.SingleAlleleVarSet :
- __rv(MUU, record, GS, i.RawVar, M, parts.RefType, O, NM)
- NM.c += ';'
+ __rv(MUU, record, i.RawVar, GenRecordInstance,
+ parts.RefType, O, NM)
+ #NM.c += ';'
NM.g += ';'
#for
- NM.c = NM.c[0:-1] + ']'
+ #NM.c = NM.c[0:-1] + ']'
NM.g = NM.g[0:-1] + ']'
#if
else :
- NM = __rv(MUU, record, GS, parts.RawVar, M, parts.RefType, O, NM)
-
- #print
- #print "+++", NM.c
- #print "+++", NM.g
- #O.createOutputNode("variantdescription", 1) # Info message.
- #O.addToOutputNode(__file__, "variantdescription", "INFO", NM.c)
- #O.addToOutputNode(__file__, "variantdescription", "INFO", NM.g)
- O.addOutput("variantdescription", NM.c)
+ NM = __rv(MUU, record, parts.RawVar, GenRecordInstance,
+ parts.RefType, O, NM)
+
+ #O.addOutput("variantdescription", NM.c)
O.addOutput("variantdescription", NM.g)
del NM
+ W = GenRecordInstance.record.geneList[0].transcriptList[0]
if not W.CDS : # Noncoding.
return
- if noTrans :
- return
- if not recordDict.genelist : # EST
+ #if noTrans :
+ # return
+ if not GenRecordInstance.record.geneList : # EST
return
- import Bio
- from Bio.Seq import Seq
- from Bio.Alphabet import IUPAC
-
- cds = Seq(str(__splice(MUU.orig, W.CDS.list)), IUPAC.unambiguous_dna)
- cdsm = Seq(str(__nsplice(MUU.mutated, MUU.newSplice(W.mRNA.list),
- MUU.newSplice(W.CDS.location), M.orientation)),
+ cds = Seq(str(__splice(MUU.orig, W.CDS.positionList)),
+ IUPAC.unambiguous_dna)
+ cdsm = Seq(str(__nsplice(MUU.mutated,
+ MUU.newSplice(W.mRNA.positionList),
+ MUU.newSplice(W.CDS.location),
+ W.CM.orientation)),
IUPAC.unambiguous_dna)
- if M.orientation == -1 :
+ if W.CM.orientation == -1 :
cds = Bio.Seq.reverse_complement(cds)
cdsm = Bio.Seq.reverse_complement(cdsm)
- del M
- #print "\n<b>Old protein:</b>"
if '*' in cds.translate()[:-1] :
- print "In frame stop codon found."
+ O.addMessage(__file__, 3, "ESTOP", "In frame stop codon found.")
return
#if
orig = cds.translate(table = W.txTable, cds = True, to_stop = True)
- #__bprint(orig + '*')
- #O.createOutputNode("oldprotein", 1) # Info message.
- #O.addToOutputNode(__file__, "oldprotein", "INFO", orig + '*')
O.addOutput("oldprotein", orig + '*')
- #print "\n\n<b>New protein:</b>"
trans = cdsm.translate(table = W.txTable, to_stop = True)
if not trans or trans[0] != 'M' :
if str(cdsm[0:3]) in \
Bio.Data.CodonTable.unambiguous_dna_by_id[
W.txTable].start_codons :
- __bprint('?')
- print "\n\n<b>Alternative protein using start codon %s:</b>" % \
- str(cdsm[0:3])
- __bprint('M' + trans[1:] + '*')
- #O.createOutputNode("altprotein", 1) # Info message.
- #O.addToOutputNode(__file__, "altprotein", "INFO", 'M' + trans[1:] + '*')
+ O.addOutput("newprotein", '?')
+ O.addOutput("altstart", str(cdsm[0:3]))
O.addOutput("altprotein", 'M' + trans[1:] + '*')
else :
__bprint('?')
- #O.createOutputNode("newprotein", 1) # Info message.
- #O.addToOutputNode(__file__, "newprotein", "INFO", '?')
O.addOutput("newprotein", '?')
else :
- #__bprint(trans + '*')
- #O.createOutputNode("newprotein", 1) # Info message.
- #O.addToOutputNode(__file__, "newprotein", "INFO", trans + '*')
O.addOutput("newprotein", trans + '*')
- if protDescr :
- #print
- #print
- #O.createOutputNode("proteindescription", 1) # Info message.
- #O.addToOutputNode(__file__, "proteindescription", "INFO",
- # __toProtDescr(orig, trans))
- O.addOutput("proteindescription", __toProtDescr(orig, trans))
- #if
+ if not parts.SingleAlleleVarSet :
+ O.addOutput("proteindescription", __toProtDescr(
+ W.CM.g2x(MUU.newSplice(W.CDS.location)[1])[0], orig, trans))
+ else :
+ O.addOutput("proteindescription", "p.?")
+
+ del W.CM
#if
#__ppp
-def main(cmd) :
- C = Config.Config()
- O = Output.Output(__file__, C.Output)
-
- #O.LogMsg(__file__, "Received variant " + cmd)
- O.addMessage(__file__, -1, "INFO", "Received variant " + cmd)
-
+def process(cmd, C, O) :
parser = Parser.Nomenclatureparser(O)
- #print cmd
- #O.createOutputNode("inputvariant", 1) # Info message.
- #O.addToOutputNode(__file__, "inputvariant", "INFO", cmd)
O.addOutput("inputvariant", cmd)
- #print
ParseObj = parser.parse(cmd)
- #print
- #for i in parser.outputData : # HMMMM
- # #print i.origin, i.name, i.msgType, i.severity, i.message
- # print i, parser.outputData[i].message
del parser
if ParseObj :
@@ -824,10 +711,9 @@ def main(cmd) :
RetrieveRecord = ParseObj.RefSeqAcc + '.' + ParseObj.Version
else :
RetrieveRecord = ParseObj.RefSeqAcc
+ O.addOutput("reference", RetrieveRecord)
- #print "Retrieving..."
-
- D = Db.Db("local", C.Db.internalDb, C.Db)
+ D = Db.Cache(C.Db)
retriever = Retriever.Retriever(C.Retriever, O, D)
record = retriever.loadrecord(RetrieveRecord)
if not record :
@@ -835,44 +721,27 @@ def main(cmd) :
del retriever
del D
- #print "Dicting..."
- D = GenRecord.GenRecord()
- d = D.record2dict(record)
- del D
- #print "Printing..."
- #D.printRecordDict(d, record)
-
- from Modules import Mutator
-
+ GenRecordInstance = GenRecord.GenRecord(C.GenRecord, O)
+ GenRecordInstance.parseRecord(record)
+
MUU = Mutator.Mutator(record.seq, C.Mutator, O)
+ __ppp(MUU, record, ParseObj, GenRecordInstance, "", 0, O)
+ del MUU
+ return GenRecordInstance
+ #if
+#process
- #MUU.createOutputNode(__file__, "errors", 3) # Error message.
- #MUU.createOutputNode(__file__, "warnings", 3) # Error message.
+def main(cmd) :
+ C = Config.Config()
+ O = Output.Output(__file__, C.Output)
- __ppp(MUU, record, ParseObj, d, "", 0, O)
- #for i in MUU.outputData : # HMMMM
- # #print i.origin, i.name, i.msgType, i.severity, i.message
- # print i, MUU.outputData[i].message
+ O.addMessage(__file__, -1, "INFO", "Received variant " + cmd)
+ RD = process(cmd, C, O)
- del MUU
- #if
- #print "\n\n"
- O.Summary()
- #O.LogMsg(__file__, "Finished processing variant " + cmd)
O.addMessage(__file__, -1, "INFO", "Finished processing variant " + cmd)
- #for i in O.outputData : # HMMMM
- # #print i.origin, i.name, i.msgType, i.severity, i.message
- # print i, O.outputData[i].message
### OUTPUT BLOCK ###
- print "NEW OUTPUT BLOCK"
- vd = O.getOutput("variantdescription")
- if vd :
- print vd[0]
- print vd[1]
- print
- #if
gn = O.getOutput("genename")
if gn :
print "Gene Name: " + gn[0]
@@ -882,54 +751,70 @@ def main(cmd) :
print
#if
- #for i in O.getOutput("fatalerrors") :
- # print "Fatal (%s) %s: %s" % (i.origin, i.code, i.description)
- #for i in O.getOutput("errors") :
- # print "Error (%s) %s: %s" % (i.origin, i.code, i.description)
- #for i in O.getOutput("warnings") :
- # print "Warning (%s) %s: %s" % (i.origin, i.code, i.description)
- #for i in O.getOutput("info") :
- # print "Info (%s) %s: %s" % (i.origin, i.code, i.description)
- #for i in O.getOutput("debug") :
- # print "Debug (%s) %s: %s" % (i.origin, i.code, i.description)
O.getMessages()
+ errors, warnings, summary = O.Summary()
+ print summary
+ print
+
+ if not errors :
+ visualisation = O.getOutput("visualisation")
+ if visualisation :
+ for i in range(len(visualisation)) :
+ if i and not i % 3 :
+ print
+ print visualisation[i]
+ #for
+ print
+ #if
- visualisation = O.getOutput("visualisation")
- if visualisation :
- for i in range(len(visualisation)) :
- if i and not i % 3 :
- print
- print visualisation[i]
- #for
- print
- #if
- vd = O.getOutput("variantdescription")
- if vd :
- for i in vd :
- print i
- op = O.getOutput("oldprotein")
- if op :
- print "\n<b>Old protein:</b>"
- __bprint(op[0])
- print
- #if
- np = O.getOutput("newprotein")
- if np :
- print "\n<b>New protein:</b>"
- __bprint(np[0])
- print
+ reference = O.getOutput("reference")[0]
+
+ for i in RD.record.geneList :
+ for j in i.transcriptList :
+ if ';' in j.description :
+ print "%s(%s_%s):%c.[%s]" % (reference, i.name, j.name,
+ j.molType, j.description)
+ else :
+ print "%s(%s_%s):%c.%s" % (reference, i.name, j.name,
+ j.molType, j.description)
+
+ vd = O.getOutput("variantdescription")
+ if vd :
+ for i in vd :
+ print "%s:%s" % (reference, i)
+
+ pd = O.getOutput("proteindescription")
+ if pd :
+ if O.getOutput("altprotein") :
+ print "%s:p.(0)" % reference
+ else :
+ print "%s:%s" % (reference, pd[0])
+ #if
+
+ op = O.getOutput("oldprotein")
+ if op :
+ print "\n<b>Old protein:</b>"
+ __bprint(op[0])
+ print
+ #if
+ np = O.getOutput("newprotein")
+ if np :
+ print "\n<b>New protein:</b>"
+ __bprint(np[0])
+ print
+ #if
+ ap = O.getOutput("altprotein")
+ if ap :
+ print "\n<b>Alternative protein using start codon %s:</b>" % \
+ O.getOutput("altstart")[0]
+ __bprint(ap[0])
+ print
+ #if
#if
- pd = O.getOutput("proteindescription")
- if pd :
- print
- print pd[0]
- print "/NEW OUTPUT BLOCK"
### OUTPUT BLOCK ###
del O
#main
if __name__ == "__main__" :
- import sys
-
main(sys.argv[1])
#if
diff --git a/src/UCSC_update.py b/src/UCSC_update.py
index 8125d63d..73cb0e29 100644
--- a/src/UCSC_update.py
+++ b/src/UCSC_update.py
@@ -3,26 +3,29 @@
"""
Get updates on mapping information from the UCSC.
- This program is intended to be run dayly from cron.
+ This program is intended to be run daily from cron.
"""
-import sys
-import os
-os.chdir(sys.argv[0].rsplit('/', 2)[0])
+import sys # sys.argv
+import os # os.chdir()
from Modules import Config
from Modules import Output
-from Modules import Db
+from Modules.Db import Remote
+from Modules.Db import Update
+
+os.chdir(sys.argv[0].rsplit('/', 2)[0])
C = Config.Config()
O = Output.Output(__file__, C.Output)
O.addMessage(__file__, -1, "INFO", "Starting UCSC mapping data update")
for i in C.Db.dbNames :
- RemoteDb = Db.Db("remote", i, C.Db)
- LocalDb = Db.Db("local", i, C.Db)
-
+ RemoteDb = Remote(i, C.Db)
RemoteDb.get_Update()
+ del RemoteDb
+
+ LocalDb = Update(i, C.Db)
LocalDb.load_Update()
count_Updates = LocalDb.count_Updates()
@@ -36,11 +39,10 @@ for i in C.Db.dbNames :
LocalDb.merge_cdsUpdates()
#if
LocalDb.merge_Update()
+
+ del LocalDb
#for
O.addMessage(__file__, -1, "INFO", "UCSC mapping data update end")
-del LocalDb
-del RemoteDb
-del O
-del C
+del O, C
diff --git a/src/VarInfo.py b/src/VarInfo.py
index 4df7273c..cda88548 100644
--- a/src/VarInfo.py
+++ b/src/VarInfo.py
@@ -72,12 +72,12 @@ def __getcoords(C, Loc, Type) :
def __process(LOVD_ver, build, acc, var, C, O) :
# Make a connection to the MySQL database with the username / db
# information from the configuration file.
- Database = Db.Db("local", build, C.Db) # Open the database.
- if not Database.opened :
+ if not build in C.Db.dbNames :
O.addMessage(__file__, 4, "EARG", "Database %s not found." % build)
print "Error (Variant_info): Database %s not found." % build
return
#if
+ Database = Db.Mapping(build, C.Db) # Open the database.
# Get the rest of the input variables.
accno = acc
diff --git a/src/handler.py b/src/handler.py
index 45bfc73d..84b3ad39 100644
--- a/src/handler.py
+++ b/src/handler.py
@@ -11,16 +11,14 @@
"""
import os
+import bz2
from ZSI import dispatch
-
-# This is a workaround for pydoc. Aparently it crashes when a module can not be
-# imported.
-try :
- from mod_python import apache, publisher
-except ImportError :
- pass
+from soaplib.client import make_service_client
+from mod_python import apache, publisher
from Modules import Web
+from Modules import Config
+
import webservice
def handler(req):
@@ -76,16 +74,43 @@ def handler(req):
reqFile = req.uri.split('/')[-1]
req.content_type = 'text/plain'
req.headers_out["Content-Disposition"] = \
- "attachment; filename = \"%s\"" % reqFile # To force downloading.
- args = {"path" : reqPath} # Replace the path variable.
+ "attachment; filename = \"%s\"" % reqFile # To force downloading.
+ args = {"path" : reqPath} # Replace the path.
req.write(W.tal("HTML", "templates/" + reqFile, args))
return apache.OK
#if
+ # Return raw content (for batch checker results).
+ if "Results" in req.uri :
+ reqFile = req.uri.split('/')[-1]
+ C = Config.Config()
+ req.write(open("%s/%s" % (C.Scheduler.resultsDir, reqFile)).read())
+ del C
+ return apache.OK
+ #if
+
+ # Return uncompressed GenBank files from the cache.
+ if "GenBank" in req.uri :
+ reqFile = req.uri.split('/')[-1]
+ C = Config.Config()
+ fileName = "%s/%s.bz2" % (C.Retriever.cache, reqFile)
+ if os.path.isfile(fileName) :
+ handle = bz2.BZ2File("%s/%s.bz2" % (C.Retriever.cache, reqFile),
+ "r")
+ req.content_type = 'text/plain'
+ req.headers_out["Content-Disposition"] = \
+ "attachment; filename = \"%s\"" % reqFile # Force downloading.
+ req.write(handle.read())
+ handle.close()
+ del C
+ #if
+ else :
+ return apache.HTTP_FORBIDDEN
+ return apache.OK
+ #if
+
# Generate the WSDL file from the MutalyzerService class.
if ".wsdl" in req.uri :
- from soaplib.client import make_service_client
-
servicepath = "http://" + reqPath + "/services"
client = make_service_client(servicepath, webservice.MutalyzerService())
req.content_type = 'text/xml'
diff --git a/src/index.py b/src/index.py
index a42649bf..b535fbc0 100644
--- a/src/index.py
+++ b/src/index.py
@@ -15,12 +15,18 @@
import Mutalyzer
import VarInfo
-from Modules import Web
-from mod_python import apache
-from Modules import Config
import pydoc
import webservice
+from mod_python import apache
+
+from Modules import Web
+from Modules import Config
+from Modules import Output
+from Modules import Db
+from Modules import Scheduler
+from Modules import File
+
def index(req) :
"""
The mutation checker page.
@@ -111,6 +117,9 @@ def download(req) :
#download
def upload(req) :
+ """
+ """
+
C = Config.Config()
maxUploadSize = C.Retriever.maxDldSize
del C
@@ -136,6 +145,41 @@ def upload(req) :
return ret
#upload
+def batch(req) :
+ """
+ """
+
+ W = Web.Web()
+ eMail = ""
+ if req.form :
+ eMail = req.form['eMail']
+ fileUpload = req.form['file']
+
+ if fileUpload.filename and W.isEMail(eMail) :
+ C = Config.Config()
+ D = Db.Batch(C.Db)
+ S = Scheduler.Scheduler(C.Scheduler, D)
+ O = Output.Output(__file__, C.Output)
+ FileInstance = File.File(C.File, O)
+
+ job = FileInstance.parseBatchFile(fileUpload.file)
+ S.addJob("1231243", eMail, job, "http://%s%s" % (req.hostname,
+ req.uri))
+
+ del FileInstance, S, D, C
+ #if
+ #if
+
+ args = {
+ "version" : W.version,
+ "lastEMail" : eMail
+ }
+
+ ret = W.tal("HTML", "templates/batch.html", args)
+ del W
+ return ret
+#batch
+
def documentation(req) :
"""
Generate documentation for the webservice.
diff --git a/src/webservice.py b/src/webservice.py
index 510f1b82..b776dac5 100644
--- a/src/webservice.py
+++ b/src/webservice.py
@@ -1,5 +1,11 @@
#!/usr/bin/python
+"""
+ Mutalyzer webservices.
+
+ Public classes:
+ MutalyzerService ; Mutalyzer webservices.
+"""
from soaplib.wsgi_soap import SimpleWSGISoapApp
from soaplib.service import soapmethod
@@ -9,7 +15,7 @@ from ZSI import TC
from ZSI.fault import Fault
from Modules import Web
-from Modules import Db
+from Modules.Db import Mapping
from Modules import Output
from Modules import Config
from Modules import Parser
@@ -48,7 +54,7 @@ class MutalyzerService(SimpleWSGISoapApp) :
gTocConversion(self, build, variant) ; Convert g. to c.
"""
- def __checkBuild(self, L, D, build) :
+ def __checkBuild(self, build, config) :
"""
Check if the build is supported (hg18 or hg19).
@@ -61,7 +67,7 @@ class MutalyzerService(SimpleWSGISoapApp) :
Nothing (but raises an EARG exception).
"""
- if not D.opened :
+ if not build in config.dbNames :
L.addMessage(__file__, 4, "EARG", "EARG %s" % build)
raise Fault(Fault.Client, "EARG",
detail = "The build argument (%s) was not a valid " \
@@ -178,8 +184,8 @@ class MutalyzerService(SimpleWSGISoapApp) :
"Received request getTranscripts(%s %s %s)" % (build,
chrom, pos))
- D = Db.Db("local", build, C.Db)
- self.__checkBuild(L, D, build)
+ self.__checkBuild(build, C.Db)
+ D = Mapping(build, C.Db)
self.__checkChrom(L, D, chrom)
self.__checkPos(L, pos)
@@ -220,8 +226,8 @@ class MutalyzerService(SimpleWSGISoapApp) :
"Received request getTranscriptsRange(%s %s %s %s %s)" % (build,
chrom, pos1, pos2, method))
- D = Db.Db("local", build, C.Db)
- self.__checkBuild(L, D, build)
+ D = Mapping(build, C.Db)
+ self.__checkBuild(build, C.Db)
ret = D.get_Transcripts(chrom, pos1, pos2, method)
L.addMessage(__file__, -1, "INFO",
@@ -252,8 +258,8 @@ class MutalyzerService(SimpleWSGISoapApp) :
L.addMessage(__file__, -1, "INFO",
"Received request getGeneName(%s %s)" % (build, accno))
- D = Db.Db("local", build, C.Db)
- self.__checkBuild(L, D, build)
+ D = Mapping(build, C.Db)
+ self.__checkBuild(build, C.Db)
ret = D.get_GeneName(accno.split('.')[0])
L.addMessage(__file__, -1, "INFO",
@@ -424,7 +430,7 @@ class MutalyzerService(SimpleWSGISoapApp) :
"""
Conf = Config.Config() # Read the configuration file.
- Database = Db.Db("local", build, Conf.Db)
+ D = Mapping(build, C.Db)
O = Output.Output(__file__, Conf.Output)
diff --git a/templates/batch.html b/templates/batch.html
new file mode 100644
index 00000000..c25e6098
--- /dev/null
+++ b/templates/batch.html
@@ -0,0 +1,40 @@
+<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"
+ "http://www.w3.org/TR/html4/loose.dtd">
+<html>
+ <head>
+ <meta http-equiv = "Content-type" content = "text/html; charset=UTF-8">
+ <title tal:content = "structure string:Mutalyzer ${version}"></title>
+ <script type = "text/javascript"
+ language = "javascript"
+ src = "test.js">
+ </script>
+ </head>
+ <body onload = "yo()">
+<!--
+ <div metal:use-macro = "sitemacros/macros/menu"></div>
+-->
+ <center>
+ <big tal:content = "structure string:Mutalyzer ${version} batch checker.">
+ </big>
+ </center><br>
+ Blablabla
+ <br>
+ <form action = "" method = "post" enctype = "multipart/form-data">
+ <input
+ type = "file"
+ name = "file"
+ size = "100%"
+ ><br>
+ <input
+ type = "text"
+ name = "eMail"
+ tal:attributes = "value lastEMail"
+ size = "100%"
+ ><br>
+ <input
+ type="submit"
+ value="Submit"
+ >
+ </form>
+ </body>
+</html>
--
GitLab