diff --git a/Db.txt b/Db.txt
index 3867c44855b2ddd306fdce086065fa45bc837582..fda594a63f529d85362e4070510a9c48d78e70b0 100644
--- a/Db.txt
+++ b/Db.txt
@@ -38,14 +38,15 @@ CREATE TABLE BatchQueue (
   QueueID INT(5) PRIMARY KEY AUTO_INCREMENT,
   JobID CHAR(20) NOT NULL,
   AccNo CHAR(13) NOT NULL,
-  Gene CHAR(20) NOT NULL,
+  Gene CHAR(20),
   Variant CHAR(255) NOT NULL
 );
 
 CREATE TABLE BatchJob (
   JobID CHAR(20) PRIMARY KEY,
   Filter CHAR(20) NOT NULL,
-  EMail CHAR(255) NOT NULL
+  EMail CHAR(255) NOT NULL,
+  FromHost Char(255) NOT NULL
 );
 
 CREATE TABLE Var (
@@ -54,3 +55,76 @@ CREATE TABLE Var (
 );
 INSERT INTO Var VALUES ("WatchDog", 0);
 ---
+
+CREATE TABLE ChrName (
+  AccNo CHAR(20) PRIMARY KEY,
+  name CHAR(20) NOT NULL
+);
+
+# hg19:
+INSERT INTO ChrName (AccNo, name) VALUES
+  ("NC_000001.10", "chr1"),
+  ("NC_000002.11", "chr2"), 
+  ("NC_000003.11", "chr3"), 
+  ("NC_000004.11", "chr4"), 
+  ("NC_000005.9", "chr5"), 
+  ("NC_000006.11", "chr6"), 
+  ("NC_000007.13", "chr7"), 
+  ("NC_000008.10", "chr8"), 
+  ("NC_000009.11", "chr9"), 
+  ("NC_000010.10", "chr10"), 
+  ("NC_000011.9", "chr11"), 
+  ("NC_000012.11", "chr12"), 
+  ("NC_000013.10", "chr13"), 
+  ("NC_000014.8", "chr14"), 
+  ("NC_000015.9", "chr15"), 
+  ("NC_000016.9", "chr16"), 
+  ("NC_000017.10", "chr17"), 
+  ("NC_000018.9", "chr18"), 
+  ("NC_000019.9", "chr19"), 
+  ("NC_000020.10", "chr20"), 
+  ("NC_000021.8", "chr21"), 
+  ("NC_000022.10", "chr22"), 
+  ("NC_000023.10", "chrX"), 
+  ("NC_000024.9", "chrY"), 
+  ("NT_167244.1", "chr6_apd_hap1"), 
+  ("NT_113891.2", "chr6_cox_hap2"), 
+  ("NT_167245.1", "chr6_dbb_hap3"), 
+  ("NT_167246.1", "chr6_mann_hap4"), 
+  ("NT_167247.1", "chr6_mcf_hap5"), 
+  ("NT_167248.1", "chr6_qbl_hap6"), 
+  ("NT_167249.1", "chr6_ssto_hap7"), 
+  ("NT_167250.1", "chr4_ctg9_hap1"), 
+  ("NT_167251.1", "chr17_ctg5_hap1")
+;
+
+# hg18:
+INSERT INTO ChrName (AccNo, name) VALUES
+  ("NC_000001.9", "chr1"),
+  ("NC_000002.10", "chr2"),
+  ("NC_000003.10", "chr3"),
+  ("NC_000004.10", "chr4"),
+  ("NC_000005.8", "chr5"),
+  ("NC_000006.10", "chr6"),
+  ("NC_000007.12", "chr7"),
+  ("NC_000008.9", "chr8"),
+  ("NC_000009.10", "chr9"),
+  ("NC_000010.9", "chr10"),
+  ("NC_000011.8", "chr11"),
+  ("NC_000012.10", "chr12"),
+  ("NC_000013.9", "chr13"),
+  ("NC_000014.7", "chr14"),
+  ("NC_000015.8", "chr15"),
+  ("NC_000016.8", "chr16"),
+  ("NC_000017.9", "chr17"),
+  ("NC_000018.8", "chr18"),
+  ("NC_000019.8", "chr19"),
+  ("NC_000020.9", "chr20"),
+  ("NC_000021.7", "chr21"),
+  ("NC_000022.9", "chr22"),
+  ("NC_000023.9", "chrX"),
+  ("NC_000024.8", "chrY"),
+  ("NC_001807.4", "chrM"),
+  ("NT_113891.1", "chr6_cox_hap1"),
+  ("NT_113959.1", "chr22_h2_hap1")
+;
diff --git a/doc/API/api.conf b/doc/API/api.conf
new file mode 100644
index 0000000000000000000000000000000000000000..f44efb9485e76827741769d89a7ebba626218363
--- /dev/null
+++ b/doc/API/api.conf
@@ -0,0 +1,105 @@
+[epydoc] # Epydoc section marker (required by ConfigParser)
+
+# modules
+#   The list of objects to document.  Objects can be named using
+#   dotted names, module filenames, or package directory names.
+#   Alases for this option include "objects" and "values".
+modules: ../../src/Modules, ../../src/*.py 
+
+# output
+#   The type of output that should be generated.  Should be one
+#   of: html, text, latex, dvi, ps, pdf.
+output: pdf
+
+# target
+#   The path to the output directory.  May be relative or absolute.
+target: api/
+
+# docformat
+#   The default markup language for docstrings, for modules that do
+#   not define __docformat__.  Defaults to epytext.
+docformat: epytext
+
+# css
+#   The CSS stylesheet for HTML output.  Can be the name of a builtin
+#   stylesheet, or the name of a file.
+#css: white
+
+# name
+#   The documented project's name.
+name: Mutalyzer 2.0
+
+# url
+#   The documented project's URL.
+url: http://www.mutalyzer.nl/2.0/
+
+# link
+#   HTML code for the project link in the navigation bar.  If left
+#   unspecified, the project link will be generated based on the
+#   project's name and URL.
+#link: <a href="somewhere">My Cool Project</a>
+
+# top
+#   The "top" page for the documentation.  Can be a URL, the name
+#   of a module or class, or one of the special names "trees.html",
+#   "indices.html", or "help.html"
+top: ../../src
+
+# help
+#   An alternative help file.  The named file should contain the
+#   body of an HTML file; navigation bars will be added to it.
+#help: my_helpfile.html
+
+# frames
+#   Whether or not to include a frames-based table of contents.
+#frames: yes
+
+# private
+#   Whether or not to inclue private variables.  (Even if included,
+#   private variables will be hidden by default.)
+private: yes
+
+# imports
+#   Whether or not to list each module's imports.
+imports: no
+
+# verbosity
+#   An integer indicating how verbose epydoc should be.  The default
+#   value is 0; negative values will supress warnings and errors;
+#   positive values will give more verbose output.
+verbosity: 0
+
+# parse
+#   Whether or not parsing should be used to examine objects.
+parse: yes
+
+# introspect
+#   Whether or not introspection should be used to examine objects.
+introspect: no
+
+# graph
+#   The list of graph types that should be automatically included
+#   in the output.  Graphs are generated using the Graphviz "dot"
+#   executable.  Graph types include: "classtree", "callgraph",
+#   "umlclass".  Use "all" to include all graph types
+graph: all
+
+# dotpath
+#   The path to the Graphviz "dot" executable, used to generate
+#   graphs.
+dotpath: /usr/local/bin/dot
+
+# sourcecode
+#   Whether or not to include syntax highlighted source code in
+#   the output (HTML only).
+#sourcecode: yes
+
+# pstat
+#   The name of one or more pstat files (generated by the profile
+#   or hotshot module).  These are used to generate call graphs.
+pstat: profile.out
+
+# separate-classes
+#   Whether each class should be listed in its own section when
+#   generating LaTeX or PDF output.
+separate-classes: no
diff --git a/doc/API/mkapidoc.sh b/doc/API/mkapidoc.sh
new file mode 100644
index 0000000000000000000000000000000000000000..9ae6c00f84bf549efc6dc842d54f5d56f5a1c867
--- /dev/null
+++ b/doc/API/mkapidoc.sh
@@ -0,0 +1,5 @@
+#!/bin/sh
+
+epydoc --config api.conf
+mv api/api.pdf .
+rm -rf api/
diff --git a/doc/TechnicalReference/Makefile b/doc/TechnicalReference/Makefile
new file mode 100644
index 0000000000000000000000000000000000000000..50239034af6f951a0e13f55123ba18d136e07303
--- /dev/null
+++ b/doc/TechnicalReference/Makefile
@@ -0,0 +1,37 @@
+# General Makefile for LaTeX documents by J. F. J. Laros.
+# Last alteration on 15-10-2009.
+#
+# The packages texlive-base-bin, texlive-latex-base and ghostscript should
+#   be installed.
+#
+
+LATEX = latex
+BIBTEX = bibtex
+DVIPS = dvips
+PS2PDF = ps2pdf14
+
+SRC := $(shell grep -H '\\begin{document' *.tex | cut -f 1 -d '.')
+
+BIB := $(shell grep '\\bibliography{' $(SRC).tex > /dev/null && \
+               grep '\\cite{' $(SRC).tex)
+
+all: $(SRC)
+
+$(SRC): $(SRC).tex
+	$(LATEX) $^ 
+ifdef BIB
+	$(BIBTEX) $(SRC)
+endif
+	$(LATEX) $^
+	$(LATEX) $^ 
+	$(DVIPS) $(SRC).dvi -o $(SRC).ps
+
+release: $(SRC) clean
+	$(PS2PDF) $(SRC).ps
+	rm -f $(SRC).ps
+
+clean:
+	rm -f *.aux $(SRC).bbl $(SRC).blg $(SRC).dvi $(SRC).log $(SRC).toc
+
+distclean: clean
+	rm -f $(SRC).ps $(SRC).pdf
diff --git a/doc/TechnicalReference/TechnicalReference.tex b/doc/TechnicalReference/TechnicalReference.tex
new file mode 100644
index 0000000000000000000000000000000000000000..b0e832b516090d80f6a5d96abaf314d3e33f311a
--- /dev/null
+++ b/doc/TechnicalReference/TechnicalReference.tex
@@ -0,0 +1,69 @@
+\newcommand{\thisversion}{2.0}
+
+\documentclass{article}
+\usepackage{amssymb, amsthm, graphicx, float, textcomp}
+\title{\Huge Mutalyzer \thisversion\ Technical Reference Manual}
+\author{Jeroen F. J. Laros
+        \vspace{10pt}\\
+        Department of Human Genetics\\
+        Center for Human and Clinical Genetics\\
+        \texttt{j.f.j.laros@lumc.nl}}
+\date{\today}
+\frenchspacing
+
+\newtheorem{theorem}{Theorem}
+\newtheorem{lemma}[theorem]{Lemma}
+\newtheorem{corollary}[theorem]{Corollary}
+
+\theoremstyle{definition}
+\newtheorem{example}[theorem]{Example}
+\newtheorem{definition}[]{Definition}
+\newtheorem{remark}[theorem]{Remark}
+\newtheorem{conjecture}[theorem]{Conjecture}
+
+\begin{document}
+
+\maketitle
+\thispagestyle{empty}
+\newpage
+
+\pagenumbering{roman}
+\tableofcontents
+\newpage
+
+\pagenumbering{arabic}
+
+\section{Introduction}\label{sec:introduction}
+This document is intended for developers.
+
+\section{Modules}\label{sec:modules}
+Mutalyzer \thisversion\ blabla.
+\subsection{Config}\label{subsec:config}
+\subsection{Output}\label{subsec:output}
+\subsection{Db}\label{subsec:db}
+\subsection{Retriever}\label{subsec:retriever}
+\subsection{Mutator}\label{subsec:mutator}
+\subsection{Scheduler}\label{subsec:scheduler}
+\subsection{GenRecord}\label{subsec:genrecord}
+\subsection{Web}\label{subsec:web}
+\subsection{Misc}\label{subsec:misc}
+
+\section{Programs}\label{sec:programs}
+\subsection{Mutalyzer}\label{subsec:mutalyzer}
+\subsection{VarInfo}\label{subsec:varinfo}
+\subsection{UCSC\_Update}\label{subsec:ucsc_update}
+
+\section{Interfaces}\label{sec:interfaces}
+% handler.py
+\subsection{Web}\label{subsec:webinterface}
+% index.py
+\subsubsection{TAL}
+% templates/
+\subsection{Webservices}\label{subsec:webservinterface}
+% webservice.py
+\subsection{Command line}\label{subsec:commandline}
+
+\bibliography{bibliography}{}
+\bibliographystyle{plain}
+
+\end{document}
diff --git a/doc/TechnicalReference/bibliography.bib b/doc/TechnicalReference/bibliography.bib
new file mode 100644
index 0000000000000000000000000000000000000000..e69de29bb2d1d6434b8b29ae775ad8c2e48c5391
diff --git a/errorcodes.txt b/errorcodes.txt
index e54c44a1f54fa5c707ac4d00b14b14e708eebe1f..b8d0a59021681b9c881a0ca0e65de431105bf4f1 100644
--- a/errorcodes.txt
+++ b/errorcodes.txt
@@ -1,34 +1,39 @@
 Information:
-INFO        | Information.
+INFO        | N | Information.
 
 Warnings:
-WSTART      | Mutation in the start codon.
-WTXSTART    | Mutation hits transcription start.
-WSPLDON     | Mutation hits a splice donor site.
-WSPLACC     | Mutation hits a splice acceptor site.
-WROLL       | Variant position is ambiguous and not the last one was given.
-WINSDUP     | Variant was described as an insertion, but it is a duplication.
-WNOMRNA     | No mRNA field was found in the GenBank record.
-WNOCDS      | No CDS field was found in the GenBank record.
-WNOVER      | No accession version number was given.
-WHASH       | Hash of a GenBank record has changed.
+WSTART      | E | Mutation in the start codon.
+WTXSTART    | E | Mutation hits transcription start.
+WSPLDON     | E | Mutation hits a splice donor site.
+WSPLACC     | E | Mutation hits a splice acceptor site.
+WROLL       | D | Variant position is ambiguous and not the last one was given.
+WINSDUP     | D | Variant was described as an insertion, but it is a
+                  duplication.
+WNOMRNA     | R | No mRNA field was found in the GenBank record.
+WNOCDS      | R | No CDS field was found in the GenBank record.
+WNOCDSLIST  | R | No CDS list was found in the GenBank record.
+WNOVER      | R | No accession version number was given.
+WHASH       | N | Hash of a GenBank record has changed.
+WNOCHANGE   | D | Variant equals reference sequence.
+WNOTMINIMAL | D | A shorter description of a raw variant is possible.
 
 Errors:
-EARGLEN     | There was a discrepancy between the range and the length of the
-            | optional argument.
-EREF        | There was a discrepancy between the reference sequence and the
-            | optional argument.
-ENOCHANGE   | Mutation has no effect.
-ENOTMINIMAL | A shorter description of a raw variant is possible.
-EINSRANGE   | The positions of an insertion are not consecutive.
-ENOCDS      | No CDS field was found in the GenBank record and none could be 
-            | constructed.
+ENOVAR      | D | No mutation given.
+EARGLEN     | D | There was a discrepancy between the range and the length of
+                  the optional argument.
+EREF        | D | There was a discrepancy between the reference sequence and the
+                  optional argument.
+EINSRANGE   | D | The positions of an insertion are not consecutive.
+WNOCDS      | R | No CDS field was found in the GenBank record and none could
+                  be constructed.
+ENOGENE     | R | Gene not found.            
+ESTOP       | R | In frame stop codon found.
 
 Fatal errors:
-EPARSE      | Nomenclature parse error.
-ERECPARSE   | GenBank record parse error.
-EARG        |
-EFILESIZE   | The filesize is either too large or too small.
-ERETR       | Could not retrieve a GenBank record.
-EARG        | Error in the arguments (of a webservice).
-ERANGE      | Position out of range (webservice).
+EPARSE      | D | Nomenclature parse error.
+EBPARSE     | D | Parse error in the submitted batch file.
+ERECPARSE   | R | GenBank record parse error.
+EFILESIZE   | N | The filesize is either too large or too small.
+ERETR       | R | Could not retrieve a GenBank record.
+EARG        | N | Error in the arguments (of a webservice).
+ERANGE      | D | Position out of range (webservice).
diff --git a/install.sh b/install.sh
index 1b0fc9077b1bb3b8096ab3aad93aad9f8dcb5516..71f3a7e2f014f005c061b3cf1a449452252cec75 100644
--- a/install.sh
+++ b/install.sh
@@ -1,22 +1,40 @@
 #!/bin/sh
 
-script="UCSC_update.py"
-cron_entry="25 6 \* \* \* python `pwd`/src/$script"
+updateCron() {
+  cron_entry="$1 python `pwd`/src/$2.py"
+
+  if ! `crontab -l | grep "$cron_entry" > /dev/null`; then
+    echo "Updating cron entry."
+    if `crontab -l | grep $2 > /dev/null`; then
+      echo "Removing old entry."
+      crontab -l | grep -v $2 | crontab
+    fi
+    echo "Installing new entry."
+    (
+      crontab -l
+      echo $cron_entry
+    ) | crontab
+  fi
+}
 
 if `echo $0 | grep '/' > /dev/null`; then
   echo "Please run this script from the installation directory."
   exit 1
 fi
 
-if ! `crontab -l | grep "$cron_entry" > /dev/null`; then
-  echo "Updating cron entry."
-  if `crontab -l | grep $script > /dev/null`; then
-    echo "Removing old entry."
-    crontab -l | grep -v $script | crontab
-  fi
-  echo "Installing new entry."
-  (
-    crontab -l
-    echo $cron_entry
-  ) | crontab
-fi
+updateCron "25 6 \* \* \*" "UCSC_update" 
+updateCron "*/1 \* \* \* \*" "BatchChecker"
+
+cat << EOF > .htaccess
+SetHandler mod_python
+PythonHandler src/handler
+PythonPath "sys.path + ['`pwd`/src']"
+PythonDebug On
+
+RewriteEngine on
+RewriteRule Variant_info.php Variant_info
+EOF
+
+chmod go+rx . src src/Modules templates
+chmod go+r .htaccess mutalyzer.conf src/*.py src/Modules/*.py templates/*
+chmod go+rw var
diff --git a/mutalyzer.conf b/mutalyzer.conf
index 6e3112b565b48bd97acf501dcb44eaaf5facddc6..6a7950dcf607162e674dcbe1ec4a09b963977d28 100644
--- a/mutalyzer.conf
+++ b/mutalyzer.conf
@@ -3,6 +3,7 @@
 #
 
 
+#
 # These settings are used by the Retriever module.
 #
 
@@ -22,6 +23,7 @@ maxDldSize = 10
 minDldSize = 512
 
 
+#
 # These settings are used by the Db module.
 #
 
@@ -34,6 +36,9 @@ dbNames = "hg18", "hg19"
 # MySQL username for the local databases (inernalDb and dnNames).
 LocalMySQLuser = "mutalyzer"
 
+# Host name for the local databases.
+LocalMySQLhost = "localhost"
+
 # MySQL username for the UCSC database.
 RemoteMySQLuser = "genome"
 
@@ -47,6 +52,7 @@ UpdateInterval = 7
 TempFile = "./var/UCSC_Update.txt"
 
 
+#
 # These settings are used by the Output module.
 #
 
@@ -72,6 +78,7 @@ loglevel = 3
 outputlevel = 1
 
 
+#
 # These settings are used by the Mutator module.
 #
 
@@ -85,11 +92,46 @@ maxvissize = 25
 flankclipsize = 6
 
 
+#
 # These settings are used by the Scheduler module.
 #
 
-# Watchdog timeout in seconds.
-watchDogTimeOut = 60
-
 # Name of the batch process.
 processName = "MutalyzerBatch2"
+
+# Return e-mail address.
+mailFrom = "noreply@humgen.nl"
+
+# Location of the mail template.
+mailMessage = "./mail.txt"
+
+# Subject of the message.
+mailSubject = "Result of Mutalyzer batch check."
+
+# Location of the results.
+resultsDir = "./var/cache"
+
+
+#
+# These settings are used by the File module.
+#
+
+# Amount of bytes to be read for determining the file type.
+bufSize = 32768
+
+# The obligatory header in batch request files.
+header = "AccNo", "Genesymbol", "Mutation"
+
+# Directory for temporary files.
+tempDir = "./var"
+
+
+#
+# These settings are used by the GenRecord module.
+#
+
+# Number of upstream nucleotides when searching for a transcript.
+upstream = 5000
+
+# Number of downstream nucleotides when searching for a transcript.
+downstream = 2000
diff --git a/src/BatchChecker.py b/src/BatchChecker.py
index da992a8999db1c2f82821371d508f65e255daf8c..b22e740f650081131872012cdcd0945eb0570ebd 100644
--- a/src/BatchChecker.py
+++ b/src/BatchChecker.py
@@ -7,11 +7,11 @@ if len(sys.argv[0].split('/')) > 2 :
     os.chdir(sys.argv[0].rsplit('/', 2)[0])
 
 from Modules import Config
-from Modules import Db
+from Modules.Db import Batch
 from Modules import Scheduler
 
 C = Config.Config()
-D = Db.Db("local", C.Db.internalDb, C.Db)
+D = Batch(C.Db)
 S = Scheduler.Scheduler(C.Scheduler, D)
 
 if not S.isDaemonRunning() :
diff --git a/src/Modules/Config.py b/src/Modules/Config.py
index 7e3ffa360523bc7bc678fb6fb55fcf4a7a3978de..f8ff8d409c441d6c7a1bb4ba39da2f5cf371dc02 100644
--- a/src/Modules/Config.py
+++ b/src/Modules/Config.py
@@ -1,62 +1,137 @@
 #!/usr/bin/python
 
+"""
+    Module for reading the config file and splitting up the variables into
+    subclasses. Each of these subclasses are used to configure a specific
+    module.
+
+    Public classes:
+        Config ; Read the configuration file and store the data in subclasses.
+"""
+
 class Config() :
     """
-        Read the configuration file and store the data.
-
-        Public variables:
-            # Used by the Retriever module:
-            email      ; Email address used for Entrez.
-            cache      ; Location of the cache directory.
-            cachesize  ; Maximum size of the cache directory in bytes.
-            maxDldSize ; Maximum size of a GenBank record in bytes.
-            minDldSize ; Minimum size of a GenBank record in bytes.
-
-            # Used by the Db module:
-            internalDb      ; Name of the internal database.
-            dbNames         ; Name of the mapping databases
-            LocalMySQLuser  ; Username for the local databases.
-            RemoteMySQLuser ; Username for the remote UCSC database.
-            RemoteMySQLhost ; Hostname of the UCSC database server.
-            UpdateInterval  ; Time window (in days) to search for updates.
-            TempFile        ; Location for downloaded updates.
-
-            # Used by the Output module:
-            log        ; Name and location of the logfile.
-            datestring ; Prefix for log messages.
-
-            # Used by the Mutator module:
-            flanksize     ; Length of the flanking sequences in the 
-                            visualisation.
-            maxvissize    ; Maximum length of the variation in the 
-                            visualisation.
-            flankclipsize ; Length of the inserted/deleted flanks.
+        Read the configuration file and store the data in subclasses.
 
+        Public subclasses:
+            Retriever ; Container for the Retriever configuration variables.
+            Db        ; Container for the Db configuration variables.
+            Output    ; Container for the Output configuration variables.
+            Mutator   ; Container for the Mutator configuration variables.
+            Scheduler ; Container for the Scheduler configuration variables.
+            File      ; Container for the File configuration variables.
+            GenRecord ; Container for the File configuration variables.
 
         Special Methods:
-            __init__ ; Read the configuration file.
+            __init__ ; Read the configuration file and initialise the 
+                       subclasses.
     """
 
     class Retriever() :
+        """
+            Container class for the Retriever configuration variables.
+            
+            Public variables:
+                email      ; Email address used for Entrez.
+                cache      ; Location of the cache directory.
+                cachesize  ; Maximum size of the cache directory in bytes.
+                maxDldSize ; Maximum size of a GenBank record in bytes.
+                minDldSize ; Minimum size of a GenBank record in bytes.
+        """
+
         pass
     #Retriever
 
     class Db() :
-        pass
+        """
+            Container class for the Db configuration variables.
+            
+            Public variables:
+                internalDb      ; Name of the internal database.
+                dbNames         ; Name of the mapping databases
+                LocalMySQLuser  ; Username for the local databases.
+                LocalMySQLhost  ; Hostname of the local databases.
+
+                RemoteMySQLuser ; Username for the remote UCSC database.
+                RemoteMySQLhost ; Hostname of the UCSC database server.
+                UpdateInterval  ; Time window (in days) to search for
+                                  updates.
+                TempFile        ; Location for downloaded updates.
+            """
     #Db
 
     class Output() :
+        """
+            Container class for the Output configuration variables.
+            
+            Public variables:
+                log         ; Name and location of the logfile.
+                datestring  ; Prefix for log messages.
+                loglevel    ; Default level for logging.
+                outputlevel ; Default level for output.
+        """
+
         pass
     #Output
 
     class Mutator() :
+        """
+            Container class for the Mutator configuration variables.
+            
+            Public variables:
+                flanksize     ; Length of the flanking sequences in the 
+                                visualisation.
+                maxvissize    ; Maximum length of the variation in the 
+                                visualisation.
+                flankclipsize ; Length of the inserted/deleted flanks.
+        """
+
         pass
     #Mutator
 
     class Scheduler() :
+        """
+            Container class for the Scheduler configuration variables.
+            
+            Public variables:
+                processName ; Name of the scheduler in the process list.
+                mailFrom    ; Return e-mail address.
+                mailMessage ; Template e-mail.
+                mailSubject ; Subject of the  e-mail.
+                resultsDir  ; Location of the results.
+        """
+
         pass
     #Scheduler
 
+    class File() :
+        """
+            Container class for the File configuration variables.
+            
+            Public variables:
+                bufSize ; Amount of bytes to be read for determining the file 
+                          type.
+                header  ; The obligatory header in batch request files.
+                tempDir ; Directory for temporary files.
+        """
+
+        pass
+    #File
+
+    class GenRecord() :
+        """
+            Container class for the GenRecord configuration variables.
+            
+            Public variables:
+            upstream   ; Number of upstream nucleotides when searching for a 
+                         transcript.
+            downstream ; Number of downstream nucleotides when searching for a 
+                         transcript.
+        """
+
+        pass
+    #File
+
     def __init__(self) :
         """
             Initialise the class with variables read from the configuration 
@@ -64,33 +139,12 @@ class Config() :
             hard coded constant is used (the name and path to the configuration
             file).
 
-            Public variables (altered):
-                # Used by the Retriever module:
-                email      ; Email address used for Entrez.
-                cache      ; Location of the cache directory.
-                cachesize  ; Maximum size of the cache directory in bytes.
-                maxDldSize ; Maximum size of a GenBank record in bytes.
-                minDldSize ; Minimum size of a GenBank record in bytes.
-
-                # Used by the Db module:
-                internalDb      ; Name of the internal database.
-                dbNames         ; Name of the mapping databases
-                LocalMySQLuser  ; Username for the local databases.
-                RemoteMySQLuser ; Username for the remote UCSC database.
-                RemoteMySQLhost ; Hostname of the UCSC database server.
-                UpdateInterval  ; Time window (in days) to search for updates.
-                TempFile        ; Location for downloaded updates.
-
-                # Used by the Output module:
-                log        ; Name and location of the logfile.
-                datestring ; Prefix for log messages.
-
-                # Used by the Mutator module:
-                flanksize     ; Length of the flanking sequences in the 
-                                visualisation.
-                maxvissize    ; Maximum length of the variation in the 
-                                visualisation.
-                flankclipsize ; Length of the inserted/deleted flanks.
+            Public subclasses (altered):
+                Retriever ; Initialised with Retriever configuration variables.
+                Db        ; Initialised with Db configuration variables.
+                Output    ; Initialised with Output configuration variables.
+                Mutator   ; Initialised with Mutator configuration variables.
+                Scheduler ; Initialised with Scheduler configuration variables.
         """
         from configobj import ConfigObj # ConfigObj()
 
@@ -106,7 +160,9 @@ class Config() :
         # Set the variables needed by the Db module.
         self.Db.internalDb = config["internalDb"]
         self.Db.dbNames = config["dbNames"]
+
         self.Db.LocalMySQLuser = config["LocalMySQLuser"]
+        self.Db.LocalMySQLhost = config["LocalMySQLhost"]
         self.Db.RemoteMySQLuser = config["RemoteMySQLuser"]
         self.Db.RemoteMySQLhost = config["RemoteMySQLhost"]
         self.Db.UpdateInterval = int(config["UpdateInterval"])
@@ -124,8 +180,20 @@ class Config() :
         self.Mutator.flankclipsize = int(config["flankclipsize"])
 
         # Set the variables needed by the Scheduler module.
-        self.Scheduler.watchDogTimeOut = int(config["watchDogTimeOut"])
         self.Scheduler.processName = config["processName"]
+        self.Scheduler.mailFrom = config["mailFrom"]
+        self.Scheduler.mailMessage = config["mailMessage"]
+        self.Scheduler.mailSubject = config["mailSubject"]
+        self.Scheduler.resultsDir = config["resultsDir"]
+
+        # Set the variables needed by the File module.
+        self.File.bufSize = int(config["bufSize"])
+        self.File.header = config["header"]
+        self.File.tempDir = config["tempDir"]
+
+        # Set the variables needed by the GenRecord module.
+        self.File.upstream = int(config["upstream"])
+        self.File.downstream = int(config["downstream"])
     #__init__
 #Config
 
diff --git a/src/Modules/Crossmap.py b/src/Modules/Crossmap.py
index 58e336b58bbaebb735f2e100334dbacfa14c879e..37ccf01e7e5b3f115187f98b50f8bdcae3ec6ba3 100644
--- a/src/Modules/Crossmap.py
+++ b/src/Modules/Crossmap.py
@@ -1,5 +1,15 @@
 #!/usr/bin/python
 
+"""
+    Module for conversion from genomic coordinates to coding sequence
+    orientated coordinates and vice versa.
+    The conversions are done based upon a list of splice sites, the CDS start
+    and stop and the orientation of a transcript.
+
+    Public classes:
+        Crossmap ; Convert from g. to c. or n. notation or vice versa.
+"""
+
 class Crossmap() :
     """
         Convert from g. to c. or n. notation or vice versa.
diff --git a/src/Modules/Db.py b/src/Modules/Db.py
index a1abc211471797daee49d7fa683235613001993f..ada5573a234719effae2a3cd22398f65f437be6b 100644
--- a/src/Modules/Db.py
+++ b/src/Modules/Db.py
@@ -1,13 +1,34 @@
 #!/usr/bin/python
 
+"""
+    Module for database access.
+    The Db class is a superclass of the rest of the classes and should not be
+    used as such. The superclass mainly consists of a wrapper for SQL
+    statements.
+
+
+    Public classes:
+        Db      ; Log in to a database and keep it open for queries.
+        Mapping ; Mapping of transcripts and genes.
+        Remote  ; Retrieving updates for the mapping databases.
+        Update  ; Updating the mapping databases.
+        Cache   ; Cache administration.
+        Batch   ; Batch checker.
+"""
+
 import MySQLdb # connect(), escape_string()
 import types   # TupleType
-import time
+import time    # strftime()
+import os      # os.remove()
 
-#from Output import Output
-import os # os.remove()
+from Modules import Misc # ID()
 
-from Modules import Misc
+#
+# Note that compound queries are split into single queries because of a bug
+# in MySQLdb. The functions load_Update(),  merge_cdsUpdates() and
+# merge_Update (search for MYSQL_BUG in this file) are affected and may be
+# rewritten when this bug is fixed.
+#
 
 class Db() :
     """
@@ -17,116 +38,30 @@ class Db() :
             __db ; Interface to the database.
 
         Special methods:
-            __init__(config, where) ; Do the login.
-
-        Private methods:
-            __query(statement) ; General query function.
+            __init__(dbName, mySqlUser, mySqlHost) ; Do the login.
 
         Public methods:
-            # For mapping.
-            get_protAcc(mrnaAcc)      ; Query the database for a protein ID.
-            get_NM_info(mrnaAcc)      ; Retrieve various data for an NM number.
-            get_NM_version(mrnaAcc)   ; Get the version number of an accession 
-                                        number.
-            get_Transcripts(chrom,    ; Get a list of transcripts, given a
-                            position,   chromosome and a range. 
-                            overlap)
-            get_GeneName(mrnaAcc)     ; Get the gene name, given an NM number.
-            isChrom(name)             ; Check whether we know this name to be
-                                        a chromosome name.
-
-            # For updating mapping information
-            get_Update()              ; Retrieve new mapping info from the UCSC.
-            load_Update()             ; Load new mapping info into the local 
-                                        database.
-            count_Updates()           ; Count the number of entries in the new 
-                                        mapping info table.
-            backup_cdsUpdates()       ; Make a backup of updates that overwrite
-                                        the old mapping info.
-            count_cdsUpdates()        ; Count the number of updates that
-                                        overwrite the old mapping info.
-            merge_cdsUpdates()        ; Merge the backup of old mapping info 
-                                        with the other old info.
-            merge_Update()            ; Merge the new mapping info from the 
-                                        UCSC with what we already have.
-
-            # For cache administration.
-            insertGB(AccNo, GI, md5,  ; Insert info about a GenBank record.
-                     ChrAccVer,      
-                     ChrStart, 
-                     ChrStop, 
-                     orientation, 
-                     url)
-            updateHash(AccNo, md5)    ; Update the hash of an accession number.
-            getGBFromLoc(ChrAccVer,   ; Get the accession number from slicing 
-                         ChrStart,      information.
-                         ChrStop, 
-                         orientation)
-            getGBFromHash(md5)        ; Get the accession number from its hash.
-            getGBFromGI(GI)           ; Get the accession number from its GI 
-                                        number.
-            getLoc(AccNo)             ; Get the slicing information of an 
-                                        accession number.
-            getHash(AccNo)            ; Get the hash of a GenBank record.
-            getUrl(AccNo)             ; Get the URL of an accession number.
-
-        Inherited from Output.Config:
-            internalDb      ; Name of the internal database.
-            RemoteMySQLuser ; MySQL username for the UCSC database.
-            RemoteMySQLhost ; Host name for the UCSC database.
-            LocalMySQLuser  ; MySQL username for the local databases.
-            UpdateInterval  ; The size of the time window.
-            TempFile        ; The name and location of the temporary file. This
-                              file is created if it doesn't exist and is
-                              overwritten if it does exist. The function
-                              load_Update() will remove this file.
+            query(statement) ; General query function.
     """
 
-    #
-    # Note that compound queries are split into single queries because of a bug
-    # in MySQLdb. The functions load_Update(),  merge_cdsUpdates() and
-    # merge_Update (search for MYSQL_BUG in this file) are affected and may be
-    # rewritten when this bug is fixed.
-    #
-
-    def __init__(self, where, dbName, config) :
+    def __init__(self, dbName, mySqlUser, mySqlHost) :
         """
-            Log in to the database. The username and the name of the 
-            database are given in the configuration file.
+            Log in to the database. 
 
             Arguments:
-                where  ; A switch to see which database to use:
-                         local  ; Use the database on localhost.
-                         remote ; Use the UCSC database.
-                dbName ; The name of the database to use (hg18 or hg19).
+                dbName    ; The name of the database to use.
+                mySqlUser ; User name for the database.
+                mySqlHost ; Host name for the database.
 
             Private variables (altered):
                 __db       ; The interface to the database.
-
-            Inherited variables from Output.Config:
-                internalDb      ; Name of the internal database.
-                RemoteMySQLuser ; MySQL username for the UCSC database.
-                RemoteMySQLhost ; Host name for the UCSC database.
-                LocalMySQLuser  ; MySQL username for the local databases.
         """
 
-        #Output.__init__(self, __file__)
-        self.__config = config
-
-        self.opened = False
-        if dbName in self.__config.dbNames or dbName == self.__config.internalDb :
-            if where == "remote" :
-                self.__db = MySQLdb.connect(user = self.__config.RemoteMySQLuser, 
-                                            db = dbName,
-                                            host = self.__config.RemoteMySQLhost)
-            else :                                 
-                self.__db = MySQLdb.connect(user = self.__config.LocalMySQLuser, 
-                                            db = dbName)
-            self.opened = True                                                
-        #if                                            
+        self.__db = MySQLdb.connect(user = mySqlUser, db = dbName,
+                                    host = mySqlHost)
     #__init__
 
-    def __query(self, statement) :
+    def query(self, statement) :
         """
             Query the database.
 
@@ -167,11 +102,47 @@ class Db() :
         cursor.close()
 
         return result
-    #__query
+    #query
+#Db    
+
+class Mapping(Db) :
+    """
+        Database functions for mapping of transcripts and genes.
+
+        Special methods:
+            __init__(build, config) ; Initialise the class.
+
+        Public methods:
+            get_protAcc(mrnaAcc)      ; Query the database for a protein ID.
+            get_NM_info(mrnaAcc)      ; Retrieve various data for an NM number.
+            get_NM_version(mrnaAcc)   ; Get the version number of an accession 
+                                        number.
+            get_Transcripts(chrom,    ; Get a list of transcripts, given a
+                            position,   chromosome and a range. 
+                            overlap)
+            get_GeneName(mrnaAcc)     ; Get the gene name, given an NM number.
+            isChrom(name)             ; Check whether we know this name to be
+                                        a chromosome name.
+
+        Inherited methods from Db:
+            query(statement) ; General query function.
+
+        SQL tables from dbNames:
+            map ; Accumulated mapping info.
+    """
+
+    def __init__(self, build, config) :
+        """
+            Initialise the Db parent class. Use the local database for a
+            certain build.
 
-    #
-    # These methods are used for mapping.
-    #
+            Arguments:
+                build  ; The version of the mapping database.
+                config ; Configuration variables.
+        """
+
+        Db.__init__(self, build, config.LocalMySQLuser, config.LocalMySQLhost)
+    #__init__
 
     def get_protAcc(self, mrnaAcc) :
         """
@@ -193,7 +164,7 @@ class Db() :
               WHERE acc = %s;
         """, mrnaAcc
 
-        return self.__query(statement)[0][0]
+        return self.query(statement)[0][0]
     #get_protAcc
 
     def get_NM_info(self, mrnaAcc) :
@@ -222,7 +193,7 @@ class Db() :
               WHERE acc = %s;
         """, mrnaAcc
 
-        return self.__query(statement)[0]
+        return self.query(statement)[0]
     #get_NM_info
 
     def get_NM_version(self, mrnaAcc) :
@@ -245,7 +216,7 @@ class Db() :
               WHERE acc = %s;
         """, mrnaAcc
 
-        ret = self.__query(statement)
+        ret = self.query(statement)
         if ret :
             return int(ret[0][0])
         return 0
@@ -295,7 +266,7 @@ class Db() :
         #else
 
         ret = [] # Convert the results to a normal list.
-        for i in self.__query(statement) :
+        for i in self.query(statement) :
             ret.append(i[0] + '.' + str(self.get_NM_version(i[0])))
         return ret
     #get_Transcripts
@@ -320,7 +291,7 @@ class Db() :
               WHERE acc = %s;
         """, mrnaAcc
 
-        return self.__query(statement)[0][0]
+        return self.query(statement)[0][0]
     #get_GeneName
 
     def isChrom(self, name) :
@@ -344,14 +315,96 @@ class Db() :
               WHERE chrom = %s;
         """, name
 
-        if int(self.__query(statement)[0][0]) > 0 :
+        if int(self.query(statement)[0][0]) > 0 :
             return True
         return False
     #isChrom
 
-    #
-    # These methods are used for updating the mapping information.
-    #
+    def chromName(self, accNo) :
+        """
+            Get the name of a chromosome, given an accession number.
+
+            Arguments:
+                accNo ; The accession number of a chromosome.
+
+            SQL tables from dbNames:
+                ChrName ; Assembly release notes.
+
+            Returns:
+                string ; The name of a chromosome.
+        """
+
+        statement = """
+            SELECT name
+              FROM ChrName
+              WHERE AccNo = %s;
+        """, accNo
+
+        return self.query(statement)[0][0]
+    #chromName
+
+    def chromAcc(self, name) :
+        """
+            Get the accession number of a chromosome, given a name.
+
+            Arguments:
+                name ; The name of a chromosome.
+
+            SQL tables from dbNames:
+                ChrName ; Assembly release notes.
+
+            Returns:
+                string ; The accession number of a chromosome.
+        """
+
+        statement = """
+            SELECT AccNo
+              FROM ChrName
+              WHERE name = %s;
+        """, name
+
+        return self.query(statement)[0][0]
+    #chromAcc
+#Mapper    
+
+class Remote(Db) :
+    """
+        Database functions for retrieving updates for the mapping databases.
+
+        Special methods:
+            __init__(config) ; Initialise the class.
+        
+        Public methods:
+            get_Update()        ; Retrieve new mapping info from the UCSC.
+
+        Inherited methods from Db:
+            query(statement) ; General query function.
+
+        SQL tables from dbNames:
+            gbStatus ; acc -> version mapping (NM to NM + version), 
+                       type, modDate
+            refGene  ; name -> geneName mapping (NM to gene name), 
+                       txStart, txEnd, cdsStart, cdsEnd, exonStarts, 
+                       exonEnds, chrom, strand.
+            refLink  ; mrnaAcc -> protAcc mapping (NM to NP).
+    """
+
+    def __init__(self, build, config) :
+        """
+            Initialise the Db parent class. Use the remote database for a 
+            certain build.
+
+            Arguments:
+                build  ; The version of the mapping database.
+                config ; Configuration variables.
+
+            Private variables (altered):
+                __config ; Configuration variables.
+        """
+
+        self.__config = config
+        Db.__init__(self, build, config.RemoteMySQLuser, config.RemoteMySQLhost)
+    #__init__
 
     def get_Update(self) :
         """
@@ -364,13 +417,6 @@ class Db() :
             the load_Update() function.
 
             
-            Inherited variables from Output.Config:
-                UpdateInterval ; The size of the time window.
-                TempFile       ; The name and location of the temporary file. 
-                                 This file is created if it doesn't exist and
-                                 is overwritten if it does exist. The function
-                                 load_Update() will remove this file.
-
             SQL tables from dbNames:
                 gbStatus ; acc -> version mapping (NM to NM + version), 
                            type, modDate
@@ -394,7 +440,7 @@ class Db() :
         handle = open(self.__config.TempFile, "w")
 
         # Convert the results to a tab delimited file.
-        for i in self.__query(statement) :
+        for i in self.query(statement) :
             for j in i :
                 handle.write(str(j) + chr(0x09))  # 0x09 is a TAB.
             handle.write('\n')
@@ -402,6 +448,53 @@ class Db() :
 
         handle.close()
     #get_Update
+#Remote    
+
+class Update(Db) :
+    """
+        Database functions for updating the mapping databases.
+
+        Public methods:
+            load_Update()       ; Load new mapping info into the local database.
+            count_Updates()     ; Count the number of entries in the new
+                                  mapping info table.
+            backup_cdsUpdates() ; Make a backup of updates that overwrite the
+                                  old mapping info.
+            count_cdsUpdates()  ; Count the number of updates that overwrite
+                                  the old mapping info.
+            merge_cdsUpdates()  ; Merge the backup of old mapping info with the
+                                  other old info.
+            merge_Update()      ; Merge the new mapping info from the UCSC with
+                                  what we already have.
+
+        Inherited methods from Db:
+            query(statement) ; General query function.
+
+        SQL tables from dbNames:
+            map                ; Accumulated mapping info.
+            map_temp           ; Newly found data.
+            map_new            ; Merge of map_temp and map.
+            map_cdsBackup_temp ; Entries that were updated without an increment
+                                 of the version number.
+            map_cdsBackup      ; Merge of map_cdsBackup_temp and itself.
+    """
+
+    def __init__(self, build, config) :
+        """
+            Initialise the Db parent class. Use the remote database for a 
+            certain build.
+
+            Arguments:
+                build  ; The version of the mapping database.
+                config ; Configuration variables.
+
+            Private variables (altered):
+                __config ; Configuration variables.
+        """
+
+        self.__config = config
+        Db.__init__(self, build, config.LocalMySQLuser, config.LocalMySQLhost)
+    #__init__
 
     def load_Update(self) :
         """
@@ -409,12 +502,6 @@ class Db() :
             configuration file) created by the get_Update() function and import
             it in the local database.
 
-            Inherited variables from Config:
-                TempFile ; The name and location of the temporary file. This 
-                           file is created by the get_Update() function. After
-                           the local import is complete, this file will be
-                           removed.
-            
             SQL tables from dbNames (altered):
                 map_temp ; Created and loaded with data from TempFile.
 
@@ -428,13 +515,13 @@ class Db() :
         statement = """
             CREATE TABLE map_temp LIKE map;
         """, None
-        self.__query(statement)
+        self.query(statement)
         statement = """
             LOAD DATA LOCAL INFILE %s 
               INTO TABLE map_temp;
         """, self.__config.TempFile
 
-        self.__query(statement)
+        self.query(statement)
 
         os.remove(self.__config.TempFile)
     #load_Update
@@ -457,7 +544,7 @@ class Db() :
               FROM map_temp;
         """, None
 
-        return int(self.__query(statement)[0][0])
+        return int(self.query(statement)[0][0])
     #count_Updates
 
     def backup_cdsUpdates(self) :
@@ -490,7 +577,7 @@ class Db() :
                 );
         """, None
 
-        self.__query(statement)
+        self.query(statement)
     #backup_cdsUpdates
 
     def count_cdsUpdates(self) :
@@ -514,7 +601,7 @@ class Db() :
               FROM map_cdsBackup_temp;
         """, None
 
-        return int(self.__query(statement)[0][0])
+        return int(self.query(statement)[0][0])
     #count_cdsUpdates
 
     def merge_cdsUpdates(self) :
@@ -537,12 +624,12 @@ class Db() :
               SELECT * 
                 FROM map_cdsBackup_temp;
         """, None
-        self.__query(statement)
+        self.query(statement)
         statement = """
             DROP TABLE map_cdsBackup_temp;
         """, None
 
-        self.__query(statement)
+        self.query(statement)
     #merge_cdsUpdates
 
     def merge_Update(self) :
@@ -574,38 +661,83 @@ class Db() :
                     AND map.txStart = map_temp.txStart
                 );
         """, None
-        self.__query(statement)
+        self.query(statement)
         statement = """
             DROP TABLE map;
         """, None
-        self.__query(statement)
+        self.query(statement)
         statement = """
             CREATE TABLE map
               SELECT * 
                 FROM map_new;
         """, None
-        self.__query(statement)
+        self.query(statement)
         statement = """
             DROP TABLE map_new;
         """, None
-        self.__query(statement)
+        self.query(statement)
         statement = """
             DROP TABLE map_temp;
         """, None
 
-        self.__query(statement)
+        self.query(statement)
     #merge_Update
+#Update
 
-    #
-    # These methods are used for cache administration.
-    #
+class Cache(Db) :
+    """
+        Database functions for cache administration.
 
-    def insertGB(self, AccNo, GI, md5, ChrAccVer, ChrStart, 
+        Special methods:
+            __init__(config) ; Initialise the class.
+        
+        Public methods:
+            insertGB(accNo, GI,       ; Insert info about a GenBank record.
+                     fileHash,  
+                     ChrAccVer,      
+                     ChrStart, 
+                     ChrStop, 
+                     orientation, 
+                     url)
+            updateHash(accNo,         ; Update the hash of an accession number.
+                       fileHash)
+            getGBFromLoc(ChrAccVer,   ; Get the accession number from slicing 
+                         ChrStart,      information.
+                         ChrStop, 
+                         orientation)
+            getGBFromHash(fileHash)   ; Get the accession number from its hash.
+            getGBFromGI(GI)           ; Get the accession number from its GI 
+                                        number.
+            getLoc(accNo)             ; Get the slicing information of an 
+                                        accession number.
+            getHash(accNo)            ; Get the hash of a GenBank record.
+            getUrl(accNo)             ; Get the URL of an accession number.
+
+        Inherited methods from Db:
+            query(statement) ; General query function.
+
+        SQL tables from internalDb:
+            GBInfo ; Information about cached and uploaded GenBank files.
+    """
+
+    def __init__(self, config) :
+        """
+            Initialise the Db parent class. Use the internalDb.
+
+            Arguments:
+                config ; Configuration variables.
+        """
+
+        Db.__init__(self, config.internalDb, config.LocalMySQLuser, 
+                    config.LocalMySQLhost)
+    #__init__
+
+    def insertGB(self, accNo, GI, fileHash, ChrAccVer, ChrStart, 
                  ChrStop, orientation, url) :
         """                 
             Insert information about a GenBank record in the internal database.
 
-            The AccNo and md5 arguments are mandatory.
+            The accNo and fileHash arguments are mandatory.
             - If the record is a normal RefSeq, then the GI number should be
               provided.
             - If the record is a chromosome slice, then the ChrAccVer, 
@@ -616,9 +748,9 @@ class Db() :
               is assumed to be uploaded.
 
             Arguments:
-                AccNo       ; The name associated with this record.
+                accNo       ; The name associated with this record.
                 GI          ; The GI number (if available).
-                md5         ; The md5sum of the content of the record.
+                fileHash    ; The hash of the content of the record.
                 ChrAccVer   ; The accession number of the chromosome (if 
                               available).
                 ChrStart    ; The start of the record in chromosomal 
@@ -637,18 +769,19 @@ class Db() :
         statement = """
             INSERT INTO GBInfo 
               VALUES (%s, %s, %s, %s, %s, %s, %s, %s);
-        """, (AccNo, GI, md5, ChrAccVer, ChrStart, ChrStop, orientation, url)
+        """, (accNo, GI, fileHash, ChrAccVer, ChrStart, ChrStop, orientation, 
+              url)
 
-        self.__query(statement)
+        self.query(statement)
     #insertGB
 
-    def updateHash(self, AccNo, md5) :
+    def updateHash(self, accNo, fileHash) :
         """
             Update the hash of an accession number.
 
             Arguments:
-                AccNo ; The accession number of a GenBank record.
-                hash  ; The hash of a GenBank record.
+                accNo     ; The accession number of a GenBank record.
+                fileHash  ; The hash of a GenBank record.
 
             SQL tables from internalDb (altered):
                 GBInfo ; Information about cached and uploaded GenBank files.
@@ -658,9 +791,9 @@ class Db() :
             UPDATE GBInfo
               SET hash = %s
               WHERE AccNo = %s;
-        """, (md5, AccNo)
+        """, (fileHash, accNo)
 
-        self.__query(statement)
+        self.query(statement)
     #updateHash
 
     def getGBFromLoc(self, ChrAccVer, ChrStart, ChrStop, orientation) :
@@ -692,18 +825,18 @@ class Db() :
               AND orientation = %s;
         """, (ChrAccVer, ChrStart, ChrStop, orientation)
 
-        ret = self.__query(statement)
+        ret = self.query(statement)
         if ret :
             return ret[0][0]
         return None
     #getGBFromLoc
 
-    def getGBFromHash(self, md5) :
+    def getGBFromHash(self, fileHash) :
         """
             Get the accession number from its hash.
 
             Arguments:
-                hash ; The hash of a GenBank record.
+                fileHash ; The hash of a GenBank record.
 
             SQL tables from internalDb:
                 GBInfo ; Information about cached and uploaded GenBank files.
@@ -716,9 +849,9 @@ class Db() :
             SELECT AccNo 
               FROM GBInfo
               WHERE hash = %s;
-        """, md5
+        """, fileHash
 
-        ret = self.__query(statement)
+        ret = self.query(statement)
         if ret :
             return ret[0][0]
         return None
@@ -745,19 +878,19 @@ class Db() :
               WHERE GI = %s;
         """, GI
 
-        ret = self.__query(statement)
+        ret = self.query(statement)
         if ret :
             return ret[0][0]
         return None
     #getGBFromGI
 
-    def getLoc(self, AccNo) :
+    def getLoc(self, accNo) :
         """
             Get the slicing information of an accession number, typically this
             only affects UD numbers.
 
             Arguments:
-                AccNo ; The accession number of a genbank record.
+                accNo ; The accession number of a genbank record.
 
             SQL tables from internalDb:
                 GBInfo ; Information about cached and uploaded GenBank files.
@@ -775,20 +908,20 @@ class Db() :
             SELECT ChrAccVer, ChrStart, ChrStop, orientation 
               FROM GBInfo
               WHERE AccNo = %s;
-        """, AccNo
+        """, accNo
 
-        ret = self.__query(statement)
+        ret = self.query(statement)
         if ret :
             return list(ret[0])
         return None
     #getLoc
 
-    def getHash(self, AccNo) :
+    def getHash(self, accNo) :
         """
             Get the hash of a GenBank record identified by an accession number.
 
             Arguments:
-                AccNo ; The accession number of a genbank record.
+                accNo ; The accession number of a genbank record.
 
             SQL tables from internalDb:
                 GBInfo ; Information about cached and uploaded GenBank files.
@@ -801,21 +934,21 @@ class Db() :
             SELECT hash 
               FROM GBInfo
               WHERE AccNo = %s;
-        """, AccNo
+        """, accNo
 
-        ret = self.__query(statement)
+        ret = self.query(statement)
         if ret :
             return ret[0][0]
         return None
     #getHash
 
-    def getUrl(self, AccNo) :
+    def getUrl(self, accNo) :
         """
             Get the URL of an accession number, typically this only affects
             uploaded UD numbers.
 
             Arguments:
-                AccNo ; The accession number of a genbank record.
+                accNo ; The accession number of a genbank record.
 
             SQL tables from internalDb:
                 GBInfo ; Information about cached and uploaded GenBank files.
@@ -828,61 +961,89 @@ class Db() :
             SELECT url 
               FROM GBInfo
               WHERE AccNo = %s;
-        """, AccNo
+        """, accNo
 
-        ret = self.__query(statement)
+        ret = self.query(statement)
         if ret :
             return ret[0][0]
         return None
     #getHash
 
-    def getGI(self, AccNo) :
+    def getGI(self, accNo) :
         """
+            Get the GI number that is connected to the accession number.
+
+            Arguments:
+                accNo ; The accession number.        
+
+            SQL tables from internalDb:
+                GBInfo ; Information about cached and uploaded GenBank files.
         """
+
         statement = """
             SELECT GI 
               FROM GBInfo
               WHERE AccNo = %s;
-        """, AccNo
+        """, accNo
 
-        ret = self.__query(statement)
+        ret = self.query(statement)
         if ret :
             return ret[0][0]
         return None
     #getGI
+#Cache    
 
-    #
-    # These methods are for the batch checker.
-    #
+class Batch(Db) :
+    """
+        Database functions for the batch checker.
 
-    def getWatchDogTimer(self) :
-        """
-        """
+        Special methods:
+            __init__(config) ; Initialise the class.
 
-        statement = """
-            SELECT Value 
-              FROM Var
-              WHERE Name = "WatchDog";
-        """, None
+        Public methods:
+            isJobListEmpty()     ; See if there are active jobs.
+            addJob(outputFilter, ; Add a job and give it a unique ID.
+                   email, 
+                   fromHost) 
+            getJobs()            ; Get a list of active jobs.
+            removeJob(jobID)     ; Remove a job and return information about 
+                                   the job submitter.
+            addToQueue(jobID,    ; Add a request belonging to a certain job to
+                       accNo,      the queue.
+                       gene, 
+                       variant)
+            getFromQueue(jobID)  ; Get a request belonging to a certain job 
+                                   from the queue.
+        
+        Inherited methods from Db:
+            query(statement) ; General query function.
 
-        return int(self.__query(statement)[0][0])
-    #getWatchDogTimer
+        SQL tables from internalDb:
+            BatchJob   ; Job information.
+            BatchQueue ; Requests.
+    """
 
-    def setWatchDogTimer(self) :
-        """
+    def __init__(self, config) :
         """
+            Initialise the Db parent class. Use the internalDb.
 
-        statement = """
-            UPDATE Var
-              SET Value = %s
-              WHERE Name = "WatchDog";
-        """, time.strftime("%s")
+            Arguments:
+                config ; Configuration variables.
+        """
 
-        self.__query(statement)
-    #setWatchDogTimer
+        Db.__init__(self, config.internalDb, config.LocalMySQLuser, 
+                    config.LocalMySQLhost)
+    #__init__
 
     def isJobListEmpty(self) :
         """
+            See if there are active jobs.
+
+            SQL tables from internalDb:
+                BatchJob ; Job information.
+
+            Returns:
+                boolean ; False if there are active jobs, True otherwise.
         """
 
         statement = """
@@ -890,13 +1051,24 @@ class Db() :
               FROM BatchJob;
         """, None
 
-        if int(self.__query(statement)[0][0]) :
+        if int(self.query(statement)[0][0]) :
             return False
         return True
     #isJobListEmpty
 
-    def addJob(self, output_filter, email) :
+    def addJob(self, outputFilter, email, fromHost) :
         """
+            Add a job and give it a unique ID.
+
+            Arguments:
+                outputFilter ; Output settings for all requests in this job.
+                email        ; Contact information of the submitter.
+
+            SQL tables from internalDb (altered):
+                BatchJob ; Job information.
+
+            Returns:
+                int ; A job ID.
         """
 
         M = Misc.Misc()
@@ -904,15 +1076,22 @@ class Db() :
         del M
         statement = """
             INSERT INTO BatchJob
-              VALUES (%s, %s, %s);
-        """, (jobID, output_filter, email)
+              VALUES (%s, %s, %s, %s);
+        """, (jobID, outputFilter, email, fromHost)
 
-        self.__query(statement)
+        self.query(statement)
         return jobID
     #addJob
 
     def getJobs(self) :
         """
+            Get a list of active jobs.
+
+            SQL tables from internalDb:
+                BatchJob ; Job information.
+
+            Returns:
+                list ; List of job IDs.
         """
         
         statement = """
@@ -921,46 +1100,85 @@ class Db() :
         """, None
 
         ret = []
-        for i in self.__query(statement) :
+        for i in self.query(statement) :
             ret.append(i[0])
         return ret
     #getJobs
 
     def removeJob(self, jobID) :
         """
-        """
+            Remove a job (because the queue for this job is empty) and return
+            information needed to alert the job submitter.
+            
+            Arguments:
+                jobID   ; Identifier of a job.
+
+            SQL tables from internalDb (altered):
+                BatchJob ; Job information.
 
+            Returns:
+                triple ; Data for the job submitter.
+        """
+        
+        # First retrieve all information about this job.
         statement = """
-            SELECT EMail
+            SELECT EMail, Filter, FromHost
               FROM BatchJob
               WHERE JobID = %s;
         """, jobID
-        eMail = self.__query(statement)[0][0]
+        data = self.query(statement)[0]
 
+        # Remove the job.
         statement = """
             DELETE 
               FROM BatchJob
               WHERE JobID = %s;
         """, jobID
 
-        self.__query(statement)
-        return eMail
+        self.query(statement)
+        return data
     #removeJob
 
-    def addToQueue(self, jobID, AccNo, Gene, Variant) :
+    def addToQueue(self, jobID, accNo, gene, variant) :
         """
+            Add a request belonging to a certain job to the queue.
+
+            Arguments:
+                jobID   ; Identifier of a job.
+                accNo   ; The accession number of a request.
+                gene    ; The gene and transcript variant information.
+                variant ; The variant.
+
+            SQL tables from internalDb (altered):
+                BatchQueue ; Requests.
         """
 
+        # The first value (QueueID) will be auto increased by MySQL.
         statement = """
             INSERT INTO BatchQueue
               VALUES (%s, %s, %s, %s, %s);
-        """, (None, jobID, AccNo, Gene, Variant)
+        """, (None, jobID, accNo, gene, variant)
 
-        self.__query(statement)
+        self.query(statement)
     #addToQueue
 
     def getFromQueue(self, jobID) :
         """
+            Get a request belonging to a certain job from the queue. If a
+            request is found, remove it from the queue and return it. Otherwise
+            return nothing.
+
+            Arguments:
+                jobID ; Identifier of a job.
+
+            SQL tables from internalDb (altered):
+                BatchQueue ; Requests.
+
+            Returns:
+                triple:
+                    accNo   ; The accession number of a request.
+                    gene    ; The gene and transcript variant information.
+                    variant ; The variant.
         """
 
         statement = """
@@ -971,35 +1189,27 @@ class Db() :
               LIMIT 1;
         """, jobID
 
-        results = self.__query(statement)
+        results = self.query(statement)
         if results :
-            queueID, accNo, gene, variant = results[0]
+            jobID, accNo, gene, variant = results[0]
         else :
             return None
 
+        # We have found a request, so remove it from the queue.
         statement = """
             DELETE 
               FROM BatchQueue
               WHERE QueueID = %s;
-        """, queueID
+        """, jobID
 
-        self.__query(statement)
+        self.query(statement)
         return accNo, gene, variant
     #getFromQueue
-#Db
+#Batch    
 
 #
 # Unit test.
 #
 if __name__ == "__main__" :
-    # Get the username / db from the config file.
-    D = Db("local")
-
-    # Do some basic testing (will crash if MySQL is not set up properly.
-    D.get_protAcc("NM_002001")
-    D.get_NM_info("NM_002001")
-    D.get_NM_version("NM_002001")
-    D.get_Transcripts("chr1", 159272155, 159272155, 0)
-    D.get_GeneName("NM_002001")
-    del D
+    pass
 #if
diff --git a/src/Modules/File.py b/src/Modules/File.py
new file mode 100644
index 0000000000000000000000000000000000000000..713b399bed4fd837ed0473397e17363afc4ac7b2
--- /dev/null
+++ b/src/Modules/File.py
@@ -0,0 +1,322 @@
+#!/usr/bin/python
+
+"""
+    Module for parsing CSV files and spreadsheets.
+
+    Public classes:
+        File ; Parse CSV files and spreadsheets.
+"""
+
+import magic           # open(), MAGIC_MIME, MAGIC_NONE
+import csv             # Sniffer(), reader(), Error
+import xlrd            # open_workbook()
+import zipfile         # ZipFile()
+import xml.dom.minidom # parseString()
+import os              # remove()
+import types           # UnicodeType
+
+from Modules import Misc
+
+class File() :
+    """
+        Parse CSV files and spreadsheets.
+
+        Private variables:
+                __config ; Configuration variables.
+                __output ; The Output object.
+
+        Special methods:
+            __init__(config, output) ; Initialse the class.
+
+        Private methods:
+            __tempFileWrapper(func,   ; Call func() with a filename.
+                              handle)
+            __getMimeType(handle)     ; Get the mime type of a stream.
+            __parseCsvFile(handle)    ; Parse a CSV file.
+            __parseXlsFile(handle)    ; Parse an Excel file.
+            __parseOdsFile(handle)    ; Parse an OpenDocument Spreadsheet file.
+            __checkBatchFormat(job)   ; Check a batch job and sanitize it.
+
+        Public methods:
+            parseFileRaw(handle)   ; Parse a stream with the appropriate parser.
+            parseBatchFile(handle) ; Parse a stream with the appropriate parser
+                                     and sanitize the output.
+    """
+
+    def __init__(self, config, output) :
+        """
+            Initialise the class.
+
+            Private variables (altered):
+                __config ; Initialised with configuration variables.
+                __output ; Set to the Output object.
+        """
+
+        self.__config = config
+        self.__output = output
+    #__init__
+
+    def __tempFileWrapper(self, func, handle) :
+        """
+            Make a temporary file, put the content of a stream in it and pass
+            the filename to a general function. Return whatever this function
+            returns.
+
+            Arguments:
+                func   ; A general function that needs a file name as argument.
+                handle ; A stream.
+
+            Returns:
+                unknown ; The output of func().
+        """
+
+        # Generate an unique filename in the tempDir directory.
+        MiscInstance = Misc.Misc()
+        fileName = self.__config.tempDir + '/' + str(MiscInstance.ID())
+        del MiscInstance
+
+        # Dump the content of the stream pointed to by handle into the file.
+        handle.seek(0)
+        writeHandle = open(fileName, "w")
+        writeHandle.write(handle.read())
+        writeHandle.close()
+
+        # Open the file with func().
+        ret = func(fileName)
+        os.remove(fileName)
+
+        return ret
+    #__tempFileWrapper
+
+    def __getMimeType(self, handle) :
+        """
+            Get the mime type of a stream by inspecting a fixed number of bytes.
+            The stream is not rewinded after use.
+
+            Arguments:
+                handle ; A handle to a stream.
+
+            Private variables:
+                __config ; The bufSize configuration variables.
+
+            Returns:
+                string ; The mime type of a file.
+        """
+
+        handle.seek(0)
+        buf = handle.read(self.__config.bufSize)
+
+        MagicInstance = magic.open(magic.MAGIC_MIME)
+        MagicInstance.load()
+        mimeType = MagicInstance.buffer(buf).split(';')[0]
+        MagicInstance.close()
+        MagicInstance = magic.open(magic.MAGIC_NONE)
+        MagicInstance.load()
+        description = MagicInstance.buffer(buf)
+        del MagicInstance
+        
+        return mimeType, description
+    #__getMimeType
+
+    def __parseCsvFile(self, handle) :
+        """
+            Parse a CSV file.
+            The stream is not rewinded after use.
+
+            Arguments:
+                handle ; A handle to a stream.
+
+            Private variables:
+                __config ; The bufSize configuration variables.
+
+            Returns:
+                list ; A list of lists.
+        """
+
+        handle.seek(0)
+        buf = handle.read(self.__config.bufSize)
+
+        try :
+            dialect = csv.Sniffer().sniff(buf)
+        except csv.Error, e :
+            self.__output.addMessage(__file__, 4, "EBPARSE", e)
+            return None
+        #except
+
+        handle.seek(0)
+        reader = csv.reader(handle, dialect)
+
+        ret = []
+        for i in reader :
+            ret.append(i)
+
+        return ret
+    #__parseCsvFile
+
+    def __parseXlsFile(self, handle) :
+        """
+            Parse an Excel file.
+            The stream is not rewinded after use.
+
+            Arguments:
+                handle ; A handle to a stream.
+
+            Returns:
+                list ; A list of lists.
+        """
+
+        workBook = self.__tempFileWrapper(xlrd.open_workbook, handle)
+        sheet = workBook.sheet_by_index(0)
+
+        ret = []
+        for i in range(sheet.nrows) :
+            row = []
+            for j in sheet.row_values(i) :
+                if type(j) == types.UnicodeType : # Convert the data to strings.
+                    row.append(j.encode("utf8"))
+                else :
+                    row.append(str(j))
+            #for
+            ret.append(row)
+        #for
+
+        del sheet, workBook
+
+        return ret
+    #__parseXlsFile
+
+    def __parseOdsFile(self, handle) :
+        """
+            Parse an OpenDocument Spreadsheet file.
+            The stream is not rewinded after use.
+
+            Arguments:
+                handle ; A handle to a stream.
+
+            Returns:
+                list ; A list of lists.
+
+        """
+
+        zipFile = self.__tempFileWrapper(zipfile.ZipFile, handle)
+        doc = xml.dom.minidom.parseString(zipFile.read("content.xml"))
+        zipFile.close()
+
+        ret = []
+        for i in doc.getElementsByTagName("table:table-row") :
+            row = []
+            for j in i.getElementsByTagName("table:table-cell") :
+                c = j.getElementsByTagName("text:p")
+                if c :
+                    row.append(c[0].lastChild.data.encode("utf8"))
+                #if
+            #for
+            ret.append(row)
+        #for
+
+        return ret
+    #__parseOdsFile
+
+    def __checkBatchFormat(self, job) :
+        """
+            Check if a job is of the correct format.
+            - Each row should consist of three elements.
+            - The first and the last element should be non-zero.
+            - The first line should be the header defined in the config file.
+            - Silently ignore all empty lines.
+
+            Arguments:
+                job ; list of lists.
+
+            Private variables:
+                __config ; The header configuration variable.
+
+            Returns:
+                list ; A sanitised list of lists (without a header or empty
+                       lines).
+        """
+        
+        if job[0] != self.__config.header :
+            self.__output.addMessage(__file__, 4, "EBPARSE", 
+                                     "Header not valid.")
+            return None
+        #if
+
+        for i in range(0, len(job)) :
+            if job[i] :                                      # Non empty line.
+                if len(job[i]) == 3 :
+                    if job[i][0] or job[i][1] or job[i][2] : # Non empty line.
+                        if not job[i][0] :
+                            self.__output.addMessage(__file__, 4, "EBPARSE",
+                                "The first column may not be empty in line " \
+                                "%i." % i)
+                            return None
+                        #if
+                        if not job[i][2] :
+                            self.__output.addMessage(__file__, 4, "EBPARSE",
+                                "The last column may not be empty in line " \
+                                "%i." % i)
+                            return None
+                        #if
+                    #if
+                #if
+                else :
+                    self.__output.addMessage(__file__, 4, "EBPARSE",
+                        "Wrong amount of columns in line %i.\n" % i)
+                    return None
+                #else
+            #if
+        #for
+
+        # All tests are passed, now we do some trimming.
+        ret = []
+        for i in range(1, len(job)) :
+            if job[i] and job[i] != ['', '', ''] :
+                ret.append(job[i])
+
+        return ret
+    #__checkBatchFormat
+
+    def parseFileRaw(self, handle) :
+        """
+            Check which format a stream has and parse it with the appropriate
+            parser if the stream is recognised.
+
+            Arguments:
+                handle ; A handle to a stream.
+
+            Returns:
+                list ; A list of lists, None if an error occured.
+        """
+
+        mimeType = self.__getMimeType(handle)
+        if mimeType[0] == "text/plain" :
+            return self.__parseCsvFile(handle)
+        if mimeType[0] == "application/vnd.ms-office" :
+            return self.__parseXlsFile(handle)
+        if mimeType == ("application/octet-stream", 
+                        "OpenDocument Spreadsheet") :
+            return self.__parseOdsFile(handle)
+
+        return None
+    #parseFile
+
+    def parseBatchFile(self, handle) :
+        """
+            Check which format a stream has and parse it with the appropriate
+            parser if the stream is recognised.
+
+            Arguments:
+                handle ; A handle to a stream.
+
+            Returns:
+                list ; A sanitised list of lists (without a header or empty
+                       lines), or None if an error occured.
+        """
+
+        job = self.parseFileRaw(handle)
+        if job :
+            return self.__checkBatchFormat(job)
+        return None
+    #parseBatchFile
+#File
diff --git a/src/Modules/GenRecord.py b/src/Modules/GenRecord.py
index e8d21872a928f34c83bb6df2c6cd08c36c3b806f..9af2397811160b970096ac45908c738ef84148f2 100644
--- a/src/Modules/GenRecord.py
+++ b/src/Modules/GenRecord.py
@@ -1,6 +1,23 @@
 #!/usr/bin/python
 
-class Plist(object) :
+import Crossmap
+import Bio
+
+"""
+    Module to convert a GenBank record to a nested dictionary consisting of
+    a list of genes, which itself consists of a list of loci. This structure
+    makes it possible to iterate over genes and transcripts without having to
+    search for them each time.
+
+    Public classes:
+        PList     ; Store a general location and a list of splice sites.
+        Locus     ; Store data about the mRNA and CDS splice sites.
+        Gene      ; Store a list of Locus objects and the orientation.
+        Record    ; Store a geneList and other additional information.
+        GenRecord ; Convert a GenBank record to a nested dictionary.
+"""
+
+class PList(object) :
     """
         A position list object, to store a general location and a list of 
         specific splice sites (if available).
@@ -30,9 +47,9 @@ class Plist(object) :
         """
 
         self.location = []
-        self.list = []
+        self.positionList = []
     #__init__
-#plist
+#PList
 
 class Locus(object) :
     """
@@ -47,26 +64,42 @@ class Locus(object) :
             exon ; A position list object.
     """
 
-    def __init__(self) :
+    def __init__(self, name) :
         """
             Initialise the class.
 
             Public variables (altered):
-                mRNA ; A position list object.
-                CDS  ; A position list object.
-                exon ; A position list object.
-                CM   ; A Crossmap object.
+                mRNA     ; A position list object.
+                CDS      ; A position list object.
+                location ;
+                exon     ; A position list object.
+                txTable  ; The translation table.
+                CM       ; A Crossmap object.
         """
 
+        self.name = name
         self.mRNA = None
         self.CDS = None
         self.location = []
         self.exon = None
         self.txTable = 1
         self.CM = None
-
+        self.transcriptID = None
+        self.proteinID = None
+        self.molType = 'c'
+        self.description = ""
     #__init__
-#locus
+
+    def addToDescription(self, rawVariant) :
+        """
+        """
+
+        if self.description :
+            self.description = "%s;%s" % (self.description, rawVariant)
+        else :
+            self.description = rawVariant
+    #addToDescription
+#Locus
 
 class Gene(object) :
     """
@@ -82,7 +115,7 @@ class Gene(object) :
             list        ; A list of Locus objects.
     """
 
-    def __init__(self) :
+    def __init__(self, name) :
         """
             Initialise the class.
 
@@ -91,21 +124,32 @@ class Gene(object) :
                 list        ; A list of Locus objects.
         """
 
-        self.orientation = 0
-        self.list = {}
+        self.name = name
+        self.orientation = 1
+        self.transcriptList = []
     #__init__
-#gene
 
-class RecordObj(object) :
+    def findLocus(self, name) :
+        """
+        """
+
+        for i in self.transcriptList :
+            if i.name == name :
+                return i
+        return None
+    #findLocus
+#Gene
+
+class Record(object) :
     """
-        A RecordObj object, to store a genelist and other additional 
+        A Record object, to store a geneList and other additional 
         information.
 
         Special methods:
             __init__() ; Initialise the class.
 
         Public variables:
-            genelist  ; List of Gene objects.
+            geneList  ; List of Gene objects.
             mol_type  ; Variable to indicate the sequence type (DNA, RNA, ...)
             organelle ; Variable to indicate whether the sequence is from the
                         nucleus or from an onganelle (if so, also from which 
@@ -120,7 +164,7 @@ class RecordObj(object) :
 
 
             Public variables (altered):
-                genelist  ; List of Gene objects.
+                geneList  ; List of Gene objects.
                 mol_type  ; Variable to indicate the sequence type (DNA, RNA, 
                             ...)
                 organelle ; Variable to indicate whether the sequence is from
@@ -130,16 +174,36 @@ class RecordObj(object) :
                             information is present.
         """
 
-        self.genelist = {}
+        self.geneList = []
         self.mol_type = None
         self.organelle = None
-        self.source = Gene()
+        self.source = Gene(None)
     #__init__
-#RecordObj
+
+    def hasGene(self, name) :
+        """
+        """
+
+        for i in self.geneList :
+            if i.name == name :
+                return True
+        return False                
+    #hasGene
+
+    def findGene(self, name) :
+        """
+        """
+
+        for i in self.geneList :
+            if i.name == name :
+                return i
+        return None
+    #findGene
+#Record
 
 class GenRecord() :
     """
-        Hmmmm.
+        Convert a GenBank record to a nested dictionary.
 
         Private methods:
             __location2pos(location)             ;
@@ -150,6 +214,15 @@ class GenRecord() :
                                   structured dictionary.
     """
 
+    def __init__(self, config, output) :
+        """
+        """
+
+        self.__config = config
+        self.__output = output
+        self.record = None
+    #__init__
+
     def __location2pos(self, location) :
         """
             Convert a location object to a tuple of integers.
@@ -184,6 +257,10 @@ class GenRecord() :
         ret = []
     
         for i in locationList.sub_features :
+            if i.ref : # This is a workaround for a bug in BioPython.
+                ret = None
+                break
+            #if
             temp = self.__location2pos(i.location)
             ret.append(temp[0])
             ret.append(temp[1])
@@ -192,51 +269,74 @@ class GenRecord() :
         return ret
     #__locationList2posList
 
-    """
-    def __sortins(self, position, posList) :
-        last = 0
-
-        for i in range(0, len(posList), 2) :
-            if position[0] == posList[i] :
-                return posList
-            if position[0] > last and position[0] < posList[i] :
-                return posList[:i] + position + posList[i:]
-            last = posList[i]
-        #for        
-        return posList + position
-    #__sortins
-    """
+    def __constructCDS(self, mRNA, CDSpos) :
+        """
+        """
+    
+        i = 1
+        ret = [CDSpos[0]]
+    
+        while CDSpos[0] > mRNA[i] :
+            i += 2
+    
+        j = i
+        while CDSpos[1] > mRNA[j] :
+            j += 2
+    
+        ret.extend(mRNA[i:j])
+        ret.append(CDSpos[1])
     
-    def record2dict(self, record) :
-        recordDict = RecordObj()
-        #recordDict.genelist = {}
+        return ret
+    #__constructCDS
+
+    def __maybeInvert(self, gene, string) :
+        """
+        """
+    
+        if gene.orientation == -1 :
+            return Bio.Seq.reverse_complement(string)
+        return string
+    #__maybeInvert
+
+    def parseRecord(self, record) :
+        """
+            Convert a GenBank record to a nested dictionary.
+
+            Arguments:
+                record ; A GenBank record.
+
+            Returns:
+                dict ; A nested dictionary.
+        """
+
+        self.record = Record()
         for i in  record.features :
             if i.qualifiers :
                 if i.type == "source" :
                     if i.qualifiers.has_key("organelle") :
-                        recordDict.organelle = i.qualifiers["organelle"][0]
+                        self.record.organelle = i.qualifiers["organelle"][0]
                     if i.qualifiers.has_key("mol_type") :
-                        recordDict.mol_type = i.qualifiers["mol_type"][0]
+                        self.record.mol_type = i.qualifiers["mol_type"][0]
 
-                    #recordDict["null"] = Gene()
-                    recordDict.source.orientation = 1
-                    recordDict.source.list["001"] = Locus()
-                    recordDict.source.list["001"].CDS = Plist()
-                    recordDict.source.list["001"].CDS.location = \
-                        self.__location2pos(i.location)
+                    fakeGene = Locus("001")
+                    self.record.source.transcriptList.append(fakeGene)
+                    fakeGene.CDS = PList()
+                    fakeGene.CDS.location = self.__location2pos(i.location)
+                #if
 
                 if i.qualifiers.has_key("gene") :
                     gene = i.qualifiers["gene"][0]
-                    if not recordDict.genelist.has_key(gene) :
-                        recordDict.genelist[gene] = Gene()
+
+                    GeneInstance = self.record.findGene(gene)
+                    if not GeneInstance :
+                        GeneInstance = Gene(gene)
+                        self.record.geneList.append(GeneInstance)
+                    #if
+
                     if i.type == "gene" :
                         if i.strand :
-                            recordDict.genelist[gene].orientation = i.strand
-                        else :
-                            recordDict.genelist[gene].orientation = 1
-
-                        recordDict.genelist[gene].location = \
-                            self.__location2pos(i.location)
+                            GeneInstance.orientation = i.strand
+                        GeneInstance.location = self.__location2pos(i.location)
                     #if
     
                     # Look if there is a locus tag present, if not, give it the
@@ -244,73 +344,152 @@ class GenRecord() :
                     locus_tag = "001"
                     if i.qualifiers.has_key("locus_tag") :
                         locus_tag = i.qualifiers["locus_tag"][0][-3:]
-                    if not recordDict.genelist[gene].list.has_key(locus_tag) :
-                        recordDict.genelist[gene].list[locus_tag] = Locus()
+
+                    LocusInstance = GeneInstance.findLocus(locus_tag)
+                    if not LocusInstance :
+                        LocusInstance = Locus(locus_tag)
+                        GeneInstance.transcriptList.append(LocusInstance)
+                    #if
     
                     if i.type == "mRNA" :
-                        recordDict.genelist[gene].list[locus_tag].mRNA = Plist()
-                        recordDict.genelist[gene].list[locus_tag].mRNA.location = \
-                            self.__location2pos(i.location)
-                        recordDict.genelist[gene].list[locus_tag].mRNA.list = \
-                            self.__locationList2posList(i)
+                        PListInstance = PList()
+                        LocusInstance.mRNA = PListInstance
+
+                        posList = self.__locationList2posList(i)
+                        if posList != None :
+                            PListInstance.location = \
+                                self.__location2pos(i.location)
+                            PListInstance.positionList = posList
+                        #if
+
                     #if
                     if i.type == "CDS" :
-                        recordDict.genelist[gene].list[locus_tag].CDS = Plist()
-                        recordDict.genelist[gene].list[locus_tag].CDS.location = \
-                            self.__location2pos(i.location)
-                        recordDict.genelist[gene].list[locus_tag].CDS.list = \
+                        PListInstance = PList()
+                        LocusInstance.CDS = PListInstance
+
+                        PListInstance.location = self.__location2pos(i.location)
+                        PListInstance.positionList = \
                             self.__locationList2posList(i)
+
                         if i.qualifiers.has_key("transl_table") :
-                            recordDict.genelist[gene].list[locus_tag].txTable = \
+                            LocusInstance.txTable = \
                                 int(i.qualifiers["transl_table"][0])
                     #if
                     if i.type == "exon" :
-                        if not recordDict.genelist[gene].list[locus_tag].exon :
-                            recordDict.genelist[gene].list[locus_tag].exon = Plist()
-                        recordDict.genelist[gene].list[locus_tag].exon.list.extend(
+                        if not LocusInstance.exon :
+                            PListInstance = PList()
+                            LocusInstance.exon = PListInstance
+                        #if
+                        PListInstance.positionList.extend(
                             self.__location2pos(i.location))
+                    #if
                 #if                            
             #if
         #for
 
-        return recordDict
-    #record2dict
-    
-    def printRecordDict(self, d, record) :
-        for i in d :
-            print i
-            print "  Orientation: " + str(d[i].orientation)
-            for j in d[i].list :
-                print "  Locus: " + str(j)
-                if d[i].list[j].mRNA :
-                    print "    mRNA: "
-                    print "      " + str(d[i].list[j].mRNA.location)
-                    if d[i].list[j].mRNA.list :
-                        print "      " + str(d[i].list[j].mRNA.list)
-                        print splice(record, d[i].list[j].mRNA.list)
+        # Now we have gathered all information.
+        for i in self.record.geneList :
+            for j in i.transcriptList :
+                if not j.mRNA :
+                    if not j.exon:
+                        self.__output.addMessage(__file__, 2, "WNOMRNA",
+                            "No mRNA field found for gene %s, transcript " \
+                            "variant %s in GenBank record %s, constructing " \
+                            "it from CDS." % (i.name, j.name, record.id))
+                        if j.CDS :
+                            if not j.CDS.positionList :
+                                self.__output.addMessage(__file__, 2, 
+                                    "WNOCDSLIST", "No CDS list found for " \
+                                    "gene %s, transcript variant %s in " \
+                                    "GenBank record %s, constructing it from " \
+                                    "CDS location." % (i.name, j.name,
+                                                       record.id))
+                                j.mRNA = j.CDS
+                                j.mRNA.positionList = j.CDS.location
+                            #if
+                            else :
+                                j.mRNA = j.CDS
+                        #if
+                        else :
+                            self.__output.addMessage(__file__, 2, "WNOCDS",
+                                "No CDS found for gene %s, transcript " \
+                                "variant %s in GenBank record %s, " \
+                                "constructing it from genelocation." % (
+                                i.name, j.name, record.id))
+                            j.CDS = GenRecord.Locus()
+                            j.CDS.location = j.location
+                            j.mRNA = j.CDS
+                            j.mRNA.positionList = i.location
+                            j.molType = 'n'
+                        #else
                     #if
                     else :
-                        print splice(record, d[i].list[j].mRNA.location)
+                        self.__output.addMessage(__file__, 2, "WNOMRNA",
+                            "No mRNA field found for gene %s, transcript " \
+                            "variant %s in GenBank record %s, constructing " \
+                            "it from gathered exon information." % (
+                            i.name, j.name, record.id))
+                        j.mRNA = j.exon
+                    #else
+                #if
+                if not j.mRNA.positionList :
+                    j.mRNA.positionList = j.mRNA.location
+                if j.CDS :
+                    if not j.CDS.positionList :
+                        self.__output.addMessage(__file__, 2, "WNOCDS",
+                            "No CDS list found for gene %s, transcript " \
+                            "variant %s in GenBank record %s, constructing " \
+                            "it from mRNA list and CDS location." % (i.name, 
+                            j.name, record.id))
+                        if j.mRNA.positionList :
+                            j.CDS.positionList = self.__constructCDS(
+                                j.mRNA.positionList, j.CDS.location)
+                        else :
+                            j.CDS.positionList = self.__constructCDS(
+                                j.mRNA.location, j.CDS.location)
+                    #if
+                    j.CM = Crossmap.Crossmap(j.mRNA.positionList, 
+                                             j.CDS.location, i.orientation)
                 #if
-                if d[i].list[j].CDS :
-                    print "    CDS: "
-                    print "      " + str(d[i].list[j].CDS.location)
-                    if d[i].list[j].CDS.list :
-                        print "      " + str(d[i].list[j].CDS.list)
-                        print splice(record, d[i].list[j].CDS.list)
+                else :
+                    j.molType = 'n'
+                    if j.mRNA.positionList :
+                        j.CM = Crossmap.Crossmap(j.mRNA.positionList, 
+                                                 [], i.orientation)
+                    else :
+                        j.description = '?'
+                #else                                                 
+            #for
+        #for
+    #parseRecord
+
+    def name(self, start, stop, varType, arg1, arg2) :
+        """
+        """
+
+        for i in self.record.geneList :
+            for j in i.transcriptList :
+                if j.CM :
+                    if varType != "subst" :
+                        if start != stop :
+                            j.addToDescription("%s_%s%s%s" % (j.CM.g2c(start), 
+                                j.CM.g2c(stop), varType, 
+                                self.__maybeInvert(i, arg1)))
+                        else :
+                            j.addToDescription("%s%s%s" % (j.CM.g2c(start), 
+                                varType, self.__maybeInvert(i, arg1)))
                     #if
                     else :
-                        print splice(record, d[i].list[j].CDS.location)
+                        j.addToDescription("%s%c>%c" % (j.CM.g2c(start), 
+                            self.__maybeInvert(i, arg1), 
+                            self.__maybeInvert(i, arg2)))
                 #if
             #for
         #for
-    #printRecordDict
+    #name
 #GenRecord
 
 if __name__ == "__main__" :
     R = GenRecord()
-    bla = R._GenRecord__sortins([10, 20], [4, 5])
-    print R._GenRecord__sortins([1, 2], bla)
-    print R._GenRecord__sortins([8, 9], bla)
     del R
 #if
diff --git a/src/Modules/Mapper.py b/src/Modules/Mapper.py
index dbb836c1fbccb0c270146127f2cc768bf3cfe8fb..a03e700527607e5f4ce9d5e13601ad136c980a20 100644
--- a/src/Modules/Mapper.py
+++ b/src/Modules/Mapper.py
@@ -30,7 +30,7 @@ from soaplib.serializers.primitive import String, Integer
 from soaplib.serializers.clazz import ClassSerializer
 
 class Mapping(ClassSerializer) :
-    '''
+    """
         Extended ClassSerializer object with mixed types of attributes
         
         Attributes:
@@ -41,49 +41,69 @@ class Mapping(ClassSerializer) :
             start_g ; Define the type of start_g value.
             end_g ; Define the type of end_g value.
             mutationType ; Define the type of mutation type
-    '''
-    class types :
-        startmain    = Integer
-        startoffset  = Integer
-        endmain      = Integer
-        endoffset    = Integer
-        start_g      = Integer
-        end_g        = Integer
+    """
+
+    class types() :
+        """
+            Types are defined here for the TC module.
+        """
+
+        startmain = Integer
+        startoffset = Integer
+        endmain = Integer
+        endoffset = Integer
+        start_g = Integer
+        end_g = Integer
         mutationType = String
     #types
-#Mapping
 
-# Any comments on the following statement??
-Mapping.typecode = TC.Struct(Mapping, 
-                                        [ TC.Integer('startmain'),
-                                        TC.Integer('startoffset'),
-                                        TC.Integer('endmain'),
-                                        TC.Integer('endoffset'),
-                                        TC.Integer('start_g'),
-                                        TC.Integer('end_g'),
-                                        TC.String('mutationType') ], 
-                                                            'Mapping')
+    def __init__(self) :
+        """
+            Types are defined here for the soaplib module.
+        """
+
+        self.typecode = TC.Struct(Mapping, [ 
+            TC.Integer('startmain'),
+            TC.Integer('startoffset'),
+            TC.Integer('endmain'),
+            TC.Integer('endoffset'),
+            TC.Integer('start_g'),
+            TC.Integer('end_g'),
+            TC.String('mutationType') 
+            ], 'Mapping')
+    #__init__                                                            
+#Mapping
 
 class Transcript(ClassSerializer) :
-    '''
+    """
         Extended ClassSerializer object with mixed types of attributes
         
         Attributes:
             trans_start ; Define the type of trans_start
             trans_stop  ; Define the type of trans_stop
             CDS_stop    ; Define the type of CDS_stop
-    '''
-    class types :
+    """
+
+    class types() :
+        """
+        """
+
         trans_start = Integer
-        trans_stop  = Integer
-        CDS_stop    = Integer
+        trans_stop = Integer
+        CDS_stop = Integer
     #types
+
+    def __init__(self) :
+        """
+        """
+
+        self.typecode = TC.Struct(Transcript, [ 
+            TC.Integer('trans_start'),
+            TC.Integer('trans_stop'),
+            TC.Integer('CDS_stop') 
+            ], 'Transcript')
+    #__init__                                                            
 #Transcript
-Transcript.typecode = TC.Struct(Transcript, 
-                                        [ TC.Integer('trans_start'),
-                                        TC.Integer('trans_stop'),
-                                        TC.Integer('CDS_stop') ], 
-                                                        'Transcript')
 
 def __sl2il(l) :
     """
@@ -132,7 +152,7 @@ def __process(LOVD_ver, build, acc, var, Conf, O) :
     # Make a connection to the MySQL database with the username / db
     #   information from the configuration file.
     #Database = Db.Db("local", O) # Open the database.
-    Database = Db.Db("local", build, Conf.Db)
+    Database = Db.Mapping(build, Conf.Db)
 
     
     # Get the rest of the input variables.
@@ -199,7 +219,7 @@ def __process(LOVD_ver, build, acc, var, Conf, O) :
 #__process
 
 def conversionToCoding(offset, main, trans_start, trans_stop, CDS_stop) :
-    '''
+    """
     Converts c. (non-star) positions to c. numbered (star and +-) positions
     
     Arguments:
@@ -216,7 +236,7 @@ def conversionToCoding(offset, main, trans_start, trans_stop, CDS_stop) :
                       (intronic position, +- notation)
         cMain   ; The main coordinate of a position in c. (star) notation.
             
-    '''
+    """
     cOffset = ""
     cMain = main
     if offset != "0" :
diff --git a/src/Modules/Misc.py b/src/Modules/Misc.py
index 98c089530e6354e707bfc4003750eb8cdf53b1ab..8f76dfc0b61cada60cebb9727a2a83c2451e3975 100644
--- a/src/Modules/Misc.py
+++ b/src/Modules/Misc.py
@@ -1,3 +1,8 @@
+#!/usr/bin/python
+
+"""
+"""
+
 import time
 
 class Misc() :
diff --git a/src/Modules/Mutator.py b/src/Modules/Mutator.py
index bdafa981ee9e7a243096a1f89d996961e71d2269..2893365c0f2f1a929db801a7f56e79f1c50187ae 100644
--- a/src/Modules/Mutator.py
+++ b/src/Modules/Mutator.py
@@ -1,6 +1,18 @@
 #!/usr/bin/python
 
-#from Output import Output
+"""
+    Module for mutating a string.
+
+    Mutations are described in the original coordinates. These coordinates are
+    transfered to the mutated coordinates with the aid of an internal shift
+    list, which keeps track of the sizes of changes. Using the original
+    coordinates greatly simplifies combined mutations in a variant.
+
+    The original as well as the mutated string are stored.
+
+    Public classes:
+        Mutator ; Mutate a string and register all shift points.
+"""
 
 class Mutator() :
     """
@@ -50,25 +62,26 @@ class Mutator() :
             Initialise the class with the original string.
 
             Arguments:
-                orig ; The original string before mutation.
+                orig   ; The original string before mutation.
+                config ; Configuration variables.
+                output ; The output object.
 
             Private variables (altered):
-                __shift ; Initialised to the empty list.
+                __config ; Initialised with the configuration variables.
+                __output ; Initialised with the output object.
+                __shift  ; Initialised to the empty list.
 
             Public variables (altered):
                 orig    ; Initialised to the parameter orig.
                 mutated ; Initialised to the parameter orig.
         """
 
-        #Output.__init__(self, __file__)
         self.__config = config
         self.__output = output
-
         self.__shift = []
+
         self.orig = orig
         self.mutated = orig
-
-        #self.output.createOutputNode("visualisation", 1) # Info message.
     #__init__
     
     def __sortins(self, tuple) :
@@ -122,6 +135,11 @@ class Mutator() :
                 pos2 ; The second interbase position of the deletion.
                 ins  ; The insertion.
 
+            Private variables:
+                __config ; The variables maxvissize, flanksize and flankclipsize
+                           are used in the visualisation.
+                __output ; Visualisation information is added.
+
             Public variables (altered):
                 mutated ; This string will reflect the result of the given 
                           delins.
@@ -135,24 +153,21 @@ class Mutator() :
         odel = self.orig[pos1:pos2]
         if len(odel) > self.__config.maxvissize :
             odel = "%s [%ibp] %s" % (odel[:self.__config.flankclipsize], 
-                                     len(odel) - self.__config.flankclipsize * 2,
-                                     odel[-self.__config.flankclipsize:])
+                len(odel) - self.__config.flankclipsize * 2,
+                odel[-self.__config.flankclipsize:])
 
         bp1 = self.shiftpos(pos1)
         bp2 = self.shiftpos(pos2)
         lmflank = self.mutated[max(bp1 - self.__config.flanksize, 0):bp1]
         rmflank = self.mutated[bp2:bp2 + self.__config.flanksize]
 
-        #print
         insvis = ins
         if len(ins) > self.__config.maxvissize :
             insvis = "%s [%ibp] %s" % (ins[:self.__config.flankclipsize],
-                                       len(ins) - self.__config.flankclipsize * 2,
-                                       ins[-self.__config.flankclipsize:])
+                len(ins) - self.__config.flankclipsize * 2,
+                ins[-self.__config.flankclipsize:])
         fill = abs(len(odel) - len(insvis))
         if len(odel) > len(ins) :
-            #print "%s %s %s" % (loflank, odel, roflank)
-            #print "%s %s%s %s" % (lmflank, insvis, '-' * fill, rmflank)
             self.__output.addOutput("visualisation", 
                                   "%s %s %s" % (loflank, odel, roflank))
             self.__output.addOutput("visualisation",
@@ -160,8 +175,6 @@ class Mutator() :
                                                   rmflank))
         #if
         else :
-            #print "%s %s%s %s" % (loflank, odel, '-' * fill, roflank)
-            #print "%s %s %s" % (lmflank, insvis, rmflank)
             self.__output.addOutput("visualisation",
                                   "%s %s%s %s" % (loflank, odel, '-' * fill, 
                                                   roflank))
@@ -175,19 +188,6 @@ class Mutator() :
         self.mutated = self.mutated[:self.shiftpos(pos1)] + ins + \
                        self.mutated[self.shiftpos(pos2):]
         self.__sortins([pos1 + 1, len(ins) + pos1 - pos2])
-
-        """
-        from Bio import pairwise2
-        po1 = max(pos1 - 25, 0)                # Bug fix for mutations at the
-        pm1 = max(self.shiftpos(pos1) - 25, 0) # start of a sequence.
-
-        alignments = pairwise2.align.globalms(self.orig[po1:pos2 + 25],
-            self.mutated[pm1:self.shiftpos(pos2) + 25],
-            1, -1, -2, -1)
-        print
-        print alignments[0][0]
-        print alignments[0][1]
-        """
     #__mutate
 
     def shiftpos(self, position) :
@@ -248,13 +248,16 @@ class Mutator() :
             Arguments:
                 pos1 ; The first nucleotide of the range to be deleted.
                 pos2 ; The last nucleotide of the range to be deleted.
+
+            Private variables:
+                __output ; Visualisation information is added.
         """
 
         if pos1 == pos2 :
             self.__output.addOutput("visualisation", "deletion of %i" % pos1)
         else :
             self.__output.addOutput("visualisation", "deletion of %i to %i" % (
-                                 pos1, pos2))
+                                    pos1, pos2))
         self.__mutate(pos1 - 1, pos2, '')
     #delM
     
@@ -266,10 +269,13 @@ class Mutator() :
                 pos ; The interbase position where the insertion should take
                       place.
                 ins ; The insertion, a string.
+
+            Private variables:
+                __output ; Visualisation information is added.
         """
 
-        self.__output.addOutput("visualisation", "insertion between %i and %i" % (
-                             pos, pos + 1))
+        self.__output.addOutput("visualisation", 
+                                "insertion between %i and %i" % (pos, pos + 1))
         self.__mutate(pos, pos, ins)
     #insM
     
@@ -294,6 +300,9 @@ class Mutator() :
             Arguments:
                 pos ; The position where the substitution should take place.
                 nuc ; The new nucleotide.
+
+            Private variables:
+                __output ; Visualisation information is added.
         """
 
         self.__output.addOutput("visualisation", "substitution at %i" % pos)
@@ -340,84 +349,3 @@ class Mutator() :
 if __name__ == "__main__" :
     pass
 #if
-"""
-import sys
-
-def ladder() :
-    length = 79
-
-    for i in range(length) :
-        sys.stdout.write(str((i + 1) / 10))
-    sys.stdout.write("\n")
-    for i in range(length) :
-        sys.stdout.write(str((i + 1) % 10))
-    sys.stdout.write("\n")
-#ladder
-
-M = Mutator("AAAGCCACCAGTTTCTTCCATGTGTTTTCACTCGCTTCGAAAAATTTAGGTAGGCTCTAGATATC")
-
-M.invM(44, 50)
-print "Inv 44 50"
-ladder()
-print M.orig
-print M.mutated
-
-M.delinsM(34, 38, "TTTAAAATTTTAA")
-print "Delins 34 38 TTTAAAATTTTAA"
-ladder()
-print M.orig
-print M.mutated
-
-M.invM(24, 30)
-print "Inv 24 30"
-ladder()
-print M.orig
-print M.mutated
-
-M.delM(10, 10)
-print "Del 10"
-ladder()
-print M.orig
-print M.mutated
-
-M.subM(5, 'T')
-print "Sub 5 T"
-ladder()
-print M.orig
-print M.mutated
-
-M.insM(7, 'G')
-print "Ins 7_8 G"
-ladder()
-print M.orig
-print M.mutated
-print M._Mutator__shift
-
-M.delM(4, 8)
-print "Del 4 8"
-ladder()
-print M.orig
-print M.mutated
-M.insM(4, "TTTA")
-print "Ins 4 TTTA"
-ladder()
-print M.orig
-print M.mutated
-M.delM(4, 8)
-print "Del 4 8"
-ladder()
-print M.orig
-print M.mutated
-M.delinsM(4, 8, "TTTAAAATTTTAA")
-print "Delins 4 8 TTTAAAATTTTAA"
-ladder()
-print M.orig
-print M.mutated
-M.invM(24, 30,)
-print "Inv 24 30"
-ladder()
-print M.orig
-print M.mutated
-
-print M.newSplice([1, 10, 20, 30, 40])
-"""
diff --git a/src/Modules/Output.py b/src/Modules/Output.py
index 84cbe63fc59fdcbacfa96e3dad1588da78f862f5..44cddd083a3cc592ae1b4c6384d8a039663aa5b6 100644
--- a/src/Modules/Output.py
+++ b/src/Modules/Output.py
@@ -1,23 +1,60 @@
 #!/usr/bin/python
 
-#from Config import Config
-from time import strftime
+"""
+    Module for storing output and messages. 
+    Output is stored as a named list that can be expanded.
+    Messages can be retrieved at a later time to provide flexibility. Message
+    levels are defined to increase or decrease the amount of logging and ouput.
+    The position of the log file, as well as the levels are defined in the
+    configuration file.
+
+    Message levels:
+        -1 : Log     ; Specifically log a message.
+         0 : Debug   ; Debug information.
+         1 : Info    ; Info.
+         2 : Warning ; Regular warnings.
+         3 : Error   ; Serious errors that can be compensated for.
+         4 : Fatal   ; Errors that are not recoverable.
+         5 : Off     ; Can be used as a log/output level to turn off output.
+
+    Public classes:
+        Message ; Container class for message variables.
+        Output  ; Output interface for errors, warnings and logging.
+"""
+
+import time # strftime()
 
-class Node() :
-    """
+class Message() :
     """
+        Container class for message variables.
 
-    def __init__(self, level) :
-        self.message = []
-        self.level = level
-    #__init__
-#Node
+        Special methods:
+            __init__(origin, level, code, description) ; Make a message object.
 
-class Message() :
-    """
+        Public variables:
+            origin      ; Name of the module creating this object.
+            level       ; Importance of the message.
+            code        ; The error code of the message.
+            description ; A description of the message.
     """
 
     def __init__(self, origin, level, code, description) :
+        """
+            Make a new message object.
+
+            Arguments:
+                origin      ; Name of the module creating this object.
+                level       ; Importance of the message.
+                code        ; The error code of the message.
+                description ; A description of the message.
+
+            Public variables (altered):
+                origin      ; Name of the module creating this object.
+                level       ; Importance of the message.
+                code        ; The error code of the message.
+                description ; A description of the message.
+        """
+    
         self.origin = origin
         self.level = level
         self.code = code
@@ -25,39 +62,41 @@ class Message() :
     #__init__
 #Message
 
-#class Empty() :
-#    def __len__(self) :
-#        return 0
-
 class Output() :
     """
         Provide an output interface for errors, warnings and logging purposes.
 
         Private variables:
+            __config     ; Configuration variables.
+            __outputdata ; The output dictionary.
+            __messages   ; The messages list.
             __instance   ; The name of the module that made this object.
             __loghandle  ; The handle of the log file.
-            __datestring ; Format of the prefix for log messages.
             __errors     ; The number of errors that have been processed.
             __warnings   ; The number of warnings that have been processed.
 
         Special methods:
-            __init__(config, instance) ; Initialise the class with variables
+            __init__(instance, config) ; Initialise the class with variables
                                          from the config file and the calling
                                          module.
-            __del__()                  ; Close the logfile.
+            __del__()                  ; Close the logfile and clean up.
 
         Private methods:                                         
             __niceName(filename) ; Strip the path and the extention from a
                                    filename.
+            __levelToName(level) ; Convert a log level to a readable string.
 
         Public methods:
-            ErrorMsg(filename, message)   ; Print an error message to standard
-                                            output and log it.
-            WarningMsg(filename, message) ; Print an error message to standard
-                                            output.
-            LogMsg(filename, message)     ; Log a message.
-            Summary()                     ; Print a summary of the number of
-                                            errors and warnings.
+            addMessage(filename,    ; Add a message to the message list.
+                       level, 
+                       code, 
+                       description) 
+            getMessages()           ; Print all messages that exceed the
+                                      configured output level.
+            addOutput(name, data)   ; Add output to the output dictionary.
+            getOutput(name)         ; Retrieve data from the output dictionary.
+            Summary()               ; Print a summary of the number of errors
+                                      and warnings.
     """
 
     def __init__(self, instance, config) :
@@ -66,26 +105,21 @@ class Output() :
             config file and the calling module.
             
             Arguments:
-                config   ; The configuration object.
                 instance ; The filename of the module that created this object.
-
-            Public variables(altered):
-                outputdata ; The output list.
+                config   ; The configuration object.
 
             Private variables (altered):
+                __config     ; Configuration variables.
+                __outputdata ; The output dictionary.
+                __messages   ; The messages list.
                 __instance   ; Initialised with the name of the module that
                                created this object.
                 __loghandle  ; Initialised as the handle of the log file 
                                defined in the configuration file.
-                __datestring ; Format of the prefix for log messages.
                 __errors     ; Initialised to 0.
                 __warnings   ; Initialised to 0.
-
-            Inherited variables from Config:
-                log ; Location of the log file.
         """
 
-        #Config.__init__(self)
         self.__config = config
         self.__outputData = {}
         self.__messages = []
@@ -93,26 +127,18 @@ class Output() :
         self.__loghandle = open(self.__config.log, "a")
         self.__errors = 0
         self.__warnings = 0
-
-
-        #self.createOutputNode("debug", 0)
-        #self.createOutputNode("info", 1)
-        #self.createOutputNode("warnings", 2)
-        #self.createOutputNode("errors", 3)
-        #self.createOutputNode("fatalerrors", 4)
-        #self.createOutputNode("log", 5)
     #__init__
 
     def __del__(self) :
         """
-            Clean up the output list and close the log file.
+            Clean up the output dictionary, the messages list and close the log 
+            file.
             
-            Public variables(altered):
-                outputdata ; The output list.
-
             Private variables(altered):
-                __loghandle ; The handle of the log file defined in the 
-                             configuration file.
+                __loghandle  ; The handle of the log file defined in the 
+                               configuration file.
+                __outputdata ; The output dictionary.
+                __messages   ; The messages list.
         """
 
         self.__loghandle.close()
@@ -138,6 +164,13 @@ class Output() :
 
     def __levelToName(self, level) :
         """
+            Convert a log level to a readable string.
+            
+            Arguments:
+                level ; A log level (an integer between -1 and 5).
+
+            Returns:
+                string ; A readable description of the log level.
         """
 
         if level == 0 :
@@ -153,63 +186,79 @@ class Output() :
         return ""
     #__levelToName
 
-    #def addToOutputNode(self, filename, name, code, message) :
-    #    """
-    #    """
-
-    #    niceName = self.__niceName(filename)
-
-    #    self.__outputData[name].message.append(Message(niceName, code, message))
-
-    #    level = self.__outputData[name].level
-    #    if level >= self.__config.loglevel :
-    #        prefix = ""
-    #        if level == 2 :
-    #            prefix = "Warning: "
-    #        if level == 3 :
-    #            prefix = "Error: "
-    #        if level == 4 :
-    #            prefix = "Fatal: "
-    #        self.__loghandle.write(strftime(self.__config.datestring + ' ') + \
-    #                               "%s (%s) %s: %s%s\n" % (self.__instance, 
-    #                               niceName, code, prefix, message))
-    #        self.__loghandle.flush()
-    #    #if
-    ##addToOutputNode
-
     def addMessage(self, filename, level, code, description) :
         """
+            Add a message to the message list. 
+            If the level exceeds the configured loglevel or if the level is -1,
+            then the message is also logged.
+            If the severity equals 2, then the number of warnings is inreased,
+            if it exceeds 2, then the number of errors is increased. 
+
+            Arguments:
+                filename    ; Name of the calling module.
+                level       ; Severity of the message.
+                code        ; Error code of the message.
+                description ; Description of the message.
+                
+            Private variables:
+                __messages  ; The messages list.
+                __instance  ; Module that created the Output object.
+                __config    ; The variables loglevel and datestring are used.
+                __loghandle ; Handle to the log file.
+
+            Private variables (altered):
+                __warnings ; Increased by one if the severity equals 2.
+                __errors   ; Increased by one if the severity exceeds 2.
         """
 
         niceName = self.__niceName(filename)
 
+        # Append a new message object to the messages list.
         self.__messages.append(Message(niceName, level, code, description))
 
         if level == 2 :
             self.__warnings += 1
         if level > 2 :
             self.__errors += 1
+
+        # Log the message if the message is important enough, or if it is only
+        # meant to be logged (level -1).
         if level > self.__config.loglevel or level == -1 :
-            self.__loghandle.write(strftime(self.__config.datestring + ' ') + \
-                                   "%s (%s) %s: %s%s\n" % (self.__instance, 
-                                   niceName, code, self.__levelToName(level), 
-                                   description))
+            self.__loghandle.write(time.strftime(
+                self.__config.datestring + ' ') + "%s (%s) %s: %s%s\n" % (
+                    self.__instance, niceName, code, self.__levelToName(level), 
+                    description))
             self.__loghandle.flush()
         #if
     #addMessage
 
     def getMessages(self) :
         """
+            Print all messages that exceed the configured output level.
+
+            Private variables:
+                __messages  ; The messages list.
+                __config    ; The variable outputlevel is used.
         """
 
         for i in self.__messages :
             if i.level > self.__config.outputlevel :
-                print "%s (%s): %s" % (self.__levelToName(i.level), i.origin,
-                                       i.description)
+                print "%s(%s): %s" % (self.__levelToName(i.level), i.origin,
+                                      i.description)
     #getMessages
 
     def addOutput(self, name, data) :
         """
+            If the output dictionary already has a node with the specified
+            name, the list that this name points to is expanded with the data.
+            Otherwise create a node and assign a list containing the data.
+            
+            Arguments:
+                name ; Name of a node in the output dictionary.
+                data ; The data to be stored at this node.
+
+            Private variables:
+                __outputData ; The output dictionary.
         """
 
         if self.__outputData.has_key(name) :
@@ -220,6 +269,13 @@ class Output() :
 
     def getOutput(self, name) :
         """
+            Return a list of data from the output dictionary.
+
+            Arguments:
+                name ; Name of a node in the output dictionary.
+                
+            Private variables:
+                __outputData ; The output dictionary.
         """
 
         if self.__outputData.has_key(name) :
@@ -227,94 +283,6 @@ class Output() :
         return None
     #getOutput
 
-
-    #def createOutputNode(self, name, level) :
-    #    """
-    #    """
-
-    #    self.__outputData[name] = Node(level)
-    ##createOutputNode
-
-    #def getData(self, name) :
-    #    """
-    #    """
-
-    #    if self.__outputData.has_key(name) and \
-    #       self.__outputData[name].level >= self.__config.outputlevel :
-    #        return self.__outputData[name].message
-    #    return []
-    ##getdata
-
-    #'''
-    #def getMsg(self, name) :
-    #    """
-    #    """
-
-    #    if self.__outputData[name].serverity >= self.__config.outputlevel :
-    #        return 
-    ##getMsg    
-
-    #def ErrorMsg(self, filename, message) :
-    #    """
-    #        Print an error message to standard output and log it.
-
-    #        Arguments:
-    #            filename ; The file where the error originated.
-    #            message  ; The error message.
-
-    #        Private variables (altered):
-    #            __errors ; Increased by one.
-    #    """
-
-    #    print "Error (%s): %s" % (self.__niceName(filename), message)
-    #    self.LogMsg(filename, "Error: " + message)
-    #    #self.addData(filename, "test", "error", "5", message)
-    #    self.__errors += 1
-    ##ErrorMsg
-
-    #def WarningMsg(self, filename, message) :
-    #    """
-    #        Print an error message to standard output.
-
-    #        Arguments:
-    #            filename ; The file where the warning originated.
-    #            message  ; The warning message.
-
-    #        Private variables (altered):
-    #            __warnings ; Increased by one.
-    #    """
-
-    #    print "Warning (%s): %s" % (self.__niceName(filename), message)
-    #    #self.addData(filename, "test", "warning", "5", message)
-    #    self.__warnings += 1
-    ##WarningMsg
-
-    #def LogMsg(self, filename, message) :
-    #    """
-    #        Log a message to the log file defined in the configuration file.
-
-    #        Arguments:
-    #            filename ; The file where the logging request originated.
-    #            message  ; The message to be logged.
-
-    #        Private variables:
-    #            __loghandle  ; The handle of the log file defined in the 
-    #                           configuration file.
-    #            __instance   ; The name of the module that created this output
-    #                           object.
-
-    #        Inherited variables from Config:
-    #            datestring ; Format of the prefix for log messages.
-    #    """
-
-
-    #    self.__loghandle.write(strftime(self.__config.datestring + ' ') + \
-    #        "%s (%s): %s\n" % (self.__instance, self.__niceName(filename), 
-    #        message))
-    #    self.__loghandle.flush()
-    ##LogMsg
-    #'''
-
     def Summary(self) :
         """
             Print a summary of the number of errors and warnings.
@@ -322,6 +290,12 @@ class Output() :
             Private variables:
                 __errors   ; The number of errors.
                 __warnings ; The number of warnings.
+            
+            Returns:
+                triple:
+                    integer ; Number of errors.
+                    integer ; Number of warnings.
+                    string  ; Summary.
         """
 
         e_s = 's'
@@ -331,8 +305,8 @@ class Output() :
         if self.__warnings == 1 :
             w_s = ''
             
-        print "%i Error%s, %i Warning%s." % (self.__errors, e_s, 
-                                             self.__warnings, w_s)
+        return self.__errors, self.__warnings, "%i Error%s, %i Warning%s." % (
+            self.__errors, e_s, self.__warnings, w_s)
     #Summary
 #Output
 
@@ -340,12 +314,5 @@ class Output() :
 # Unit test.
 #
 if __name__ == "__main__" :
-    import Config
-
-    C = Config.Config()
-
-    O = Output(__file__, C.Output)
-
-    O.WarningMsg(__file__, "Ja, er ging wat mis.")
-    del O
+    pass
 #if
diff --git a/src/Modules/Parser.py b/src/Modules/Parser.py
index 09726036bbcf15947e0b71c13d005d6e5bd05278..b3e18deac21b77565270c78a2ea06fa2473f2caa 100644
--- a/src/Modules/Parser.py
+++ b/src/Modules/Parser.py
@@ -1,6 +1,16 @@
 #!/usr/bin/python
 
-#from Output import Output
+"""
+    Module for parting a variant described using the HGVS nomenclature.
+
+    A context-free parser is defined here, the nomenclature rules are specified
+    in BNF, which is used (with some minor modifications) as source of this
+    module.
+
+    Public classes:
+        Nomenclatureparser ; Parse an input string.
+"""
+
 from pyparsing import *
 
 class Nomenclatureparser() :
@@ -285,10 +295,7 @@ class Nomenclatureparser() :
                 __output ; Set to the output object.
         """
 
-        #self.__output = output
-        #Output.__init__(self, __file__)
-        self.output = output
-
+        self.__output = output
         ParserElement.enablePackrat() # Speed up parsing considerably.
     #__init__
 
@@ -314,19 +321,14 @@ class Nomenclatureparser() :
         try :
             return self.Var.parseString(variant, parseAll = True)
         except ParseException, err :
-            self.output.addMessage(__file__, 4, "EPARSE", str(err))
+            self.__output.addMessage(__file__, 4, "EPARSE", str(err))
 
-            # Print the input.
-            #print variant
-            #self.output.createOutputNode("parseError", 4) # Fatal error.
-            #self.output.addOutput("nomenclatureparser", variant)
-            self.output.addMessage(__file__, 4, "EPARSE", variant)
+            # Log the input.
+            self.__output.addMessage(__file__, 4, "EPARSE", variant)
 
-            # And print the position where the parsing error occurred.
+            # And log the position where the parsing error occurred.
             pos = int(str(err).split(':')[-1][:-1]) - 1
-            #print pos * ' ' + '^'
-            #self.output.addOutput("nomenclatureparser", pos * ' ' + '^')
-            self.output.addMessage(__file__, 4, "EPARSE", pos * ' ' + '^')
+            self.__output.addMessage(__file__, 4, "EPARSE", pos * ' ' + '^')
 
             return None
         #except
diff --git a/src/Modules/Retriever.py b/src/Modules/Retriever.py
index 3b1c2e6de6b1722edec8eb5bdf3706a04e3bc8c7..08b2ca750e88f011885ea26f13ca66cfb0cf36d7 100644
--- a/src/Modules/Retriever.py
+++ b/src/Modules/Retriever.py
@@ -1,5 +1,16 @@
 #!/usr/bin/python
 
+"""
+    Module for retrieving files from either the cache or the NCBI.
+
+    A hash of every retrieved file is stored in the internal database. If a 
+    requested file is not found, but its hash is, we use additional information
+    to re-download the file.
+
+    Public classes:
+        Retriever ; Retrieve a record from either the cache or the NCBI.
+"""
+
 import os              # path.isfile(), link() path.isdir(), path.mkdir(),
                        # walk(), path.getsize(), path.join(), stat(), remove()
 import bz2             # BZ2Compressor(), BZ2File()
@@ -9,10 +20,7 @@ import StringIO        # StringIO()
 from Bio import SeqIO  # read()
 from Bio import Entrez # efetch(), read(), esearch(), esummary()
 
-import Misc
-
-#from Output import Output
-#from Db import Db
+from Modules import Misc
 
 class Retriever() :
     """
@@ -24,8 +32,10 @@ class Retriever() :
             cachesize ; Maximum size of the cache.
 
         Special methods:
-            __init__(config) ; Use variables from the configuration file to 
-                               initialise the class private variables.
+            __init__(config,   ; Use variables from the configuration file to 
+                     output,     initialise the class private variables.
+                     database) 
+                               
 
         Private methods:
             __foldersize(folder) ; Return the size of a folder.
@@ -68,8 +78,6 @@ class Retriever() :
                 cache     ; The directory where the records are stored.
         """
 
-        #Db.__init__(self, "local", "mutalyzer")
-
         self.__config = config
         self.__output = output
         self.__database = database
@@ -91,8 +99,8 @@ class Retriever() :
 
         folder_size = 0
         for (path, dirs, files) in os.walk(folder) :
-            for file in files :
-                folder_size += os.path.getsize(os.path.join(path, file))
+            for fileName in files :
+                folder_size += os.path.getsize(os.path.join(path, fileName))
 
         return folder_size
     #__foldersize
@@ -259,13 +267,14 @@ class Retriever() :
             name, GI = self.__write(raw_data, name, 1)
             if name :               # Processing went okay.
                 currentmd5sum = self.__database.getHash(name)
-                md5sum = self.__calcHash(raw_data)
-                if md5sum != currentmd5sum :
-                    self.__output.addMessage(__file__, -1, "WHASH", 
-                        "Warning: Hash of %s changed from %s to %s." % (
-                        name, currentmd5sum, md5sum))
-                    self.__database.updateHash(name, md5sum)
-                #if
+                if currentmd5sum :
+                    md5sum = self.__calcHash(raw_data)
+                    if md5sum != currentmd5sum :
+                        self.__output.addMessage(__file__, -1, "WHASH", 
+                            "Warning: Hash of %s changed from %s to %s." % (
+                            name, currentmd5sum, md5sum))
+                        self.__database.updateHash(name, md5sum)
+                    #if
                 else :
                     self.__database.insertGB(name, GI, 
                         self.__calcHash(raw_data), None, 0, 0, 0, None)
@@ -353,6 +362,9 @@ class Retriever() :
                 organism   ; The organism in which we search.
                 upstream   ; Number of upstream nucleotides for the slice.
                 downstream ; Number of downstream nucleotides for the slice.
+            
+            Returns:
+                
         """
 
         # Search the NCBI for a specific gene in an organism.
@@ -361,41 +373,53 @@ class Retriever() :
         searchresult = Entrez.read(handle)
         handle.close()
 
-        # FIXME
-        if len(searchresult["IdList"]) > 1 :
-            print "Hmmmmm."
-            return None
-        #if
+        ChrAccVer = None        # We did not find anything yet.
+        aliases = []            # A list of aliases in case we find them.
+        for i in searchresult["IdList"] :                 # Inspect all results.
+            handle = Entrez.esummary(db = "gene", id = i)
+            summary = Entrez.read(handle)
+            handle.close()
+            if summary[0]["NomenclatureSymbol"] == gene : # Found it.
+                ChrAccVer = summary[0]["GenomicInfo"][0]["ChrAccVer"]
+                ChrLoc = summary[0]["GenomicInfo"][0]["ChrLoc"]
+                ChrStart = summary[0]["GenomicInfo"][0]["ChrStart"]
+                ChrStop = summary[0]["GenomicInfo"][0]["ChrStop"]
+                break;
+            #if
 
-        # Get summary information for the first search hit.
-        handle = Entrez.esummary(db = "gene", id = searchresult["IdList"][0])
-        summary = Entrez.read(handle)
-        handle.close()
-        if not len(summary[0]["GenomicInfo"]) :
-            print "No mapping information found."
-            #FIXME Output and stuff.
-            return
+            # Collect official symbols that has this gene as alias in case we 
+            # can not find anything.
+            if gene in summary[0]["OtherAliases"] and \
+                summary[0]["NomenclatureSymbol"] :
+                aliases.append(summary[0]["NomenclatureSymbol"]);
+        #for
+                
+        if not ChrAccVer : # We did not find any genes.
+            if aliases :
+                self.__output.addMessage(__file__, 4, "ENOGENE",
+                    "Gene %s not found, found aliases: %s" % (gene, aliases))
+                return None
+            #if
+            self.__output.addMessage(__file__, 4, "ENOGENE",
+                "Gene %s not found." % gene)
+            return None
         #if
-        ChrAccVer = summary[0]["GenomicInfo"][0]["ChrAccVer"] # Extract the mapping
-        ChrLoc = summary[0]["GenomicInfo"][0]["ChrLoc"]       # information.
-        ChrStart = summary[0]["GenomicInfo"][0]["ChrStart"]
-        ChrStop = summary[0]["GenomicInfo"][0]["ChrStop"]
-
+            
         # Figure out the orientation of the gene.
         orientation = "1"
         if ChrStart > ChrStop :             # Swap start and stop.
             orientation = "2"
             temp = ChrStart
             ChrStart = ChrStop - downstream # Also take care of the flanking
-            ChrStop = temp + upstream       # sequences.
+            ChrStop = temp + upstream + 1   # sequences.
         #if
         else :
-            ChrStart -= upstream
-            ChrStop += downstream
+            ChrStart -= upstream - 1
+            ChrStop += downstream + 2
         #else
 
         # And retrieve the slice.
-        self.retrieveslice(ChrAccVer, ChrStart, ChrStop, orientation)
+        return self.retrieveslice(ChrAccVer, ChrStart, ChrStop, orientation)
     #retrievegene
 
     def downloadrecord(self, url) :
@@ -544,120 +568,11 @@ class Retriever() :
 
         return record
     #loadrecord
-
-    #'''
-    #def loadrecord_old(self, identifier) :
-    #    """
-    #        Return a record from either the cache or the NCBI. 
-    #        If a file is retrieved from the NCBI, a hard link is made to its
-    #        alternative name (GI when an accession number is given and vice
-    #        versa). If no version is given, it will be retrieved and the
-    #        record will be renamed.
-    #        After downloading a file, the cache is checked for overflows by
-    #        calling the __cleancache() function.
-    #        The files are stored in compressed format in the cache.
-
-    #        Variables: 
-    #            identifier ; Either an accession number or a GI number.
-
-    #        Inherited variables from Config:
-    #            cache      ; The directory where the record is stored.
-    #            email      ; The email address which we give to the NCBI.
-    #            output     ; The output object.
-
-    #        Returns:
-    #            SeqRecord ; The record that was requested.
-    #    """
-
-    #    # If a GI is given, remove the "GI" or "GI:" part.
-    #    if (identifier[:2] == "GI") :
-    #        if (identifier[2] == ':') :
-    #            name = identifier[3:]
-    #        else :
-    #            name = identifier[2:]
-    #    #if
-    #    else :
-    #        name = identifier
-    #
-    #    # Make a filename based upon the identifier.
-    #    filename = self.__nametofile(name)
-    #
-    #    # If the filename is not present, retrieve it from the NCBI.
-    #    if not os.path.isfile(filename) :
-    #        Loc = self.__database.getLoc(name) # Look in the UD database
-    #        if not Loc :            # Never seen this name before.
-    #            net_handle = \
-    #                Entrez.efetch(db = "nucleotide", id = name, rettype = "gb")
-    #            raw_data = net_handle.read()
-    #            net_handle.close()
-    #            # Check if the record is empty or not.
-    #            if raw_data != "\n" :
-    #                self.__write(raw_data, filename, 1)
-    #            else :
-    #                self.__output.addMessage(__file__, 4, "ERETR", 
-    #                                         "Could not retrieve %s." % name)
-    #                return None
-    #        #if                    
-    #        else :                  # We know the name.
-    #            self.retrieveslice(*Loc)
-    #    #if
-    #    
-    #    # Now we have the file, so we can parse it.
-    #    file_handle = bz2.BZ2File(filename, "r")
-    #    try :
-    #        record = SeqIO.read(file_handle, "genbank")
-    #    except ValueError :
-    #        self.__output.addMessage(__file__, 4, "ERECPARSE", 
-    #                                 "Could not parse %s, purging." % filename)
-    #        os.remove(filename)
-    #        file_handle.close()
-    #        return None
-    #    #except
-
-    #    file_handle.close()
-
-    #    if name[:3] == "UD_" : # No renaming is needed.
-    #        return record
-
-    #    # If a GI is supplied, find out the accession number (plus version)
-    #    #   and vice versa.
-    #    if name != record.annotations["gi"] :
-    #        altfilename = self.__nametofile(record.annotations["gi"])
-    #        altfilename2 = self.__nametofile(record.id)
-    #    #if
-    #    else :
-    #        altfilename = self.__nametofile(record.id)
-    #
-    #    # If the alternative filename is not present yet, make a hard link.
-    #    if not os.path.isfile(altfilename) :
-    #        os.link(filename, altfilename)
-
-    #    # If the other alternative filename is not present (no version was 
-    #    #   given), rename the file. If it already exists, remove the file.
-    #    if filename != altfilename2 :
-    #        if not os.path.isfile(altfilename2) :
-    #            os.rename(filename, altfilename2)
-    #        else :
-    #            os.remove(filename)
-
-    #        self.__output.addMessage(__file__, 2, "WNOVRE", 
-    #        "No version number is given, using %s. Please use version numbers to reduce " \
-    #              "downloading overhead." % record.id)
-    #    #if
-
-    #    return record
-    ##loadrecord
-    #'''
 #Retriever
 
 #
 # Unit test.
 #
 if __name__ == "__main__" :
-    # Get the location of the cache, the cachesize and the email address from 
-    #   the config file.
-    R = Retriever()
-
-    R.loadrecord("AB026906.1") # Retrieve a GenBank record.
-    del R
+    pass
 #if
diff --git a/src/Modules/Scheduler.py b/src/Modules/Scheduler.py
index 5899ada1bc9ae6b8c8bc81f74cd8cbf6094fb498..d83d9090de4ed590679e73f595ec11b77cc03036 100644
--- a/src/Modules/Scheduler.py
+++ b/src/Modules/Scheduler.py
@@ -1,27 +1,79 @@
 #!/usr/bin/python
 
+"""
+    Public classes:
+        Scheduler ;
+"""
+
 import time
 
-import Config
-import Db
 import subprocess
 import psutil
 import os
+import smtplib
+from email.mime.text import MIMEText
+
+from Modules import Config
+from Modules import Output
+from Modules import Db
+
+import Mutalyzer
 
 class Scheduler() :
     """
+        Special methods:
+            __init__(config, database) ;
+        
+        Public methods:
+            isDaemonRunning() ;
+            process()         ;
+            addJob(outputFilter, eMail, queue, fromHost) ;
+
     """
 
     def __init__(self, config, database) :
         """
+            Arguments:
+                config   ;
+                database ;
         """
 
         self.__config = config
         self.__database = database
     #__init__
 
+    def __sendMail(self, mailTo, url) :
+        """
+            Send an e-mail containing an url to a batch job submitter.
+
+            Arguments:
+                mailTo ; The batch job submitter.
+                url    ; The url containing the results.
+
+            Private variables:
+                __config ; The variables mailMessage, mailSubject and mailFrom
+                           are used.
+        """
+
+        handle = open(self.__config.mailMessage)
+        message = MIMEText(handle.read() % url)
+        handle.close()
+
+        message["Subject"] = self.__config.mailSubject
+        message["From"] = self.__config.mailFrom
+        message["To"] = mailTo
+
+        smtpInstance = smtplib.SMTP()
+        smtpInstance.connect()
+        smtpInstance.sendmail(self.__config.mailFrom, mailTo, 
+                              message.as_string())
+        smtpInstance.quit()
+    #__sendMail
+
     def isDaemonRunning(self) :
         """
+            Returns:
+                True if an other scheduler is already running, False otherwise.
         """
 
         myPid = os.getpid()
@@ -42,23 +94,40 @@ class Scheduler() :
             for i in jobList :
                 results = self.__database.getFromQueue(i)
                 if results :
-                    print i, results
+                    if results[1] :
+                        cmd = "%s(%s):%s" % results
+                    else :
+                        cmd = "%s:%s" % (results[0], results[2])
+                    C = Config.Config()
+                    O = Output.Output(__file__, C.Output)
+                    Mutalyzer.process(cmd, C, O)
+                    handle = open("%s/Results_%s.txt" % (
+                        self.__config.resultsDir, i), "a")
+                    handle.write(str(O.getOutput("variantdescription")))
+                    handle.close()
+                    del O, C
+                #if
                 else :
-                    eMail = self.__database.removeJob(i)
-                    print "Job %s finished, email %s file %s" % (i, eMail, i)
-                time.sleep(1)
+                    eMail, stuff, fromHost = self.__database.removeJob(i)
+                    #print "Job %s finished, email %s file %s" % (i, eMail, i)
+                    self.__sendMail(eMail, "%sResults_%s.txt" % (fromHost, i))
+                #else
             #for
             jobList = self.__database.getJobs()
         #while
     #process
 
-    def addJob(self, outputFilter, eMail, queue) :
+    def addJob(self, outputFilter, eMail, queue, fromHost) :
         """
+            Arguments:
+                outputFilter ;
+                eMail        ;
+                queue        ;
         """
 
         print "called addjob"
         jobList = self.__database.getJobs()
-        jobID = self.__database.addJob(outputFilter, eMail)
+        jobID = self.__database.addJob(outputFilter, eMail, fromHost)
         for i in queue :
             self.__database.addToQueue(jobID, *i)
         subprocess.Popen([self.__config.processName, "src/BatchChecker.py"], 
diff --git a/src/Modules/Web.py b/src/Modules/Web.py
index 99c398f2c3e8de581baca4a49c2b60a83e73140c..95bb681d80995e99d215652807c06f24717e72ce 100644
--- a/src/Modules/Web.py
+++ b/src/Modules/Web.py
@@ -1,6 +1,14 @@
 #!/usr/bin/python
 
+"""
+    Module that provides general functions used by the web interfaces.
+
+    Public classes:
+        Web ; General functions used by the web interfaces.
+"""
+
 import sys                     # sys.stdout
+import re                      # match
 from cStringIO import StringIO # StringIO() getvalue()
 
 class Web() :
@@ -153,4 +161,14 @@ class Web() :
     
         return s
     #read
+
+    def isEMail(self, eMail) :
+        """
+        """
+
+        if re.match("^[a-zA-Z0-9._%-]+@[a-zA-Z0-9._%-]+.[a-zA-Z]{2,6}$", 
+                    eMail) :
+            return True
+        return False
+    #isEmail
 #Web
diff --git a/src/Modules/__init__.py b/src/Modules/__init__.py
index e69de29bb2d1d6434b8b29ae775ad8c2e48c5391..10629c4230034104ab132399156ba023ce75add4 100644
--- a/src/Modules/__init__.py
+++ b/src/Modules/__init__.py
@@ -0,0 +1,14 @@
+"""
+    Public modules:
+        Config    ;
+        Crossmap  ;
+        Db        ;
+        GenRecord ;
+        Misc      ;
+        Mutator   ;
+        Output    ;
+        Parser    ;
+        Retriever ;
+        Scheduler ;
+        Web       ;
+"""
diff --git a/src/Mutalyzer.py b/src/Mutalyzer.py
index 15c6693cd8908a6decde74bdba6f431929568379..b46379a64a2f41499a542e5cd8b57c944283e451 100644
--- a/src/Mutalyzer.py
+++ b/src/Mutalyzer.py
@@ -1,17 +1,28 @@
 #!/usr/bin/python
 
+"""
+    The nomenclature checker.
+"""
+
+import sys
+import math
+import types
+import Bio
+
+import Bio.Seq
+from Bio.Seq import Seq
+from Bio.Alphabet import IUPAC
+from Bio.SeqUtils import seq3
+
 from Modules import Retriever
 from Modules import GenRecord
 from Modules import Crossmap
 from Modules import Parser
 from Modules import Db
-
-import types
+from Modules import Mutator
 from Modules import Output
 from Modules import Config
 
-import Bio.Seq
-
 class newMut() :
     def __init__(self) :
         self.c = ""
@@ -26,6 +37,9 @@ def __order(a, b) :
 #__order
 
 def __roll(string, start, stop, orientation) :
+    """
+    """
+
     pattern = string[start:stop]
     if orientation == 1 :
         i = stop - 1
@@ -49,8 +63,34 @@ def __roll(string, start, stop, orientation) :
     #else
 #__roll
 
+def roll2(ref, start, stop) :
+    """
+    """
+
+    pattern = ref[start:stop]
+    patternLength = len(pattern)
+
+    g_min = start - 1
+    j = patternLength - 1
+    while g_min > -1 and ref[g_min] == pattern[j % patternLength] :
+        j -= 1
+        g_min -= 1
+    #while 
+    g_min += 1
+
+    g_max = stop
+    j = 0
+    while g_max < len(ref) and ref[g_max] == pattern[j % patternLength] :
+        j += 1
+        g_max += 1
+    #while 
+
+    return g_min, g_max - patternLength
+#roll2
+
 def __palinsnoop(string) :
-    import math
+    """
+    """
 
     revcomp = Bio.Seq.reverse_complement(string)
 
@@ -61,7 +101,8 @@ def __palinsnoop(string) :
 #__palinsnoop
 
 def __bprint(s) :
-    import math
+    """
+    """
 
     if not s :
         return
@@ -82,6 +123,9 @@ def __bprint(s) :
 #__bprint
 
 def __PtLoc2main(Loc) :
+    """
+    """
+
     main = int(Loc.Main)
     if Loc.MainSgn == '-' :
         main = -main
@@ -90,6 +134,9 @@ def __PtLoc2main(Loc) :
 #__PtLoc2main
 
 def __PtLoc2offset(Loc) :
+    """
+    """
+
     if Loc.Offset :
         offset = int(Loc.Offset)
         if Loc.OffSgn == '-' :
@@ -101,22 +148,6 @@ def __PtLoc2offset(Loc) :
     return offset
 #__PtLoc2offset
 
-"""
-def IsInt(string) :
-    try :
-        num = int(string)
-        return 1
-    #try
-    except ValueError :
-        return 0
-#IsInt
-"""
-
-"""
-def printp(string, depth) :
-    print (depth * "  ") + str(string)
-"""
-
 def __splice(string, splice_sites) :
     """
         Construct the transcript or the coding sequence from a record and
@@ -140,6 +171,9 @@ def __splice(string, splice_sites) :
 #__splice
 
 def __nsplice(string, splice_sites, CDS, orientation) :
+    """
+    """
+
     transcript = ""
 
     if orientation == 1 :
@@ -148,94 +182,45 @@ def __nsplice(string, splice_sites, CDS, orientation) :
                 transcript += string[CDS[0] - 1:splice_sites[i + 1]]
             else :
                 if splice_sites[i] > CDS[0] :
-                    transcript += string[splice_sites[i] - 1:splice_sites[i + 1]] 
+                    transcript += \
+                        string[splice_sites[i] - 1:splice_sites[i + 1]] 
+        #for
+    #if        
     else :
         for i in range(0, len(splice_sites), 2) :
             if CDS[1] >= splice_sites[i] and CDS[1] <= splice_sites[i + 1] :
                 transcript += string[splice_sites[i] - 1: CDS[1]]
             else :
                 if splice_sites[i] < CDS[1] :
-                    transcript += string[splice_sites[i] - 1:splice_sites[i + 1]] 
-
+                    transcript += \
+                     string[splice_sites[i] - 1:splice_sites[i + 1]] 
+        #for
+    #else        
 
     return transcript
 #__nsplice
 
-
-def __toProtDescr(orig, trans) :
-    from Bio.SeqUtils import seq3
-
-    if str(trans) == str(orig) :
-        return "p.="
-
-    if len(trans) > len(orig) :
-        ext = abs(len(orig) - len(trans))
-        return "p.*%i%sext*%i" % (len(orig) + 1, seq3(trans[len(orig)]), ext)
-
-    if len(orig) > len(trans) :
-        return "p.%s%i*" % (seq3(orig[len(trans)]), len(trans) + 1)
-
-    i = 0
-    while i < len(orig) - 1 and orig[i] == trans[i] :
-        i += 1
-
-    return "p.%s%i%s" % (seq3(orig[i]), i + 1, seq3(trans[i]))
-#__toProtDescr
-
-def __constructCDS(mRNA, CDSpos) :
-    #print mRNA
-    #print CDSpos
-    i = 1
-    ret = [CDSpos[0]]
-
-    while CDSpos[0] > mRNA[i] :
-        i += 2
-
-    j = i
-    while CDSpos[1] > mRNA[j] :
-        j += 2
-
-    ret.extend(mRNA[i:j])
-    ret.append(CDSpos[1])
-
-    #print ret
-    return ret
-#__constructCDS
-
-"""
-def __isStringThere(ref, p1, p2, string) :
-    if ref[p1 - 1:p2] == string :
-        return True
-    return False
-#__isStringThere
-
-def __checkStringLength(p1, p2, length) :
-    if p2 - p1 + 1 == int(length) :
-        return True
-    return False
-#__checkStringLength
-"""
-
 def __checkOptArg(ref, p1, p2, arg, M, O) :
+    """
+    """
+
     if arg :
         if arg.isdigit() :
             length = int(arg)
             interval = p2 - p1 + 1
             if length != interval :
-                O.addMessage(__file__, 3, "EARGLEN", "The length (%i) differed from that of " \
-                    "the range (%i)." % (length, interval))
+                O.addMessage(__file__, 3, "EARGLEN", 
+                    "The length (%i) differed from that of the range (%i)." % (
+                    length, interval))
                 return False
             #if
         #if
         else :
-            #revcomp = reverse_complement(string)
-
             ref_slice = str(ref[p1 - 1:p2])
-            #if M.orientation == -1 :
-            #    ref_slice = Bio.Seq.reverse_complement(ref_slice)
             if ref_slice != str(arg) : # FIXME more informative.
-                O.addMessage(__file__, 3, "EREF", "%s not found at position c.%s (g.%i), " \
-                    "found %s instead." % (arg, M.g2c(p1), p1, ref_slice))
+                O.addMessage(__file__, 3, "EREF", 
+                    "%s not found at position c.%s (g.%i), found %s instead." \
+                    % (arg, M.g2c(p1), p1, ref_slice))
                 return False
             #if
         #else
@@ -284,97 +269,186 @@ def __lcs(str1, str2) :
     return __lcp(t1, t2) 
 #__lcs
 
+def findInFrameDescription(str1, str2) :
+    """
+    """
+
+    # Nothing happened.
+    if str1 == str2 :
+        return "p.(=)"
+
+    lcp = __lcp(str1, str2)
+    lcs = __lcs(str1[lcp:], str2[lcp:])
+    str1_end = len(str1) - lcs
+    str2_end = len(str2) - lcs
+
+    # Insertion / Duplication.
+    if not str1_end - lcp :
+        inLen = str2_end - lcp
+
+        if lcp - inLen >= 0 and str1[lcp - inLen:lcp] == str2[lcp:str2_end] :
+            if inLen == 1 :
+                return "p.(%s%idup)" % (seq3(str1[lcp - inLen]), 
+                                        lcp - inLen + 1)
+            return "p.(%s%i_%s%idup)" % (seq3(str1[lcp - inLen]), 
+                                         lcp - inLen + 1,
+                                         seq3(str1[lcp - 1], lcp))
+        #if
+        return "p.(%s%i_%s%iins%s)" % (seq3(str1[lcp - 1]), lcp, 
+                                       seq3(str1[lcp]), lcp + 1,
+                                       seq3(str2[lcp:str2_end]))
+    #if
+
+    # Deletion.
+    if not str2_end - lcp :
+        if lcp + 1 == str1_end :
+            return "p.(%s%idel)" % (seq3(str1[lcp], lcp + 1))
+        return "p.(%s%i_%s%idel)" % (seq3(str1[lcp - 1]), lcp + 1, 
+                                     seq3(str1[str1_end - 1]), str1_end)
+    #if
+
+    # Substitution.
+    if str1_end == str2_end and str1_end == lcp + 1 :
+        if len(str1) > len(str2) :
+            return "p.(*%i%sext*%i)" % (len(str1) + 1, seq3(str2[len(str1)]), 
+                                        abs(len(str1) - len(str2)))
+        if len(str1) > len(str2) :
+            return "p.(%s%i*)" % (seq3(str1[len(str2)]), len(str2) + 1)
+        return "p.(%s%i%s)" % (seq3(str1[lcp]), lcp + 1, seq3(str2[lcp]))
+    #if
+
+    # InDel.
+    if lcp + 1 == str1_end :
+        return "p.(%s%idelins%s)" % (seq3(str1[lcp]), lcp + 1, 
+                                     seq3(str2[lcp:str2_end]))
+    return "p.(%s%i_%s%idelins%s)" % (seq3(str1[lcp]), lcp + 1, 
+                                      seq3(str1[str1_end - 1]),
+                                      str1_end, seq3(str2[lcp:str2_end]))
+#findInFrameDescription
+
+def findFrameShift(str1, str2) :
+    """
+    """
+
+    lcp = __lcp(str1, str2)
+
+    return "p.(%s%i%sfs*%i)" % (seq3(str1[lcp]), lcp + 1, seq3(str2[lcp]),
+                                len(str2) - lcp)
+#findFrameShift
+
+def __toProtDescr(CDSStop, orig, trans) :
+    """
+    """
+
+    if CDSStop % 3 :
+        return findFrameShift(str(orig), str(trans))
+    return findInFrameDescription(str(orig), str(trans))
+#__toProtDescr
+
 def __trim(string, lcp, lcs) :
-    if lcp and lcs :
-        return string[lcp:-lcs]
-    if lcp :
-        return string[lcp:]
-    if lcs :
-        return string[:-lcs]
-    return string
+    """
+    """
+
+    return string[lcp:len(string) - lcs]
 #__trim
 
 def __rangeToC(M, g1, g2) :
+    """
+    """
+
     if M.orientation == -1 :
         return M.g2c(g2), M.g2c(g1)
     return M.g2c(g1), M.g2c(g2)
 #__rangeToC
 
 def __maybeInvert(M, string) :
+    """
+    """
+
     if M.orientation == -1 :
         return Bio.Seq.reverse_complement(string)
     return string
 #__maybeInvert
 
-def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
-    #start_main = __PtLoc2main(RawVar.StartLoc.PtLoc)
-    start_main = M.main2int(RawVar.StartLoc.PtLoc.MainSgn + 
-                            RawVar.StartLoc.PtLoc.Main)
-    start_offset = __PtLoc2offset(RawVar.StartLoc.PtLoc)
-    end_main = start_main
-    end_offset = start_offset
-    if RawVar.EndLoc :
-        #end_main = __PtLoc2main(RawVar.EndLoc.PtLoc)
-        end_main = M.main2int(RawVar.EndLoc.PtLoc.MainSgn + 
-                              RawVar.EndLoc.PtLoc.Main)
-        end_offset = __PtLoc2offset(RawVar.EndLoc.PtLoc)
-    #if
-    
-    start_g = int(start_main)
-    end_g = int(end_main)
-
-    Arg1 = RawVar.Arg1
-    Arg2 = RawVar.Arg2
-    if RefType in ['c', 'n'] :
-        start_g = M.x2g(start_main, start_offset)
-        end_g = M.x2g(end_main, end_offset)
-        if M.orientation == -1 :
-            Arg1 = Bio.Seq.reverse_complement(RawVar.Arg1)
-            Arg2 = Bio.Seq.reverse_complement(RawVar.Arg2)
-        #if
-    #if
-    
-    start_g, end_g = __order(start_g, end_g)
-
-    start_c, end_c = __rangeToC(M, start_g, end_g)
-    if start_c.isdigit() and 1 <= int(start_c) <= 3 or \
-       end_c.isdigit() and 1 <= int(end_c) <= 3 :
-        O.addMessage(__file__, 2, "WSTART", "Mutation in start codon.")
-
-    # start_offset has to be calculated (not accepted from the parser)
-    start_t_m, start_t_o = M.g2x(start_g)
-    t_s, t_e, c_s = M.info()
-    if start_t_o == -1 or start_t_o == -2 :
-        if start_t_m == t_s :
-            O.addMessage(__file__, 2, "WTXSTART", "Mutation hits transcription start.")
-        else :
-            O.addMessage(__file__, 2, "WSPLDON", "Mutation hits a splice donor site.")
-    if start_t_o == 1 or start_t_o == 2 :
-        O.addMessage(__file__, 2, "WSPLACC", "Mutation hits a splice acceptor site.")
-    
-    #print str(record.seq[start_g - 20:start_g + 20])
-    
-    if RawVar.MutationType in ["del", "dup", "subst", "delins"] :
-        __checkOptArg(record.seq, start_g, end_g, Arg1, M, O)
+def __searchFrameShift(orig, mutated) :
+    pass
+#__searchFrameShift
+
+def __rv(MUU, record, RawVar, GenRecordInstance, RefType, O, NM) :
+    """
+    """
+
+    for i in GenRecordInstance.record.geneList :
+        for j in i.transcriptList :
+            M = j.CM
+            if j.CM :
+                start_main = j.CM.main2int(RawVar.StartLoc.PtLoc.MainSgn + 
+                                        RawVar.StartLoc.PtLoc.Main)
+                start_offset = __PtLoc2offset(RawVar.StartLoc.PtLoc)
+                end_main = start_main
+                end_offset = start_offset
+                if RawVar.EndLoc :
+                    end_main = j.CM.main2int(RawVar.EndLoc.PtLoc.MainSgn + 
+                                          RawVar.EndLoc.PtLoc.Main)
+                    end_offset = __PtLoc2offset(RawVar.EndLoc.PtLoc)
+                #if
+                
+                start_g = int(start_main)
+                end_g = int(end_main)
+
+                Arg1 = RawVar.Arg1
+                Arg2 = RawVar.Arg2
+                if RefType in ['c', 'n'] :
+                    start_g = j.CM.x2g(start_main, start_offset)
+                    end_g = j.CM.x2g(end_main, end_offset)
+                    if j.CM.orientation == -1 :
+                        Arg1 = Bio.Seq.reverse_complement(RawVar.Arg1)
+                        Arg2 = Bio.Seq.reverse_complement(RawVar.Arg2)
+                    #if
+                #if
+                
+                start_g, end_g = __order(start_g, end_g)
+
+                start_c, end_c = __rangeToC(M, start_g, end_g)
+                if start_c.isdigit() and 1 <= int(start_c) <= 3 or \
+                   end_c.isdigit() and 1 <= int(end_c) <= 3 :
+                    O.addMessage(__file__, 2, "WSTART", 
+                                 "Mutation in start codon.")
+
+                # start_offset has to be calculated (not accepted from the 
+                # parser)
+                start_t_m, start_t_o = j.CM.g2x(start_g)
+                t_s, t_e, c_s = j.CM.info()
+                if start_t_o == -1 or start_t_o == -2 :
+                    if start_t_m == t_s :
+                        O.addMessage(__file__, 2, "WTXSTART", 
+                            "Mutation hits transcription start.")
+                    else :
+                        O.addMessage(__file__, 2, "WSPLDON", 
+                            "Mutation hits a splice donor site.")
+                #if                            
+                if start_t_o == 1 or start_t_o == 2 :
+                    O.addMessage(__file__, 2, "WSPLACC", 
+                        "Mutation hits a splice acceptor site.")
+                
+                if RawVar.MutationType in ["del", "dup", "subst", "delins"] :
+                    __checkOptArg(record.seq, start_g, end_g, Arg1, M, O)
+            #if                    
+        #for
+    #for
 
-    global protDescr
-    protDescr = False
     # Substitution.
     if RawVar.MutationType == "subst" :
         if RawVar.Arg1 == RawVar.Arg2 :
-            O.addMessage(__file__, 3, "ENOCHANGE", "No mutation given (%c>%c) at position " \
-                "c.%s (g.%i)." % (RawVar.Arg1, RawVar.Arg1, M.g2c(start_g), 
-                start_g))
+            O.addMessage(__file__, 3, "ENOVAR", 
+                "No mutation given (%c>%c) at position c.%s (g.%i)." % (
+                RawVar.Arg1, RawVar.Arg1, M.g2c(start_g), start_g))
 
         MUU.subM(start_g, Arg2)
 
-        NM.c += str(M.g2c(start_g)) + \
-                    __maybeInvert(M, record.seq[start_g - 1]) + \
-                    '>' + __maybeInvert(M, Arg2)
-        NM.g += str(start_g) + \
-                   record.seq[start_g - 1] + \
-                   '>' + Arg2
-        protDescr = True                   
+        GenRecordInstance.name(start_g, 0, "subst", record.seq[start_g - 1], 
+                               Arg2)
+        NM.g += str(start_g) + record.seq[start_g - 1] + '>' + Arg2
     #if
     
     # Deletion / Duplication.
@@ -383,10 +457,11 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
                               M.orientation)
         if rollposstart != start_g :
             rollposend = rollposstart + (end_g - start_g)
-            O.addMessage(__file__, 2, "WROLL", "Sequence %s at position c.%s (g.%i) was " \
-                "given, however, the HGVS notation prescribes that it should " \
-                "be %s at position c.%s (g.%i)." % (
-                str(record.seq[start_g - 1:end_g]), M.g2c(start_g), start_g,
+            O.addMessage(__file__, 2, "WROLL", 
+                "Sequence %s at position c.%s (g.%i) was given, however, " \
+                "the HGVS notation prescribes that it should be %s at " \
+                "position c.%s (g.%i)." % (str(record.seq[start_g - 1:end_g]), 
+                M.g2c(start_g), start_g, 
                 str(record.seq[rollposstart - 1:rollposend]), 
                 M.g2c(rollposstart), rollposstart))
             start_g = rollposstart
@@ -406,7 +481,7 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
             cpos = str(M.g2c(start_g))
             gpos = str(start_g)
         #else
-        NM.c += cpos + RawVar.MutationType
+        GenRecordInstance.name(start_g, end_g, RawVar.MutationType, "", "")
         NM.g += gpos + RawVar.MutationType
     #if
     
@@ -415,20 +490,20 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
         snoop = __palinsnoop(record.seq[start_g - 1:end_g])
         if snoop :
             if snoop == -1 :
-                O.addMessage(__file__, 3, "ENOCHANGE", "Sequence %s at position c.%s (g.%i) " \
-                    "is a palindrome (its own reverse complement)." % (
+                O.addMessage(__file__, 2, "WNOCHANGE", 
+                    "Sequence %s at position c.%s (g.%i) is a palindrome " \
+                    "(its own reverse complement)." % (
                     str(record.seq[start_g - 1:end_g]), 
                     M.g2c(start_g), start_g))
-                # Do nothing...
+                return NM
             else :
-                O.addMessage(__file__, 2, "ENOTMINIMAL", "Sequence %s at position c.%s (g.%i) " \
-                    "is a partial palindrome (the first %i " \
-                    "nucleotide(s) are the reverse complement of " \
-                    "the last one(s)), the HGVS notation " \
-                    "prescribes that it should be %s at position " \
-                    "c.%s (g.%i)." % (
-                    str(record.seq[start_g - 1:end_g]), M.g2c(start_g),
-                    start_g, snoop, 
+                O.addMessage(__file__, 2, "WNOTMINIMAL", 
+                    "Sequence %s at position c.%s (g.%i) is a partial " \
+                    "palindrome (the first %i nucleotide(s) are the reverse " \
+                    "complement of the last one(s)), the HGVS notation " \
+                    "prescribes that it should be %s at position c.%s " \
+                    "(g.%i)." % (str(record.seq[start_g - 1:end_g]), 
+                    M.g2c(start_g), start_g, snoop, 
                     str(record.seq[start_g + snoop - 1: end_g - snoop]),
                     M.g2c(start_g + snoop), start_g + snoop))
                 start_g += snoop
@@ -437,21 +512,18 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
         MUU.invM(start_g, end_g)
             
         c1, c2 = __rangeToC(M, start_g, end_g)
-        NM.c += c1 + '_' + c2 + "inv"
+        #NM.c += c1 + '_' + c2 + "inv"
+        GenRecordInstance.name(start_g, end_g, "inv", "", "")
         NM.g += str(start_g) + '_' + str(end_g) + "inv"
     #if
     
     # Insertion.
     if RawVar.MutationType == "ins" :
         if start_g + 1 != end_g :
-            O.addMessage(__file__, 3, "EINSRANGE", "c.%s (g.%i) and c.%s (g.%i) are not " \
-                "consecutive positions." % (
-                M.g2c(start_g), start_g, M.g2c(end_g), end_g))
+            O.addMessage(__file__, 3, "EINSRANGE", 
+                "c.%s (g.%i) and c.%s (g.%i) are not consecutive positions." \
+                % (M.g2c(start_g), start_g, M.g2c(end_g), end_g))
     
-        #inserted = RawVar.Arg1
-        #if M.orientation == -1 :
-        #    inserted = Bio.Seq.reverse_complement(RawVar.Arg1)
-
         MUU.insM(start_g, Arg1)
     
         way = M.orientation
@@ -459,14 +531,9 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
         rs1 = MUU.shiftpos(start_g)
         re1 = MUU.shiftpos(start_g) + l
 
-        #rs1, re1 = __order(rs1, re1)
-        #print "+++", MUU.mutated[rs1:re1], rs1, re1
-
         rs2 = __roll(MUU.mutated, rs1, re1, way) - 1
 
-        #shiftlen = ((rs2 - rs1 - l + 1) * way)
         shiftlen = (((rs2 - rs1) * way) - l + 1) * way
-        #print "+++", rs2, shiftlen
 
         c1 = rs2
         c2 = rs2 + ((l - 1) * way)
@@ -474,12 +541,12 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
         corr = 0
         if rs1 != rs2 or \
            str(MUU.mutated[c1:c2 + 1]) == str(MUU.mutated[c1-l:(c2-l)+1]) :
-            O.addMessage(__file__, 2, "WINSDUP", "Insertion of %s at position c.%s (g.%i) " \
-                "was given, however, the HGVS notation prescribes that it " \
-                "should be a duplication of %s at position c.%s (g.%i)." % (
-                RawVar.Arg1, M.g2c(start_g), start_g, 
-                str(MUU.mutated[c1:c2 + 1]), M.g2c(start_g + shiftlen), 
-                start_g + shiftlen))
+            O.addMessage(__file__, 2, "WINSDUP", 
+                "Insertion of %s at position c.%s (g.%i) was given, " \
+                "however, the HGVS notation prescribes that it should be a " \
+                "duplication of %s at position c.%s (g.%i)." % (RawVar.Arg1, 
+                M.g2c(start_g), start_g, str(MUU.mutated[c1:c2 + 1]),
+                M.g2c(start_g + shiftlen), start_g + shiftlen))
             start_g += shiftlen
             end_g += shiftlen
             corr = 1
@@ -487,29 +554,41 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
 
         c1, c2 = __rangeToC(M, start_g, end_g)
         if corr :
-            NM.c += c1 + '_' + c2 + "dup"
+            #NM.c += c1 + '_' + c2 + "dup"
+            GenRecordInstance.name(start_g, end_g, "dup", "", "")
             NM.g += str(start_g) + '_' + str(end_g) + "dup"
         else :
-            NM.c += c1 + '_' + c2 + "ins" + RawVar.Arg1
+            #NM.c += c1 + '_' + c2 + "ins" + RawVar.Arg1
+            GenRecordInstance.name(start_g, end_g, "ins", "", "")
             NM.g += str(start_g) + '_' + str(end_g) + "ins" + Arg1
     #if
 
+    # DelIns.
     if RawVar.MutationType == "delins" :
-        lcp =  __lcp(RawVar.Arg1, RawVar.Arg2)
-        lcs =  -__lcs(RawVar.Arg1, RawVar.Arg2)
-
+        Arg1 = RawVar.Arg1
+        if not RawVar.Arg1 :
+            Arg1 = MUU.orig[start_g - 1:end_g]
+
+        lcp =  __lcp(Arg1, RawVar.Arg2)
+        lcs =  __lcs(Arg1, RawVar.Arg2)
+
+        if str(Arg1) == str(RawVar.Arg2) :
+            O.addMessage(__file__, 2, "WNOCHANGE", 
+                "Sequence %s at position c.%s (g.%i) is identical to the " \
+                "variant." % (
+                str(record.seq[start_g - 1:end_g]), 
+                M.g2c(start_g), start_g))
+            return NM
+        ins_part = RawVar.Arg2
         if lcp or lcs :
-            del_part = __trim(RawVar.Arg1, lcp, lcs)
+            del_part = __trim(Arg1, lcp, lcs)
             ins_part = __trim(RawVar.Arg2, lcp, lcs)
-            # FIXME Output stuff and such.
-            print start_g + lcp, end_g - lcs
-            print M.g2c(start_g + lcp), M.g2c(end_g - lcs)
-            print "del%sins%s" % (del_part, ins_part)
-
-        MUU.delinsM(start_g, end_g, Arg2)
+            #O.addMessage(__file__, 2, "WNOTMINIMAL", 
+            #    "")
 
-        #NM.c += str(M.g2c(start_g)) + '_' + str(M.g2c(end_g)) + "delins" + RawVar.Arg2
-        #NM.g += str(start_g) + '_' + str(end_g) + "delins" + RawVar.Arg2
+        start_g += lcp
+        end_g -= lcs
+        MUU.delinsM(start_g, end_g, ins_part)
 
         if start_g != end_g :
             c1, c2 = __rangeToC(M, start_g, end_g)
@@ -520,303 +599,111 @@ def __rv(MUU, record, GeneSymbol, RawVar, M, RefType, O, NM) :
             cpos = str(M.g2c(start_g))
             gpos = str(start_g)
         #else
-        #NM.c += cpos + "delins" + RawVar.Arg2 
-        #NM.g += gpos + "delins" + RawVar.Arg2
-        NM.c += cpos + "delins" + __maybeInvert(M, Arg2)
-        NM.g += gpos + "delins" + Arg2
+        #NM.c += cpos + "delins" + __maybeInvert(M, ins_part)
+        GenRecordInstance.name(start_g, end_g, "delins", ins_part, "")
+        NM.g += gpos + "delins" + ins_part
     #if
     
-    #print MUU.mutated[start_g - 20:start_g + 20]
     return NM
 #__rv
 
-def __ppp(MUU, record, parts, recordDict, refseq, depth, O) :
-    #printp("+++ recurse +++", depth)
-    #printp(repr(parts), depth)
-    #printp(parts, depth)
-    """
-    printp(parts[4], depth)
-    printp(repr(parts[4]), depth)
-    printp(parts[4][0][0][0].Main, 2)
-    printp(parts, depth)
-    """
+def __ppp(MUU, record, parts, GenRecordInstance, refseq, depth, O) :
     if parts.RefSeqAcc :
         refseq = parts.RefSeqAcc
-    #printp("RefSeqAcc: " + str(refseq), depth)
-    #printp("RefType: " + str(parts.RefType), depth)
-
 
-    #printp("Version: " + str(parts.Version), depth)
-    if parts.Gene :
-        print "Gene Symbol: " + str(parts.Gene.GeneSymbol)
-        #printp("Transcript variant: " + str(parts.Gene.TransVar), depth)
-        #printp("Protein isoform: " + str(parts.Gene.ProtIso), depth)
-    #if
-    """
-    if parts.ChimeronSet :
-        #printp(str(parts.ChimeronSet), depth)
-        for i in parts.ChimeronSet :
-            printp("ChimeronSet", depth)
-            __ppp(MUU, record, i, recordDict, refseq, depth + 1, O)
-        #for
-    #if
-    if parts.MosaicSet :
-        #printp(str(parts.MosaicSet), depth)
-        for i in parts.MosaicSet :
-            printp("MosaicSet", depth)
-            __ppp(MUU, record, i, recordDict, refseq, depth + 1, O)
-        #for
-    #if
-    if parts.SimpleAlleleVarSet :
-        #printp(str(parts.SimpleAlleleVarSet), depth)
-        for i in parts.SimpleAlleleVarSet :
-            printp("SimpleAlleleVarSet", depth)
-            __ppp(MUU, record, i, recordDict, refseq, depth + 1, O)
-        #for
-            #__ppp(MUU, record, i, recordDict, refseq, depth + 1)
-    #if
-    if parts.MultiAlleleVars :
-        printp(str(parts.MultiAlleleVars), depth)
-        for i in parts.MultiAlleleVars :
-            printp("MultiAlleleVars", depth)
-            print repr(i)
-            __ppp(MUU, record, i, recordDict, refseq, depth + 1, O)
-        #for
-    #if
-    """
     if parts.RawVar or parts.SingleAlleleVarSet :
-        GS = ""
-        if recordDict.genelist :
-            GS = recordDict.genelist.keys()[0]
-
-        if parts.Gene and parts.Gene.GeneSymbol :
-            GS = parts.Gene.GeneSymbol
-        #print "Gene Name: " + GS
-        #O.createOutputNode("genename", 1) # Info message.
-        #O.addToOutputNode(__file__, "genename", "INFO", GS)
-        O.addOutput("genename", GS)
-
-        transcriptvariant = "001" 
-        if parts.Gene and parts.Gene.TransVar :
-            transcriptvariant = parts.Gene.TransVar
-        #print "Transcript variant: " + transcriptvariant
-        #O.createOutputNode("transcriptvariant", 1) # Info message.
-        #O.addToOutputNode(__file__, "transcriptvariant", "INFO", transcriptvariant)
-        O.addOutput("transcriptvariant", transcriptvariant)
-        #print
-            
-        if recordDict.genelist :
-            if recordDict.genelist.has_key(GS) :
-                currentGene = recordDict.genelist[GS]
-            else :
-                print "No such gene %s in record." % GS
-                # FIXME Output an stuff.
-                return
-            #else
-        else :
-            currentGene = recordDict.source
-        W = currentGene.list[transcriptvariant]
-
-        noTrans = False
-        if not W.mRNA :
-            if not W.exon:
-                O.addMessage(__file__, 2, "WNOMRNA", "No mRNA field found for gene %s, " \
-                    "transcript variant %s in GenBank record %s, " \
-                    "constructing it from CDS." % (GS, transcriptvariant, 
-                    record.id))
-                if W.CDS :
-                    if not W.CDS.list :
-                        print "Extra warning"
-                        # FIXME Output and stuff.
-                        W.mRNA = W.CDS
-                        W.mRNA.list = W.CDS.location
-                        noTrans = True
-                    else :
-                        W.mRNA = W.CDS
-                #if
-                else :
-                    print currentGene.location
-                    # FIXME Output and stuff.
-                    W.CDS = GenRecord.Locus()
-                    W.CDS.location = W.location
-                    W.mRNA = W.CDS
-                    W.mRNA.list = currentGene.location
-                    noTrans = True
-            #if
-            else :
-                O.addMessage(__file__, 2, "WNOMRNA", "No mRNA field found for gene %s, " \
-                    "transcript variant %s in GenBank record %s, " \
-                    "constructing it from gathered exon information." % (GS, 
-                    transcriptvariant, record.id))
-                W.mRNA = W.exon
-        #if
-        #print W.mRNA.list
-        if not W.mRNA.list :
-            W.mRNA.list = W.mRNA.location
-        if W.CDS :
-            if not W.CDS.list :
-                O.addMessage(__file__, 2, "WNOCDS", "No CDS list found for gene %s, " \
-                    "transcript variant %s in GenBank record %s, " \
-                    "constructing it from mRNA list and CDS location." % (GS, 
-                    transcriptvariant, record.id))
-                if W.mRNA.list :
-                    W.CDS.list = __constructCDS(W.mRNA.list, W.CDS.location)
-                    #print W.mRNA.list, W.CDS.location
-                    #print W.CDS.list
-                else :
-                    W.CDS.list = __constructCDS(W.mRNA.location, W.CDS.location)
-        #else :
-        #    pass # Noncoding RNA?
-
-        if parts.RefType == 'n' :
-            M = Crossmap.Crossmap(
-                W.mRNA.list,
-                [],
-                currentGene.orientation)
-        else :                
-            if not W.CDS :
-                O.addMessage(__file__, 3, "ENOCDS", "No CDS information found for gene %s, " \
-                                     "transcript variant %s in GenBank " \
-                                     "record %s." % (GS, transcriptvariant, 
-                                                     record.id))
-                return
-            #if
-            M = Crossmap.Crossmap(
-                W.mRNA.list,
-                W.CDS.location,
-                currentGene.orientation)
-        #else
-        #print W.mRNA
-
-        #print recordDict["organelle"], recordDict["mol_type"]
         NM = newMut()
-        NM.c = parts.RefSeqAcc 
-        NM.g = parts.RefSeqAcc 
-        if parts.Version :
-            NM.c += '.' + parts.Version
-            NM.g += '.' + parts.Version
-        #if
-        if parts.RefType == 'n' :
-            NM.c += ":n."
-        else :
-            NM.c += ":c."
-        if recordDict.organelle and recordDict.organelle == "mitochondrion" :
-            NM.g += ":m."
+
+        print GenRecordInstance.record.mol_type
+        #if parts.RefType == 'n' :
+        #    #NM.c += "n."
+        #else :
+        #    #NM.c += "c."
+        if GenRecordInstance.record.organelle and \
+           GenRecordInstance.record.organelle == "mitochondrion" :
+            NM.g += "m."
         else :
-            if recordDict.genelist :
-                NM.g += ":g."
-            else : # EST
-                NM.g += ":"
+            if GenRecordInstance.record.geneList :
+                NM.g += "g."
+            #else : # EST
+            #    NM.g += ""
         #else   
 
+        GS = GenRecordInstance.record.geneList[0].name
         if parts.SingleAlleleVarSet :
-            NM.c += '['
+            #NM.c += '['
             NM.g += '['
             for i in parts.SingleAlleleVarSet :
-                __rv(MUU, record, GS, i.RawVar, M, parts.RefType, O, NM)
-                NM.c += ';'
+                __rv(MUU, record, i.RawVar, GenRecordInstance, 
+                     parts.RefType, O, NM)
+                #NM.c += ';'
                 NM.g += ';'
             #for
-            NM.c = NM.c[0:-1] + ']'
+            #NM.c = NM.c[0:-1] + ']'
             NM.g = NM.g[0:-1] + ']'
         #if
         else :
-            NM = __rv(MUU, record, GS, parts.RawVar, M, parts.RefType, O, NM)
-
-        #print
-        #print "+++", NM.c
-        #print "+++", NM.g
-        #O.createOutputNode("variantdescription", 1) # Info message.
-        #O.addToOutputNode(__file__, "variantdescription", "INFO", NM.c)
-        #O.addToOutputNode(__file__, "variantdescription", "INFO", NM.g)
-        O.addOutput("variantdescription", NM.c)
+            NM = __rv(MUU, record, parts.RawVar, GenRecordInstance, 
+                      parts.RefType, O, NM)
+
+        #O.addOutput("variantdescription", NM.c)
         O.addOutput("variantdescription", NM.g)
         del NM
 
+        W = GenRecordInstance.record.geneList[0].transcriptList[0]
         if not W.CDS : # Noncoding.
             return
-        if noTrans :
-            return
-        if not recordDict.genelist : # EST
+        #if noTrans :
+        #    return
+        if not GenRecordInstance.record.geneList : # EST
             return
 
-        import Bio
-        from Bio.Seq import Seq
-        from Bio.Alphabet import IUPAC
-
-        cds = Seq(str(__splice(MUU.orig, W.CDS.list)), IUPAC.unambiguous_dna)
-        cdsm = Seq(str(__nsplice(MUU.mutated, MUU.newSplice(W.mRNA.list), 
-                                 MUU.newSplice(W.CDS.location), M.orientation)),
+        cds = Seq(str(__splice(MUU.orig, W.CDS.positionList)), 
+                  IUPAC.unambiguous_dna)
+        cdsm = Seq(str(__nsplice(MUU.mutated, 
+                                 MUU.newSplice(W.mRNA.positionList), 
+                                 MUU.newSplice(W.CDS.location), 
+                                 W.CM.orientation)),
                    IUPAC.unambiguous_dna)
-        if M.orientation == -1 :
+        if W.CM.orientation == -1 :
             cds = Bio.Seq.reverse_complement(cds)
             cdsm = Bio.Seq.reverse_complement(cdsm)
-        del M
 
-        #print "\n<b>Old protein:</b>"
         if '*' in cds.translate()[:-1] :
-            print "In frame stop codon found."
+            O.addMessage(__file__, 3, "ESTOP", "In frame stop codon found.")
             return
         #if
         orig = cds.translate(table = W.txTable, cds = True, to_stop = True)
-        #__bprint(orig + '*')
-        #O.createOutputNode("oldprotein", 1) # Info message.
-        #O.addToOutputNode(__file__, "oldprotein", "INFO", orig + '*')
         O.addOutput("oldprotein", orig + '*')
-        #print "\n\n<b>New protein:</b>"
         trans = cdsm.translate(table = W.txTable, to_stop = True)
 
         if not trans or trans[0] != 'M' :
             if str(cdsm[0:3]) in \
                 Bio.Data.CodonTable.unambiguous_dna_by_id[
                     W.txTable].start_codons :
-                __bprint('?')
-                print "\n\n<b>Alternative protein using start codon %s:</b>" % \
-                    str(cdsm[0:3])
-                __bprint('M' + trans[1:] + '*')
-                #O.createOutputNode("altprotein", 1) # Info message.
-                #O.addToOutputNode(__file__, "altprotein", "INFO", 'M' + trans[1:] + '*')
+                O.addOutput("newprotein", '?')
+                O.addOutput("altstart", str(cdsm[0:3]))
                 O.addOutput("altprotein", 'M' + trans[1:] + '*')
             else :
                 __bprint('?')
-                #O.createOutputNode("newprotein", 1) # Info message.
-                #O.addToOutputNode(__file__, "newprotein", "INFO", '?')
                 O.addOutput("newprotein", '?')
         else :
-            #__bprint(trans + '*')
-            #O.createOutputNode("newprotein", 1) # Info message.
-            #O.addToOutputNode(__file__, "newprotein", "INFO", trans + '*')
             O.addOutput("newprotein", trans + '*')
 
-        if protDescr :
-            #print
-            #print
-            #O.createOutputNode("proteindescription", 1) # Info message.
-            #O.addToOutputNode(__file__, "proteindescription", "INFO", 
-            #                  __toProtDescr(orig, trans))
-            O.addOutput("proteindescription", __toProtDescr(orig, trans))
-        #if
+        if not parts.SingleAlleleVarSet :
+            O.addOutput("proteindescription", __toProtDescr(
+                W.CM.g2x(MUU.newSplice(W.CDS.location)[1])[0], orig, trans))
+        else :
+            O.addOutput("proteindescription", "p.?")
+            
+        del W.CM
     #if                
 #__ppp
 
-def main(cmd) :
-    C = Config.Config()
-    O = Output.Output(__file__, C.Output)
-
-    #O.LogMsg(__file__, "Received variant " + cmd)
-    O.addMessage(__file__, -1, "INFO", "Received variant " + cmd)
-
+def process(cmd, C, O) :
     parser = Parser.Nomenclatureparser(O)
-    #print cmd
-    #O.createOutputNode("inputvariant", 1) # Info message.
-    #O.addToOutputNode(__file__, "inputvariant", "INFO", cmd)
     O.addOutput("inputvariant", cmd)
-    #print
     ParseObj = parser.parse(cmd)
-    #print
-    #for i in parser.outputData : # HMMMM
-    #    #print i.origin, i.name, i.msgType, i.severity, i.message
-    #    print i, parser.outputData[i].message
     del parser
 
     if ParseObj :
@@ -824,10 +711,9 @@ def main(cmd) :
             RetrieveRecord = ParseObj.RefSeqAcc + '.' + ParseObj.Version
         else :
             RetrieveRecord = ParseObj.RefSeqAcc
+        O.addOutput("reference", RetrieveRecord)
         
-        #print "Retrieving..."
-
-        D = Db.Db("local", C.Db.internalDb, C.Db)
+        D = Db.Cache(C.Db)
         retriever = Retriever.Retriever(C.Retriever, O, D)
         record = retriever.loadrecord(RetrieveRecord)
         if not record :
@@ -835,44 +721,27 @@ def main(cmd) :
         del retriever
         del D
         
-        #print "Dicting..."
-        D = GenRecord.GenRecord()
-        d = D.record2dict(record)
-        del D
-        #print "Printing..."
-        #D.printRecordDict(d, record)
-        
-        from Modules import Mutator
-        
+        GenRecordInstance = GenRecord.GenRecord(C.GenRecord, O)
+        GenRecordInstance.parseRecord(record)
+
         MUU = Mutator.Mutator(record.seq, C.Mutator, O)
+        __ppp(MUU, record, ParseObj, GenRecordInstance, "",  0, O)
+        del MUU
+        return GenRecordInstance
+    #if
+#process
 
-        #MUU.createOutputNode(__file__, "errors", 3) # Error message.
-        #MUU.createOutputNode(__file__, "warnings", 3) # Error message.
+def main(cmd) :
+    C = Config.Config()
+    O = Output.Output(__file__, C.Output)
 
-        __ppp(MUU, record, ParseObj, d, "",  0, O)
-        #for i in MUU.outputData : # HMMMM
-        #    #print i.origin, i.name, i.msgType, i.severity, i.message
-        #    print i, MUU.outputData[i].message
+    O.addMessage(__file__, -1, "INFO", "Received variant " + cmd)
 
+    RD = process(cmd, C, O)
 
-        del MUU
-    #if
-    #print "\n\n"
-    O.Summary()
-    #O.LogMsg(__file__, "Finished processing variant " + cmd)
     O.addMessage(__file__, -1, "INFO", "Finished processing variant " + cmd)
-    #for i in O.outputData : # HMMMM
-    #    #print i.origin, i.name, i.msgType, i.severity, i.message
-    #    print i, O.outputData[i].message
 
     ### OUTPUT BLOCK ###
-    print "NEW OUTPUT BLOCK"
-    vd = O.getOutput("variantdescription")
-    if vd :
-        print vd[0]
-        print vd[1]
-        print
-    #if
     gn = O.getOutput("genename")
     if gn :
         print "Gene Name: " + gn[0]
@@ -882,54 +751,70 @@ def main(cmd) :
         print
     #if
     
-    #for i in O.getOutput("fatalerrors") :
-    #    print "Fatal (%s) %s: %s" % (i.origin, i.code, i.description)
-    #for i in O.getOutput("errors") :
-    #    print "Error (%s) %s: %s" % (i.origin, i.code, i.description)
-    #for i in O.getOutput("warnings") :
-    #    print "Warning (%s) %s: %s" % (i.origin, i.code, i.description)
-    #for i in O.getOutput("info") :
-    #    print "Info (%s) %s: %s" % (i.origin, i.code, i.description)
-    #for i in O.getOutput("debug") :
-    #    print "Debug (%s) %s: %s" % (i.origin, i.code, i.description)
     O.getMessages()
+    errors, warnings, summary = O.Summary()
+    print summary
+    print
+
+    if not errors :
+        visualisation = O.getOutput("visualisation")
+        if visualisation :
+            for i in range(len(visualisation)) :
+                if i and not i % 3 :
+                    print
+                print visualisation[i]
+            #for
+            print
+        #if
 
-    visualisation = O.getOutput("visualisation")
-    if visualisation :
-        for i in range(len(visualisation)) :
-            if i and not i % 3 :
-                print
-            print visualisation[i]
-        #for
-        print
-    #if
-    vd = O.getOutput("variantdescription")
-    if vd :
-        for i in vd :
-            print i
-    op = O.getOutput("oldprotein")
-    if op :
-        print "\n<b>Old protein:</b>"
-        __bprint(op[0])
-        print
-    #if
-    np = O.getOutput("newprotein")
-    if np :
-        print "\n<b>New protein:</b>"
-        __bprint(np[0])
-        print
+        reference = O.getOutput("reference")[0]
+
+        for i in RD.record.geneList :
+            for j in i.transcriptList :
+                if ';' in j.description :
+                    print "%s(%s_%s):%c.[%s]" % (reference, i.name, j.name, 
+                                                 j.molType, j.description)
+                else :
+                    print "%s(%s_%s):%c.%s" % (reference, i.name, j.name, 
+                                               j.molType, j.description)
+
+        vd = O.getOutput("variantdescription")
+        if vd :
+            for i in vd :
+                print "%s:%s" % (reference, i)
+
+        pd = O.getOutput("proteindescription")
+        if pd :
+            if O.getOutput("altprotein") :
+                print "%s:p.(0)" % reference
+            else :
+                print "%s:%s" % (reference, pd[0])
+        #if
+
+        op = O.getOutput("oldprotein")
+        if op :
+            print "\n<b>Old protein:</b>"
+            __bprint(op[0])
+            print
+        #if
+        np = O.getOutput("newprotein")
+        if np :
+            print "\n<b>New protein:</b>"
+            __bprint(np[0])
+            print
+        #if
+        ap = O.getOutput("altprotein")
+        if ap :
+            print "\n<b>Alternative protein using start codon %s:</b>" % \
+                O.getOutput("altstart")[0]
+            __bprint(ap[0])
+            print
+        #if
     #if
-    pd = O.getOutput("proteindescription")
-    if pd :
-        print
-        print pd[0]
-    print "/NEW OUTPUT BLOCK"
     ### OUTPUT BLOCK ###
     del O
 #main
 
 if __name__ == "__main__" :
-    import sys
-
     main(sys.argv[1])
 #if
diff --git a/src/UCSC_update.py b/src/UCSC_update.py
index 8125d63d2e7407ea984f78a02a3db8da16157ba1..73cb0e29b297efdd10abf91673f24c553d0863fc 100644
--- a/src/UCSC_update.py
+++ b/src/UCSC_update.py
@@ -3,26 +3,29 @@
 """
     Get updates on mapping information from the UCSC.
 
-    This program is intended to be run dayly from cron. 
+    This program is intended to be run daily from cron. 
 """
 
-import sys
-import os
-os.chdir(sys.argv[0].rsplit('/', 2)[0])
+import sys # sys.argv
+import os  # os.chdir()
 
 from Modules import Config
 from Modules import Output
-from Modules import Db
+from Modules.Db import Remote
+from Modules.Db import Update
+
+os.chdir(sys.argv[0].rsplit('/', 2)[0])
 
 C = Config.Config()
 O = Output.Output(__file__, C.Output)
 O.addMessage(__file__, -1, "INFO", "Starting UCSC mapping data update")
 
 for i in C.Db.dbNames :
-    RemoteDb = Db.Db("remote", i, C.Db)
-    LocalDb = Db.Db("local", i, C.Db)
-    
+    RemoteDb = Remote(i, C.Db)
     RemoteDb.get_Update()
+    del RemoteDb
+
+    LocalDb = Update(i, C.Db)
     LocalDb.load_Update()
     
     count_Updates = LocalDb.count_Updates()
@@ -36,11 +39,10 @@ for i in C.Db.dbNames :
         LocalDb.merge_cdsUpdates()
     #if
     LocalDb.merge_Update()
+
+    del LocalDb
 #for    
 
 O.addMessage(__file__, -1, "INFO", "UCSC mapping data update end")
 
-del LocalDb
-del RemoteDb
-del O
-del C
+del O, C
diff --git a/src/VarInfo.py b/src/VarInfo.py
index 4df7273c01e3c91a4c48f7f6a01b23e0a40a03f3..cda88548b843d8a82419288d58297ff16fbe5527 100644
--- a/src/VarInfo.py
+++ b/src/VarInfo.py
@@ -72,12 +72,12 @@ def __getcoords(C, Loc, Type) :
 def __process(LOVD_ver, build, acc, var, C, O) :
     # Make a connection to the MySQL database with the username / db
     #   information from the configuration file.
-    Database = Db.Db("local", build, C.Db) # Open the database.
-    if not Database.opened :
+    if not build in C.Db.dbNames :
         O.addMessage(__file__, 4, "EARG", "Database %s not found." % build)
         print "Error (Variant_info): Database %s not found." % build
         return
     #if        
+    Database = Db.Mapping(build, C.Db) # Open the database.
     
     # Get the rest of the input variables.
     accno = acc
diff --git a/src/handler.py b/src/handler.py
index 45bfc73d2e81b93bf47ed9af36067847d19518c9..84b3ad3981a9d0485b69a43dbe9b1121f2049b2f 100644
--- a/src/handler.py
+++ b/src/handler.py
@@ -11,16 +11,14 @@
 """
 
 import os
+import bz2
 from ZSI import dispatch
-
-# This is a workaround for pydoc. Aparently it crashes when a module can not be
-# imported.
-try : 
-    from mod_python import apache, publisher
-except ImportError :
-    pass
+from soaplib.client import make_service_client
+from mod_python import apache, publisher
 
 from Modules import Web
+from Modules import Config
+
 import webservice
 
 def handler(req):
@@ -76,16 +74,43 @@ def handler(req):
         reqFile = req.uri.split('/')[-1]
         req.content_type = 'text/plain'
         req.headers_out["Content-Disposition"] = \
-          "attachment; filename = \"%s\"" % reqFile # To force downloading.
-        args = {"path" : reqPath}                   # Replace the path variable.
+            "attachment; filename = \"%s\"" % reqFile # To force downloading.
+        args = {"path" : reqPath}                     # Replace the path.
         req.write(W.tal("HTML", "templates/" + reqFile, args))
         return apache.OK
     #if
 
+    # Return raw content (for batch checker results).
+    if "Results" in req.uri :
+        reqFile = req.uri.split('/')[-1]
+        C = Config.Config()
+        req.write(open("%s/%s" % (C.Scheduler.resultsDir, reqFile)).read())
+        del C
+        return apache.OK
+    #if
+
+    # Return uncompressed GenBank files from the cache.
+    if "GenBank" in req.uri :
+        reqFile = req.uri.split('/')[-1]
+        C = Config.Config()
+        fileName = "%s/%s.bz2" % (C.Retriever.cache, reqFile)
+        if os.path.isfile(fileName) :
+            handle = bz2.BZ2File("%s/%s.bz2" % (C.Retriever.cache, reqFile), 
+                                 "r")
+            req.content_type = 'text/plain'
+            req.headers_out["Content-Disposition"] = \
+                "attachment; filename = \"%s\"" % reqFile # Force downloading.
+            req.write(handle.read())
+            handle.close()
+            del C
+        #if
+        else :
+            return apache.HTTP_FORBIDDEN
+        return apache.OK
+    #if
+
     # Generate the WSDL file from the MutalyzerService class.
     if ".wsdl" in req.uri :
-        from soaplib.client import make_service_client
-
         servicepath = "http://" + reqPath + "/services"
         client = make_service_client(servicepath, webservice.MutalyzerService())
         req.content_type = 'text/xml'
diff --git a/src/index.py b/src/index.py
index a42649bf6e928a2491a3b35d021469f8e9db29e9..b535fbc045c400c0e770e5a8c1bdd8e6ba9735f4 100644
--- a/src/index.py
+++ b/src/index.py
@@ -15,12 +15,18 @@
 
 import Mutalyzer
 import VarInfo
-from Modules import Web
-from mod_python import apache
-from Modules import Config
 import pydoc
 import webservice
 
+from mod_python import apache
+
+from Modules import Web
+from Modules import Config
+from Modules import Output
+from Modules import Db
+from Modules import Scheduler
+from Modules import File
+
 def index(req) :
     """
         The mutation checker page.
@@ -111,6 +117,9 @@ def download(req) :
 #download
 
 def upload(req) :
+    """
+    """
+
     C = Config.Config()
     maxUploadSize = C.Retriever.maxDldSize
     del C
@@ -136,6 +145,41 @@ def upload(req) :
     return ret
 #upload
 
+def batch(req) :
+    """
+    """
+
+    W = Web.Web()
+    eMail = ""
+    if req.form :
+        eMail = req.form['eMail']
+        fileUpload = req.form['file']
+        
+        if fileUpload.filename and W.isEMail(eMail) :
+            C = Config.Config()
+            D = Db.Batch(C.Db)
+            S = Scheduler.Scheduler(C.Scheduler, D)
+            O = Output.Output(__file__, C.Output)
+            FileInstance = File.File(C.File, O)
+
+            job = FileInstance.parseBatchFile(fileUpload.file)
+            S.addJob("1231243", eMail, job, "http://%s%s" % (req.hostname, 
+                                                             req.uri))
+
+            del FileInstance, S, D, C
+        #if            
+    #if
+
+    args = {
+        "version" : W.version,
+        "lastEMail" : eMail
+    }
+
+    ret = W.tal("HTML", "templates/batch.html", args)
+    del W
+    return ret
+#batch
+
 def documentation(req) :
     """
         Generate documentation for the webservice.
diff --git a/src/webservice.py b/src/webservice.py
index 510f1b82bb897abd409aa879142866a8356bc32a..b776dac5a51d5810c0450c2027393475e3120b9d 100644
--- a/src/webservice.py
+++ b/src/webservice.py
@@ -1,5 +1,11 @@
 #!/usr/bin/python
 
+"""
+    Mutalyzer webservices.
+
+    Public classes:
+        MutalyzerService ; Mutalyzer webservices.
+"""
 
 from soaplib.wsgi_soap import SimpleWSGISoapApp
 from soaplib.service import soapmethod
@@ -9,7 +15,7 @@ from ZSI import TC
 from ZSI.fault import Fault
 
 from Modules import Web
-from Modules import Db
+from Modules.Db import Mapping
 from Modules import Output
 from Modules import Config
 from Modules import Parser
@@ -48,7 +54,7 @@ class MutalyzerService(SimpleWSGISoapApp) :
             gTocConversion(self, build, variant) ; Convert g. to c.
     """
 
-    def __checkBuild(self, L, D, build) :
+    def __checkBuild(self, build, config) :
         """
             Check if the build is supported (hg18 or hg19).
 
@@ -61,7 +67,7 @@ class MutalyzerService(SimpleWSGISoapApp) :
                 Nothing (but raises an EARG exception).
         """
 
-        if not D.opened :
+        if not build in config.dbNames :
             L.addMessage(__file__, 4, "EARG", "EARG %s" % build)
             raise Fault(Fault.Client, "EARG", 
                 detail = "The build argument (%s) was not a valid " \
@@ -178,8 +184,8 @@ class MutalyzerService(SimpleWSGISoapApp) :
                      "Received request getTranscripts(%s %s %s)" % (build,
                      chrom, pos))
 
-        D = Db.Db("local", build, C.Db)
-        self.__checkBuild(L, D, build)
+        self.__checkBuild(build, C.Db)
+        D = Mapping(build, C.Db)
 
         self.__checkChrom(L, D, chrom)
         self.__checkPos(L, pos)
@@ -220,8 +226,8 @@ class MutalyzerService(SimpleWSGISoapApp) :
             "Received request getTranscriptsRange(%s %s %s %s %s)" % (build,
             chrom, pos1, pos2, method))
 
-        D = Db.Db("local", build, C.Db)
-        self.__checkBuild(L, D, build)
+        D = Mapping(build, C.Db)
+        self.__checkBuild(build, C.Db)
 
         ret = D.get_Transcripts(chrom, pos1, pos2, method)
         L.addMessage(__file__, -1, "INFO", 
@@ -252,8 +258,8 @@ class MutalyzerService(SimpleWSGISoapApp) :
         L.addMessage(__file__, -1, "INFO", 
                      "Received request getGeneName(%s %s)" % (build, accno))
 
-        D = Db.Db("local", build, C.Db)
-        self.__checkBuild(L, D, build)
+        D = Mapping(build, C.Db)
+        self.__checkBuild(build, C.Db)
     
         ret = D.get_GeneName(accno.split('.')[0])
         L.addMessage(__file__, -1, "INFO", 
@@ -424,7 +430,7 @@ class MutalyzerService(SimpleWSGISoapApp) :
         """
     
         Conf = Config.Config() # Read the configuration file.
-        Database = Db.Db("local", build, Conf.Db)
+        D = Mapping(build, C.Db)
 
         O = Output.Output(__file__, Conf.Output)
     
diff --git a/templates/batch.html b/templates/batch.html
new file mode 100644
index 0000000000000000000000000000000000000000..c25e60987199f209aeee4a59e0b7f01453a2252a
--- /dev/null
+++ b/templates/batch.html
@@ -0,0 +1,40 @@
+<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" 
+  "http://www.w3.org/TR/html4/loose.dtd">
+<html>
+  <head>
+    <meta http-equiv = "Content-type" content = "text/html; charset=UTF-8">
+    <title tal:content = "structure string:Mutalyzer ${version}"></title>
+    <script type = "text/javascript" 
+        language = "javascript" 
+        src = "test.js">
+    </script>
+  </head>
+  <body onload = "yo()">
+<!--
+    <div metal:use-macro = "sitemacros/macros/menu"></div>
+-->
+    <center>
+      <big tal:content = "structure string:Mutalyzer ${version} batch checker.">
+      </big>
+    </center><br>
+    Blablabla
+    <br>
+    <form action = "" method = "post" enctype = "multipart/form-data">
+      <input 
+        type = "file" 
+        name = "file" 
+        size = "100%"
+      ><br>
+      <input 
+        type = "text" 
+        name = "eMail" 
+        tal:attributes = "value lastEMail"
+        size = "100%"
+      ><br>
+      <input 
+        type="submit" 
+        value="Submit"
+      >
+    </form>
+  </body>
+</html>