From 40130b273afb35b153f68b21ebd1c5e78745e1e3 Mon Sep 17 00:00:00 2001
From: Martijn Vermaat <martijn@vermaat.name>
Date: Mon, 9 Dec 2013 16:50:22 +0100
Subject: [PATCH] Use Jinja2 for description extractor
---
mutalyzer/templates/descriptionExtract.html | 109 -----------------
.../templates/description_extractor.html | 111 ++++++++++++++++++
mutalyzer/templates/syntax_checker.html | 2 +-
mutalyzer/website.py | 13 +-
4 files changed, 118 insertions(+), 117 deletions(-)
delete mode 100644 mutalyzer/templates/descriptionExtract.html
create mode 100644 mutalyzer/templates/description_extractor.html
diff --git a/mutalyzer/templates/descriptionExtract.html b/mutalyzer/templates/descriptionExtract.html
deleted file mode 100644
index 27551f31..00000000
--- a/mutalyzer/templates/descriptionExtract.html
+++ /dev/null
@@ -1,109 +0,0 @@
-<html>
- <head>
- <link rel="stylesheet"
- type="text/css"
- href="static/css/style.css">
- <title></title>
- </head>
- <body>
- <div metal:define-macro="content">
- <center>
- <h3>Variant Description Extractor</h3>
- </center>
- <div> <!-- Remove this div later. -->
- <b style="color: red">Note that this is an experimental service.</b>
- <br>
- <br>
- Extract the HGVS variant description from a reference sequence and an
- observed sequence. For now, we require the user to fill in two
- sequences. After the testing phase, we plan to use the underlying
- algorithm for:
- <ul>
- <li>
- Disambiguation in the name checker. This will enable full support
- for complex variants.
- </li>
- <li>
- Comparison of two reference sequences. Useful for migrating a
- variant description to an other reference sequence.
- </li>
- <li>
- Implementation of a Reference Sequence Editor.
- </li>
- </ul>
- <br>
- </div>
- <div style="border: 1px solid grey; background-color: aliceblue; padding: 20px;">
- <form action = "" method = "post">
- Please supply a reference sequence and an observed sequence.<br>
- <br>
- <div style="border: 1px solid grey; padding: 20px">
- <b>Reference sequence:</b><br>
- <br>
- Example: <tt>ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA</tt><br>
- <br>
- <input
- type = "text"
- name = "referenceSeq"
- tal:attributes = "value lastReferenceSeq"
- style = "width:100%"
- ><br>
- <input type="button" value="Clear field" onclick="clearField(this.form, 'referenceSeq');">
- </div>
- <br>
- <div style="border: 1px solid grey; padding: 20px">
- <b>Observed sequence:</b><br>
- <br>
- Example: <tt>ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</tt><br>
- <br>
- <input
- type = "text"
- name = "variantSeq"
- tal:attributes = "value lastVariantSeq"
- style = "width:100%"
- ><br>
- <input type="button" value="Clear field" onclick="clearField(this.form, 'variantSeq');">
- </div>
- <br>
- <input type="submit" value="Submit">
- <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/DescriptionExtractor">Help</a>
- </form>
- </div>
- <div tal:condition = "description">
- <br>
- <h3>Variant Description Extractor results:</h3>
- <div class="messages">
- <p tal:repeat = "m messages" tal:content = "m/description"
- tal:attributes = "class m/class; title string:${m/level} (origin: ${m/origin})"></p>
- <p tal:content = "summary"></p>
- </div>
- <div tal:condition = "not:errors">
- <br>
- <b>Genomic description:</b><br>
- <br>
- <tt>g.<div tal:replace = "description"></div></tt>
- <br>
- <br>
- <br>
- <b>Overview of the raw variants:</b><br>
- <br>
- <table class = "laTable">
- <tr>
- <td>Start</td>
- <td>End</td>
- <td>Type</td>
- <td>Deleted</td>
- <td>Inserted</td>
- <td>Shift</td>
- <td>Description</td>
- </tr>
- <tr tal:repeat = "i visualisation">
- <td tal:repeat = "j i" tal:content = "j"></td>
- </tr>
- </table>
- </div>
- </div> <!-- description -->
- <br>
- </div>
- </body>
-</html>
diff --git a/mutalyzer/templates/description_extractor.html b/mutalyzer/templates/description_extractor.html
new file mode 100644
index 00000000..7d2b5c11
--- /dev/null
+++ b/mutalyzer/templates/description_extractor.html
@@ -0,0 +1,111 @@
+{% extends "base.html" %}
+
+{% set active_page = "description-extractor" %}
+{% set page_title = "Variant Description Extractor" %}
+
+{% block content %}
+
+<p>
+<b style="color: red">Note that this is an experimental service.</b>
+</p>
+
+<p>
+Extract the HGVS variant description from a reference sequence and an
+observed sequence. For now, we require the user to fill in two
+sequences. After the testing phase, we plan to use the underlying
+algorithm for:
+</p>
+
+<ul>
+ <li>
+ Disambiguation in the name checker. This will enable full support
+ for complex variants.
+ </li>
+ <li>
+ Comparison of two reference sequences. Useful for migrating a
+ variant description to an other reference sequence.
+ </li>
+ <li>
+ Implementation of a Reference Sequence Editor.
+ </li>
+</ul>
+
+<div style="border: 1px solid grey; background-color: aliceblue; padding: 20px;">
+ <form action = "" method = "post">
+ Please supply a reference sequence and an observed sequence.<br>
+ <br>
+ <div style="border: 1px solid grey; padding: 20px">
+ <b>Reference sequence:</b><br>
+ <br>
+ Example: <tt>ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA</tt><br>
+ <br>
+ <input
+ type = "text"
+ name = "referenceSeq"
+ value = "{{ lastReferenceSeq|e }}"
+ style = "width:100%"
+ ><br>
+ <input type="button" value="Clear field" onclick="clearField(this.form, 'referenceSeq');">
+ </div>
+ <br>
+ <div style="border: 1px solid grey; padding: 20px">
+ <b>Observed sequence:</b><br>
+ <br>
+ Example: <tt>ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA</tt><br>
+ <br>
+ <input
+ type = "text"
+ name = "variantSeq"
+ value = "{{ lastVariantSeq|e }}"
+ style = "width:100%"
+ ><br>
+ <input type="button" value="Clear field" onclick="clearField(this.form, 'variantSeq');">
+ </div>
+ <br>
+ <input type="submit" value="Submit">
+ <a href="https://humgenprojects.lumc.nl/trac/mutalyzer/wiki/DescriptionExtractor">Help</a>
+ </form>
+</div>
+
+{% if description is defined %}
+ <h3>Variant Description Extractor results:</h3>
+
+ <div class="messages">
+ {% for m in messages %}
+ <p class="{{ m.class|e }}" title="{{ m.level|e }} (origin: {{ m.origin|e }})">{{ m.description|e }}</p>
+ {% endfor %}
+ <p>{{ summary|e }}</p>
+ </div>
+
+ {% if not errors %}
+ <p>
+ <b>Genomic description:</b>
+ </p>
+ <p>
+ <tt>g.{{ description|e }}</tt>
+ </p>
+ <p>
+ <b>Overview of the raw variants:</b>
+ </p>
+ <table class = "laTable">
+ <tr>
+ <td>Start</td>
+ <td>End</td>
+ <td>Type</td>
+ <td>Deleted</td>
+ <td>Inserted</td>
+ <td>Shift</td>
+ <td>Description</td>
+ </tr>
+ {% for i in visualisation %}
+ <tr>
+ {% for j in i %}
+ <td>{{ j|e }}</td>
+ {% endfor %}
+ </tr>
+ {% endfor %}
+ </table>
+ {% endif %}
+{% endif %}
+
+{% endblock content %}
diff --git a/mutalyzer/templates/syntax_checker.html b/mutalyzer/templates/syntax_checker.html
index 1052c464..822b532c 100644
--- a/mutalyzer/templates/syntax_checker.html
+++ b/mutalyzer/templates/syntax_checker.html
@@ -33,7 +33,7 @@
<br>
</div>
<br>
-{% if variant %}
+{% if variant is defined %}
<h3>Variant syntax checker results:</h3>
{% if parseError %}
<div class="messages">
diff --git a/mutalyzer/website.py b/mutalyzer/website.py
index 53e65cfd..ecbdf93b 100644
--- a/mutalyzer/website.py
+++ b/mutalyzer/website.py
@@ -459,7 +459,7 @@ class SyntaxCheck:
counter = Db.Counter()
counter.increment('syntaxcheck', 'website')
- variant = i.variant
+ variant = i.variant or ''
if variant.find(',') >= 0:
output.addMessage(__file__, 2, "WCOMMASYNTAX",
"Comma's are not allowed in the syntax, autofixed.")
@@ -962,14 +962,14 @@ class DescriptionExtractor:
output = Output(__file__)
IP = web.ctx["ip"]
+ if not (referenceSeq and variantSeq):
+ return render.description_extractor()
+
args = {
'lastReferenceSeq' : referenceSeq,
'lastVariantSeq' : variantSeq
}
- if not (referenceSeq and variantSeq):
- return render_.descriptionExtract(args)
-
output.addMessage(__file__, -1, 'INFO',
"Received Description Extract request from %s" % IP)
@@ -998,14 +998,13 @@ class DescriptionExtractor:
'visualisation' : visualisation,
'errors' : errors,
'summary' : summary,
- 'messages' : map(util.message_info,
- output.getMessages())
+ 'messages' : map(util.message_info, output.getMessages())
}
output.addMessage(__file__, -1, 'INFO',
"Finished Description Extract request")
- return render_.descriptionExtract(args)
+ return render.description_extractor(args)
#descriptionExtract
#DescriptionExtract
--
GitLab