repeat-extractor.py 4.76 KB
Newer Older
jkvis's avatar
jkvis committed
1 2 3 4 5 6
#!/usr/bin/env python

from __future__ import unicode_literals

from extractor import *

jkvis's avatar
jkvis committed
7 8 9
#ref = 'AGCTGTGGGAGGGAGCCAGTGGATTTGGAAACAGAAATGGCTTGGCCTTGCCTGCCTGCCTGCCTGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCCTCCTGCAATCCTTTAACTTACTGAATAACTCATGATTATGGGCCACCTGCAGGTACCATGCTAG'
#alt = 'AGCTGTGGGAGGGAGCCAGTGGATTTGGAAACAGAAATGGCTTCGCCTTGCCTGCCTGCCTGCCTGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCGTCCTTCCTTCCCTCCTGCAATCCTATAACTTACTGAATAACTCATGATTATGGGCCACCTGCAGGTACCATGCTAG'
#units = ['TCCT', 'GCCT']
jkvis's avatar
jkvis committed
10

jkvis's avatar
jkvis committed
11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82
#print 'version:', extractor.VERSION

#describe_repeats(ref, alt, units)

THRESHOLD = 10000


class Repeat(object):
    """
    Simple repeat structure.
    """
    __slots__ = ['start', 'end', 'count']

    def __init__(self, start, end, count=0):
        """
        Initialize the repeat structure.

        :arg integer start: Start position of the repeat.
        :arg integer end: End position of the repeat.
        :arg integer count: Number of repeats.
        """
        self.start = start
        self.end = end
        self.count = count


def short_sequence_repeat_extractor(string, min_length=1):
    """
    Extract the short tandem repeat structure from a string.

    :arg string string: The string.
    :arg integer min_length: Minimum length of the repeat structure.
    """
    length = len(string)

    k_max = length // 2 + 1
    if k_max > THRESHOLD:
        k_max = THRESHOLD // 2

    repeats = []

    i = 0
    last_repeat = i
    while i < length:
        max_count = 0
        max_k = 1
        for k in range(min_length, k_max):
            count = 0
            for j in range(i + k, length - k + 1, k):
                if string[i:i + k] != string[j:j + k]:
                    break
                count += 1

            if count > 0 and count >= max_count:
                max_count = count
                max_k = k

        if max_count > 0:
            if last_repeat < i:
                repeats.append(Repeat(last_repeat, i))
            repeats.append(Repeat(i, i + max_k, max_count))
            last_repeat = i + max_k * (max_count + 1)

        i += max_k * (max_count + 1)

    if last_repeat < i:
        repeats.append(Repeat(last_repeat, i))

    return repeats


min_count = 3
83
min_length = 3
jkvis's avatar
jkvis committed
84 85 86 87 88 89 90 91 92 93 94 95 96

with open('strlist.txt', 'r') as infile:
    lines = infile.readlines()

sequences = {}

for line in lines:
    label, string = line.split('\t')
    if label in sequences:
        sequences[label].append(string.strip())
    else:
        sequences[label] = [string.strip()]

97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121
standard = {
    'Amel':     [],
    'CSF1P0':   ['AGAT'],
    'D10S1248': ['GGAA'],
    'D12S391':  ['AGAT', 'AGAC'],
    'D13S317':  ['TATC'],
    'D16S539':  ['GATA'],
    'D18S51':   ['GAAA'],
    'D19S433':  ['AAGG'],
    'D1S1656':  ['TAGA', 'TG'],
    'D21S11':   ['TCTA', 'TCTG'],
    'D22S1045': ['ATT'],
    'D2S1338':  ['TGCC', 'TTCC'],
    'D2S441':   ['TCTA'],
    'D3S1358':  ['AGAT', 'TCTA'],
    'D5S818':   ['AGAT'],
    'D7S820':   ['GATA'],
    'D8S1179':  ['TATC'],
    'FGA':      ['TTTC', 'CTTT', 'TTCC'],
    'PentaD':   ['AAAGA'],
    'PentaE':   ['AAAGA'],
    'TH01':     ['TCAT'],
    'TPOX':     ['AATG'],
    'vWA':      ['TCTA', 'TCTG', 'TCCA'],
    'DYS391':   ['TCTA']
122 123 124
}


jkvis's avatar
jkvis committed
125
#select = 'D13S317'
126
#unit_list = standard[select]
jkvis's avatar
jkvis committed
127
#reference = sequences[select][0]
128 129 130 131
#sample = sequences[select][14]
#description, rep_start, rep_end = describe_repeats(reference, sample, unit_list)
#print '{}({}_{}):l.{}'.format(select, rep_start, rep_end, description)

jkvis's avatar
jkvis committed
132 133 134


for sequence in sequences:
135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154
#    best = 0
#    for string in sequences[sequence]:
#        repeats = short_sequence_repeat_extractor(string, min_length)
#        score = 0
#        for repeat in repeats:
#            if repeat.count + 1 >= min_count:
#                score += (repeat.end - repeat.start) * (repeat.end - repeat.start) * (repeat.count + 1)
#        if score > best:
#            reference = string
#            best = score

#    repeats = short_sequence_repeat_extractor(reference, min_length)
#    units = {}
#    for repeat in repeats:
#        if repeat.count + 1 >= min_count:
#            units[reference[repeat.start:repeat.end]] = repeat.count + 1
#    unit_list = []
#    for unit in units:
#        unit_list.append(unit)

155
    unit_list = standard[sequence]
jkvis's avatar
jkvis committed
156 157 158 159

    reference = sequences[sequence][0]
    print sequence + ':',
    print reference
160
    if len(unit_list) > 0:
jkvis's avatar
jkvis committed
161 162 163 164 165 166
        print 'repeat units:', unit_list
    else:
        print 'repeat units: []'
    for string in sequences[sequence]:
        rep_start = 1
        rep_end = len(reference)
167
        if len(unit_list) > 0:
jkvis's avatar
jkvis committed
168 169 170 171 172
            description, rep_start, rep_end = describe_repeats(reference, string, unit_list)
        else:
            description = describe_dna(reference, string)
        print '{}({}_{}):l.{}'.format(sequence, rep_start, rep_end, description)
    print
jkvis's avatar
jkvis committed
173

jkvis's avatar
jkvis committed
174