Commit 8d286cf8 authored by jkvis's avatar jkvis
Browse files

Old tests ported to new dict output for single variants

parent 5725dfac
......@@ -14,7 +14,9 @@ TESTS = [
'type': 'range'},
'type': 'equal'}]),
# Single substitution: 7A>G
# Single variants
## Substitution: 7A>G
(REFERENCE,
'ACGTCGGTTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{'location': {'start': {'position': 0, 'type': 'point'},
......@@ -34,7 +36,7 @@ TESTS = [
'type': 'range'},
'type': 'equal'}]),
# Single deletion: 7del
## Single nucleotide deletion: 7del
(REFERENCE,
'ACGTCGTTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{'location': {'start': {'position': 0, 'type': 'point'},
......@@ -54,54 +56,157 @@ TESTS = [
'type': 'range'},
'type': 'equal'}]),
]
UNUSED = [
# Single deletion: 7del
(REFERENCE,
'ACGTCGTTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{}]),
# Single deletion multiple bases: 7_8del
## Multi nucleotide deletion: 7_8del
(REFERENCE,
'ACGTCGTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{}]),
[{'location': {'start': {'position': 0, 'type': 'point'},
'end': {'position': 6, 'type': 'point'},
'type': 'range'},
'type': 'equal'},
{'location': {'start': {'position': 6, 'type': 'point'},
'end': {'position': 8, 'type': 'point'},
'type': 'range'},
'insertions': [{'source': 'observed',
'location': {'start': {'position': 6, 'type': 'point'},
'end' : {'position': 6, 'type': 'point'},
'type': 'range'}}],
'type': 'delins'},
{'location': {'start': {'position': 8, 'type': 'point'},
'end': {'position': 44, 'type': 'point'},
'type': 'range'},
'type': 'equal'}]),
# Single insertion: 6_7insC
## Single nucleotide insertion: 6_7insC
(REFERENCE,
'ACGTCGCATTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{}]),
[{'location': {'start': {'position': 0, 'type': 'point'},
'end': {'position': 6, 'type': 'point'},
'type': 'range'},
'type': 'equal'},
{'location': {'start': {'position': 6, 'type': 'point'},
'end': {'position': 6, 'type': 'point'},
'type': 'range'},
'insertions': [{'source': 'observed',
'location': {'start': {'position': 6, 'type': 'point'},
'end' : {'position': 7, 'type': 'point'},
'type': 'range'}}],
'type': 'delins'},
{'location': {'start': {'position': 6, 'type': 'point'},
'end': {'position': 44, 'type': 'point'},
'type': 'range'},
'type': 'equal'}]),
# Single insertion multiple bases: 6_7insCC
## Multi nucleotide insertion: 6_7insCC
(REFERENCE,
'ACGTCGCCATTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{}]),
[{'location': {'start': {'position': 0, 'type': 'point'},
'end': {'position': 6, 'type': 'point'},
'type': 'range'},
'type': 'equal'},
{'location': {'start': {'position': 6, 'type': 'point'},
'end': {'position': 6, 'type': 'point'},
'type': 'range'},
'insertions': [{'source': 'observed',
'location': {'start': {'position': 6, 'type': 'point'},
'end' : {'position': 8, 'type': 'point'},
'type': 'range'}}],
'type': 'delins'},
{'location': {'start': {'position': 6, 'type': 'point'},
'end': {'position': 44, 'type': 'point'},
'type': 'range'},
'type': 'equal'}]),
# Single inversion: 7_11inv
## Inversion: 7_11inv
(REFERENCE,
'ACGTCGCGAATCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{}]),
[{'location': {'start': {'position': 0, 'type': 'point'},
'end': {'position': 6, 'type': 'point'},
'type': 'range'},
'type': 'equal'},
{'location': {'start': {'position': 6, 'type': 'point'},
'end': {'position': 11, 'type': 'point'},
'type': 'range'},
'type': 'inv'},
{'location': {'start': {'position': 11, 'type': 'point'},
'end': {'position': 44, 'type': 'point'},
'type': 'range'},
'type': 'equal'}]),
# Single delins: 7delinsCC
## Inversion: 6_7inv
(REFERENCE,
'ACGTCGCCTTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{}]),
'ACGTCTCTTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{'location': {'start': {'position': 0, 'type': 'point'},
'end': {'position': 5, 'type': 'point'},
'type': 'range'},
'type': 'equal'},
{'location': {'start': {'position': 5, 'type': 'point'},
'end': {'position': 7, 'type': 'point'},
'type': 'range'},
'type': 'inv'},
{'location': {'start': {'position': 7, 'type': 'point'},
'end': {'position': 44, 'type': 'point'},
'type': 'range'},
'type': 'equal'}]),
# Single delins: 21_23delinsTTTT
## Deletion/insertion 7delinsCC
(REFERENCE,
'ACGTCGATTCGCTAGCTTCGTTTTGATAGATAGAGATATAGAGAT',
[{}]),
'ACGTCGCCTTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{'location': {'start': {'position': 0, 'type': 'point'},
'end': {'position': 6, 'type': 'point'},
'type': 'range'},
'type': 'equal'},
{'location': {'start': {'position': 6, 'type': 'point'},
'end': {'position': 7, 'type': 'point'},
'type': 'range'},
'insertions': [{'source': 'observed',
'location': {'start': {'position': 6, 'type': 'point'},
'end' : {'position': 8, 'type': 'point'},
'type': 'range'}}],
'type': 'delins'},
{'location': {'start': {'position': 7, 'type': 'point'},
'end': {'position': 44, 'type': 'point'},
'type': 'range'},
'type': 'equal'}]),
# Single inversion: 6_7inv
## Deletion/insertion 21_23delinsTTTT
(REFERENCE,
'ACGTCTCTTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{}]),
'ACGTCGATTCGCTAGCTTCGTTTTGATAGATAGAGATATAGAGAT',
[{'location': {'start': {'position': 0, 'type': 'point'},
'end': {'position': 20, 'type': 'point'},
'type': 'range'},
'type': 'equal'},
{'location': {'start': {'position': 20, 'type': 'point'},
'end': {'position': 23, 'type': 'point'},
'type': 'range'},
'insertions': [{'source': 'observed',
'location': {'start': {'position': 20, 'type': 'point'},
'end' : {'position': 24, 'type': 'point'},
'type': 'range'}}],
'type': 'delins'},
{'location': {'start': {'position': 23, 'type': 'point'},
'end': {'position': 44, 'type': 'point'},
'type': 'range'},
'type': 'equal'}]),
# Single inversion: 7_8delinsTC
## Deletion/insertion 7_8delinsTC
(REFERENCE,
'ACGTCGTCTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT',
[{}]),
[{'location': {'start': {'position': 0, 'type': 'point'},
'end': {'position': 6, 'type': 'point'},
'type': 'range'},
'type': 'equal'},
{'location': {'start': {'position': 6, 'type': 'point'},
'end': {'position': 8, 'type': 'point'},
'type': 'range'},
'insertions': [{'source': 'observed',
'location': {'start': {'position': 6, 'type': 'point'},
'end' : {'position': 8, 'type': 'point'},
'type': 'range'}}],
'type': 'delins'},
{'location': {'start': {'position': 8, 'type': 'point'},
'end': {'position': 44, 'type': 'point'},
'type': 'range'},
'type': 'equal'}]),
]
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment