repeat-extractor.py 4.83 KB
Newer Older
jkvis's avatar
jkvis committed
1
2
3
4
5
6
#!/usr/bin/env python

from __future__ import unicode_literals

from extractor import *

jkvis's avatar
Testing    
jkvis committed
7
8
9
#ref = 'AGCTGTGGGAGGGAGCCAGTGGATTTGGAAACAGAAATGGCTTGGCCTTGCCTGCCTGCCTGCCTGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCCTCCTGCAATCCTTTAACTTACTGAATAACTCATGATTATGGGCCACCTGCAGGTACCATGCTAG'
#alt = 'AGCTGTGGGAGGGAGCCAGTGGATTTGGAAACAGAAATGGCTTCGCCTTGCCTGCCTGCCTGCCTGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCGTCCTTCCTTCCCTCCTGCAATCCTATAACTTACTGAATAACTCATGATTATGGGCCACCTGCAGGTACCATGCTAG'
#units = ['TCCT', 'GCCT']
jkvis's avatar
jkvis committed
10

jkvis's avatar
Testing    
jkvis committed
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
#print 'version:', extractor.VERSION

#describe_repeats(ref, alt, units)

THRESHOLD = 10000


class Repeat(object):
    """
    Simple repeat structure.
    """
    __slots__ = ['start', 'end', 'count']

    def __init__(self, start, end, count=0):
        """
        Initialize the repeat structure.

        :arg integer start: Start position of the repeat.
        :arg integer end: End position of the repeat.
        :arg integer count: Number of repeats.
        """
        self.start = start
        self.end = end
        self.count = count


def short_sequence_repeat_extractor(string, min_length=1):
    """
    Extract the short tandem repeat structure from a string.

    :arg string string: The string.
    :arg integer min_length: Minimum length of the repeat structure.
    """
    length = len(string)

    k_max = length // 2 + 1
    if k_max > THRESHOLD:
        k_max = THRESHOLD // 2

    repeats = []

    i = 0
    last_repeat = i
    while i < length:
        max_count = 0
        max_k = 1
        for k in range(min_length, k_max):
            count = 0
            for j in range(i + k, length - k + 1, k):
                if string[i:i + k] != string[j:j + k]:
                    break
                count += 1

            if count > 0 and count >= max_count:
                max_count = count
                max_k = k

        if max_count > 0:
            if last_repeat < i:
                repeats.append(Repeat(last_repeat, i))
            repeats.append(Repeat(i, i + max_k, max_count))
            last_repeat = i + max_k * (max_count + 1)

        i += max_k * (max_count + 1)

    if last_repeat < i:
        repeats.append(Repeat(last_repeat, i))

    return repeats


min_count = 3
83
min_length = 3
jkvis's avatar
Testing    
jkvis committed
84
85
86
87
88
89
90
91
92
93
94
95
96

with open('strlist.txt', 'r') as infile:
    lines = infile.readlines()

sequences = {}

for line in lines:
    label, string = line.split('\t')
    if label in sequences:
        sequences[label].append(string.strip())
    else:
        sequences[label] = [string.strip()]

97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
literature = {
    'Amel':        [],
    'CSF1P0':      ['AGAT'],
    'D10S1248':    ['GGAA'],
    'D12S391':     ['AGAT', 'AGAC'],
    'D13S317':     ['TATC'],
    'D16S539':     ['GATA'],
    'D18S51':      ['GAAA'],
    'D19S433':     ['AAGG'],
    'D1S1656':     ['TAGA', 'TG'],
    'D21S11':      ['TCTA', 'TCTG'],
    'D22S1045':    ['ATT'],
    'D2S1338':     ['TGCC', 'TTCC'],
    'D2S441':      ['TCTA'],
    'D3S1358':     ['AGAT', 'TCTA'],
    'D5S818':      ['AGAT'],
    'D7S820':      ['GATA'],
    'D8S1179':     ['TATC'],
    'FGA':         ['TTTC', 'CTTT', 'TTCC'],
    'PentaD':      ['AAAGA'],
    'PentaE':      ['AAAGA'],
    'TH01':        ['TCAT'],
    'TPOX':        ['AATG'],
    'vWA':         ['TCTA', 'TCTG', 'TCCA'],
    'DYS391':      ['TCTA']
}


jkvis's avatar
Testing    
jkvis committed
125
#select = 'D13S317'
126
#unit_list = literature[select]
jkvis's avatar
Testing    
jkvis committed
127
#reference = sequences[select][0]
128
129
130
131
#sample = sequences[select][14]
#description, rep_start, rep_end = describe_repeats(reference, sample, unit_list)
#print '{}({}_{}):l.{}'.format(select, rep_start, rep_end, description)

jkvis's avatar
Testing    
jkvis committed
132
133
134


for sequence in sequences:
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
#    best = 0
#    for string in sequences[sequence]:
#        repeats = short_sequence_repeat_extractor(string, min_length)
#        score = 0
#        for repeat in repeats:
#            if repeat.count + 1 >= min_count:
#                score += (repeat.end - repeat.start) * (repeat.end - repeat.start) * (repeat.count + 1)
#        if score > best:
#            reference = string
#            best = score

#    repeats = short_sequence_repeat_extractor(reference, min_length)
#    units = {}
#    for repeat in repeats:
#        if repeat.count + 1 >= min_count:
#            units[reference[repeat.start:repeat.end]] = repeat.count + 1
#    unit_list = []
#    for unit in units:
#        unit_list.append(unit)

    unit_list = literature[sequence]
jkvis's avatar
Testing    
jkvis committed
156
157
158
159

    reference = sequences[sequence][0]
    print sequence + ':',
    print reference
160
    if len(unit_list) > 0:
jkvis's avatar
Testing    
jkvis committed
161
162
163
164
165
166
        print 'repeat units:', unit_list
    else:
        print 'repeat units: []'
    for string in sequences[sequence]:
        rep_start = 1
        rep_end = len(reference)
167
        if len(unit_list) > 0:
jkvis's avatar
Testing    
jkvis committed
168
169
170
171
172
            description, rep_start, rep_end = describe_repeats(reference, string, unit_list)
        else:
            description = describe_dna(reference, string)
        print '{}({}_{}):l.{}'.format(sequence, rep_start, rep_end, description)
    print
jkvis's avatar
jkvis committed
173

jkvis's avatar
jkvis committed
174