repeat-extractor.py 3.6 KB
Newer Older
jkvis's avatar
jkvis committed
1
2
3
4
5
6
7
#!/usr/bin/env python

from __future__ import unicode_literals

from extractor import *


jkvis's avatar
Testing    
jkvis committed
8
9
10
#ref = 'AGCTGTGGGAGGGAGCCAGTGGATTTGGAAACAGAAATGGCTTGGCCTTGCCTGCCTGCCTGCCTGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCCTCCTGCAATCCTTTAACTTACTGAATAACTCATGATTATGGGCCACCTGCAGGTACCATGCTAG'
#alt = 'AGCTGTGGGAGGGAGCCAGTGGATTTGGAAACAGAAATGGCTTCGCCTTGCCTGCCTGCCTGCCTGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCGTCCTTCCTTCCCTCCTGCAATCCTATAACTTACTGAATAACTCATGATTATGGGCCACCTGCAGGTACCATGCTAG'
#units = ['TCCT', 'GCCT']
jkvis's avatar
jkvis committed
11

jkvis's avatar
Testing    
jkvis committed
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
#print 'version:', extractor.VERSION

#describe_repeats(ref, alt, units)

THRESHOLD = 10000


class Repeat(object):
    """
    Simple repeat structure.
    """
    __slots__ = ['start', 'end', 'count']

    def __init__(self, start, end, count=0):
        """
        Initialize the repeat structure.

        :arg integer start: Start position of the repeat.
        :arg integer end: End position of the repeat.
        :arg integer count: Number of repeats.
        """
        self.start = start
        self.end = end
        self.count = count


def short_sequence_repeat_extractor(string, min_length=1):
    """
    Extract the short tandem repeat structure from a string.

    :arg string string: The string.
    :arg integer min_length: Minimum length of the repeat structure.
    """
    length = len(string)

    k_max = length // 2 + 1
    if k_max > THRESHOLD:
        k_max = THRESHOLD // 2

    repeats = []

    i = 0
    last_repeat = i
    while i < length:
        max_count = 0
        max_k = 1
        for k in range(min_length, k_max):
            count = 0
            for j in range(i + k, length - k + 1, k):
                if string[i:i + k] != string[j:j + k]:
                    break
                count += 1

            if count > 0 and count >= max_count:
                max_count = count
                max_k = k

        if max_count > 0:
            if last_repeat < i:
                repeats.append(Repeat(last_repeat, i))
            repeats.append(Repeat(i, i + max_k, max_count))
            last_repeat = i + max_k * (max_count + 1)

        i += max_k * (max_count + 1)

    if last_repeat < i:
        repeats.append(Repeat(last_repeat, i))

    return repeats


min_count = 3
84
min_length = 3
jkvis's avatar
Testing    
jkvis committed
85
86
87
88
89
90
91
92
93
94
95
96
97

with open('strlist.txt', 'r') as infile:
    lines = infile.readlines()

sequences = {}

for line in lines:
    label, string = line.split('\t')
    if label in sequences:
        sequences[label].append(string.strip())
    else:
        sequences[label] = [string.strip()]

98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
#select = 'Amel'
#unit_list = ['TATC']
#reference = sequences[select][0]
#sample = sequences[select][0]
#description = describe_repeats(reference, sample, unit_list)
#print 'l.{}'.format(description)


for sequence in sequences:
    best = 0
    for string in sequences[sequence]:
        repeats = short_sequence_repeat_extractor(string, min_length)
        score = 0
        for repeat in repeats:
            if repeat.count + 1 >= min_count:
                score += (repeat.end - repeat.start) * (repeat.end - repeat.start) * (repeat.count + 1)
        if score > best:
            reference = string
            best = score

    repeats = short_sequence_repeat_extractor(reference, min_length)
    units = {}
    for repeat in repeats:
        if repeat.count + 1 >= min_count:
            units[reference[repeat.start:repeat.end]] = repeat.count + 1
    unit_list = []
    for unit in units:
        unit_list.append(unit)

    print sequence, unit_list
    reference = sequences[sequence][0]
    for string in sequences[sequence]:
        description = describe_repeats(reference, string, unit_list)
        print 'l.{}'.format(description)
    print
jkvis's avatar
jkvis committed
133