repeat-extractor.py 3.6 KB
Newer Older
jkvis's avatar
jkvis committed
1 2 3 4 5 6 7
#!/usr/bin/env python

from __future__ import unicode_literals

from extractor import *


jkvis's avatar
Testing  
jkvis committed
8 9 10
#ref = 'AGCTGTGGGAGGGAGCCAGTGGATTTGGAAACAGAAATGGCTTGGCCTTGCCTGCCTGCCTGCCTGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCCTCCTGCAATCCTTTAACTTACTGAATAACTCATGATTATGGGCCACCTGCAGGTACCATGCTAG'
#alt = 'AGCTGTGGGAGGGAGCCAGTGGATTTGGAAACAGAAATGGCTTCGCCTTGCCTGCCTGCCTGCCTGCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCGTCCTTCCTTCCCTCCTGCAATCCTATAACTTACTGAATAACTCATGATTATGGGCCACCTGCAGGTACCATGCTAG'
#units = ['TCCT', 'GCCT']
jkvis's avatar
jkvis committed
11

jkvis's avatar
Testing  
jkvis committed
12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83
#print 'version:', extractor.VERSION

#describe_repeats(ref, alt, units)

THRESHOLD = 10000


class Repeat(object):
    """
    Simple repeat structure.
    """
    __slots__ = ['start', 'end', 'count']

    def __init__(self, start, end, count=0):
        """
        Initialize the repeat structure.

        :arg integer start: Start position of the repeat.
        :arg integer end: End position of the repeat.
        :arg integer count: Number of repeats.
        """
        self.start = start
        self.end = end
        self.count = count


def short_sequence_repeat_extractor(string, min_length=1):
    """
    Extract the short tandem repeat structure from a string.

    :arg string string: The string.
    :arg integer min_length: Minimum length of the repeat structure.
    """
    length = len(string)

    k_max = length // 2 + 1
    if k_max > THRESHOLD:
        k_max = THRESHOLD // 2

    repeats = []

    i = 0
    last_repeat = i
    while i < length:
        max_count = 0
        max_k = 1
        for k in range(min_length, k_max):
            count = 0
            for j in range(i + k, length - k + 1, k):
                if string[i:i + k] != string[j:j + k]:
                    break
                count += 1

            if count > 0 and count >= max_count:
                max_count = count
                max_k = k

        if max_count > 0:
            if last_repeat < i:
                repeats.append(Repeat(last_repeat, i))
            repeats.append(Repeat(i, i + max_k, max_count))
            last_repeat = i + max_k * (max_count + 1)

        i += max_k * (max_count + 1)

    if last_repeat < i:
        repeats.append(Repeat(last_repeat, i))

    return repeats


min_count = 3
84
min_length = 3
jkvis's avatar
Testing  
jkvis committed
85 86 87 88 89 90 91 92 93 94 95 96 97

with open('strlist.txt', 'r') as infile:
    lines = infile.readlines()

sequences = {}

for line in lines:
    label, string = line.split('\t')
    if label in sequences:
        sequences[label].append(string.strip())
    else:
        sequences[label] = [string.strip()]

98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
#select = 'Amel'
#unit_list = ['TATC']
#reference = sequences[select][0]
#sample = sequences[select][0]
#description = describe_repeats(reference, sample, unit_list)
#print 'l.{}'.format(description)


for sequence in sequences:
    best = 0
    for string in sequences[sequence]:
        repeats = short_sequence_repeat_extractor(string, min_length)
        score = 0
        for repeat in repeats:
            if repeat.count + 1 >= min_count:
                score += (repeat.end - repeat.start) * (repeat.end - repeat.start) * (repeat.count + 1)
        if score > best:
            reference = string
            best = score

    repeats = short_sequence_repeat_extractor(reference, min_length)
    units = {}
    for repeat in repeats:
        if repeat.count + 1 >= min_count:
            units[reference[repeat.start:repeat.end]] = repeat.count + 1
    unit_list = []
    for unit in units:
        unit_list.append(unit)

    print sequence, unit_list
    reference = sequences[sequence][0]
    for string in sequences[sequence]:
        description = describe_repeats(reference, string, unit_list)
        print 'l.{}'.format(description)
    print
jkvis's avatar
jkvis committed
133