Commit bf2a496b authored by Peter van 't Hof's avatar Peter van 't Hof

Fixed test

parent 441b74ac
......@@ -2,7 +2,7 @@
# Organism name: Ageratum yellow vein betasatellite (viruses)
# Taxid: 185750
# BioProject: PRJNA14444
# Submitter: NCBI
# Submitter: Stanley J., Department of Virus Research, John Innes Centre, Norwich Research Park, Colney, Norwich, NR4 7UH, UNITED KINGDOM
# Date: 2000-6-14
# Assembly type: n/a
# Release type: major
......
>gi|18702122|ref|NC_003403.1| Ageratum yellow vein virus-associated DNA beta, complete genome
>NC_003403.1 Ageratum yellow vein virus-associated DNA beta, complete genome
ACCGGTGGCGAGCGGGGAATTTGGGTTCCAGGTGGGACCCACACCTGGAACAGCCTGGAAAGAACGTGAG
TGGGCCAAATAAGTGGGCCGTTGAATTGGGCTTTTTATTCAAAACTATCTCAAATTTACGAAGCCCATTA
TTATTCATTTGAGAAAAATTACATTAAACATAGTCCGTATAAATATACATTTATACGGTTACATTCTTGT
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment