diff --git a/lightmotif/src/pwm.rs b/lightmotif/src/pwm.rs index b1f6fc1f6f33e4627929f1c56bfabda97336cb8d..c4e3d5e9efa253e8fd9cb87870ef9262419d4a7b 100644 --- a/lightmotif/src/pwm.rs +++ b/lightmotif/src/pwm.rs @@ -24,9 +24,15 @@ macro_rules! matrix_traits { impl<A: Alphabet> $mx<A> { /// The raw data storage for the matrix. #[inline] - pub fn matrix(&self) -> &DenseMatrix<$t, A::K> { + pub const fn matrix(&self) -> &DenseMatrix<$t, A::K> { &self.data } + + /// The length of the motif encoded in this matrix. + #[inline] + pub const fn len(&self) -> usize { + self.data.rows() + } } impl<A: Alphabet> AsRef<$mx<A>> for $mx<A> { @@ -93,12 +99,6 @@ impl<A: Alphabet> CountMatrix<A> { // } } - /// The length of the motif encoded in this count matrix. - #[inline] - pub const fn len(&self) -> usize { - self.data.rows() - } - /// Create a new count matrix from the given sequences. /// /// # Errors @@ -239,12 +239,6 @@ impl<A: Alphabet> FrequencyMatrix<A> { } } - /// The length of the motif encoded in this frequency matrix. - #[inline] - pub const fn len(&self) -> usize { - self.data.rows() - } - /// Create a new frequency matrix. /// /// The matrix must contain frequency data, i.e. rows should all sum to 1 @@ -341,12 +335,6 @@ impl<A: Alphabet> WeightMatrix<A> { Self { background, data } } - /// The length of the motif encoded in this weight matrix. - #[inline] - pub const fn len(&self) -> usize { - self.data.rows() - } - /// The background frequencies of the position weight matrix. #[inline] pub fn background(&self) -> &Background<A> { @@ -455,12 +443,6 @@ impl<A: Alphabet> ScoringMatrix<A> { Self { background, data } } - /// The length of the motif encoded in this scoring matrix. - #[inline] - pub const fn len(&self) -> usize { - self.data.rows() - } - /// The background frequencies of the position weight matrix. #[inline] pub fn background(&self) -> &Background<A> { @@ -520,6 +502,37 @@ impl<A: Alphabet> ScoringMatrix<A> { } score } + + /// Get a discrete matrix from this position-specific scoring matrix. + pub fn to_discrete(&self) -> DiscreteMatrix<A> { + let max_score = self.max_score(); + let offsets = self + .matrix() + .iter() + .map(|row| { + row[..A::K::USIZE - 1] + .iter() + .min_by(|x, y| x.partial_cmp(y).unwrap()) + .unwrap() + }) + .cloned() + .collect::<Vec<f32>>(); + let offset = offsets.iter().sum::<f32>(); + let factor = (max_score - offset) / (u8::MAX as f32); + let pssm = self.matrix(); + let mut data = DenseMatrix::new(self.len()); + for i in 0..data.rows() { + for j in 0..data.columns() { + data[i][j] = ((pssm[i][j] - offsets[i]) / factor).ceil() as u8; + } + } + DiscreteMatrix { + data, + factor, + offsets, + offset, + } + } } impl<A: Alphabet> From<WeightMatrix<A>> for ScoringMatrix<A> { @@ -529,3 +542,90 @@ impl<A: Alphabet> From<WeightMatrix<A>> for ScoringMatrix<A> { } matrix_traits!(ScoringMatrix, f32); + +// --- DiscreteMatrix ---------------------------------------------------------- + +/// A position-specific scoring matrix discretized over `u8::MIN..u8::MAX`. +/// +/// # Note +/// The discretization is done by rounding the error *up*, so that the scores +/// computed through a discrete matrix are over an *over*-estimation of the +/// actual scores. This allows for the fast scanning for candidate positions, +/// which have then to be scanned again with the full PSSM to compute the real +/// scores. +/// +/// # Example +/// ``` +/// # use lightmotif::*; +/// # let counts = CountMatrix::<Dna>::from_sequences( +/// # ["GTTGACCTTATCAAC", "GTTGATCCAGTCAAC"] +/// # .into_iter() +/// # .map(|s| EncodedSequence::encode(s).unwrap()), +/// # ) +/// # .unwrap(); +/// # let pssm = counts.to_freq(0.1).to_scoring(None); +/// # let seq = "ATGTCCCAACAACGATACCCCGAGCCCATCGCCGTCATCGGCTCGGCATGCAGATTCCCAGGCG"; +/// # let mut striped = EncodedSequence::encode(seq).unwrap().to_striped(); +/// // Create a `DiscreteMatrix` from a `ScoringMatrix` +/// let discrete = pssm.to_discrete(); +/// +/// // The discrete scores are always higher than the real scores. +/// for j in 0..seq.len() - pssm.len() + 1 { +/// let score_f32 = pssm.score_position(&striped, 1); +/// let score_u8 = discrete.unscale(discrete.score_position(&striped, 1)); +/// assert!(score_u8 >= score_f32); +/// } +/// ``` +#[derive(Clone, Debug, PartialEq)] +pub struct DiscreteMatrix<A: Alphabet> { + data: DenseMatrix<u8, A::K>, + factor: f32, + offsets: Vec<f32>, + offset: f32, +} + +impl<A: Alphabet> DiscreteMatrix<A> { + /// Compute the score for a single sequence position. + pub fn score_position<S, C>(&self, seq: S, pos: usize) -> u8 + where + C: StrictlyPositive, + S: AsRef<StripedSequence<A, C>>, + { + let mut score = 0; + let s = seq.as_ref(); + for (j, row) in self.data.iter().enumerate() { + score += row[s[pos + j].as_index()] + } + score + } + + /// Scale the given score to an integer score using the matrix scale. + /// + /// # Note + /// This function rounds down the final score, and is suitable to translate + /// an `f32` score threshold to a `u8` score threshold. + #[inline] + pub fn scale(&self, score: f32) -> u8 { + ((score - self.offset) / self.factor).floor() as u8 + } + + /// Unscale the given integer score into a score using the matrix scale. + #[inline] + pub fn unscale(&self, score: u8) -> f32 { + (score as f32) * self.factor + self.offset + } +} + +impl<A: Alphabet> From<ScoringMatrix<A>> for DiscreteMatrix<A> { + fn from(value: ScoringMatrix<A>) -> Self { + Self::from(&value) + } +} + +impl<A: Alphabet> From<&ScoringMatrix<A>> for DiscreteMatrix<A> { + fn from(s: &ScoringMatrix<A>) -> Self { + s.to_discrete() + } +} + +matrix_traits!(DiscreteMatrix, u8);