Commit 9565c837 authored by Hoogenboom, Jerry's avatar Hoogenboom, Jerry

Fixed Samplevis allele selection glitch, removed TSSV -L

Fixed:
* Fixed a glitch in Samplevis HTML visualisations, where it would fail
  to correctly maintain the user-(de)selected alleles when switching
  Split Markers on or off.

Removed:
* Removed -L/--check-length option from the TSSV tool, because it had no
  effect. Instead, the TSSV tool will always enforce the expected allele
  lengths specified in the library file. Behaviour has not changed.
parent a4a5d02e
......@@ -431,9 +431,9 @@ def add_arguments(parser):
"stutter (default: %(default)s)")
filtergroup.add_argument('-r', '--min-report', metavar="N", type=float,
default=_DEF_MIN_REPORT,
help="sequence are only annotated as a stutter of some other sequence "
"if the expected number of stutter occurances of this other "
"sequence is above this value (default: %(default)s)")
help="a sequence is only annotated as a stutter of some other "
"sequence if the expected number of stutter occurances of this "
"other sequence is above this value (default: %(default)s)")
add_sequence_format_args(parser, "tssv", True) # Force tssv seqs.
#add_arguments
......
......@@ -161,14 +161,11 @@ def add_arguments(parser):
default=_DEF_MINIMUM,
help="report only sequences with this minimum number of reads "
"(default: %(default)s)")
filtergroup.add_argument("-L", "--check-length", action="store_true",
help="if specified, enforce the minimum and maximum allele lengths "
"specified in the library (FDSTools library format only)")
filtergroup.add_argument("-A", "--aggregate-filtered", action="store_true",
help="if specified, sequences that have been filtered (as per the "
"-a/--minimum and -L/--check-length options, or with ambiguous "
"bases) will be aggregated per marker and reported as 'Other "
"sequences'")
"-a/--minimum option, the expected_allele_length section in the "
"library file, as well as all sequences with ambiguous bases) "
"will be aggregated per marker and reported as 'Other sequences'")
filtergroup.add_argument("-M", "--missing-marker-action", metavar="ACTION",
choices=("include", "exclude", "halt"),
default="include",
......
......@@ -692,6 +692,7 @@ function parse(maintainSelection){
datum._prev = null;
sa._id = datum._id;
sa.aggr._id = datum.aggr._id;
sa.rank = datum.rank;
sa.thedatum = null;
datum.thedatum = null;
var equal = vg.util.equal(sa, datum);
......
......@@ -10,7 +10,14 @@ To-do:
next chunk through "window.setTimeout(nextChunkFunction);". The page will
be repainted between each chunk. One major issue with this is that user
input events may get scheduled between the chunks.
* Add 'Save page' button that also saves the alleles clicked by the user.
* Add options to set the Table filtering options in the Vis tool.
* Additions needed for publication:
* Check whether there is a difference between filtering short artefacts in
TSSV vs having BGEstimate/BGCorrect filter them.
* vWA GATGGAT
* D2S441 GGCGCCCCAGCATTCTAACAAGGAATGTGGGTGCTGGGAGCCAGGAACCTGGACAAAAACCAAAACGCATATCC
* D2S441 AGCACCCCAGCATTCTAACAAGCAATGTAGGCATTGGGAGCCAGGAGCCTGGACAAAATCCAATACGCATATCC
* [If not too difficult to implement] BGEstimate should start with homozygous
samples and add heterozygous samples later to optimise correction.
* Summary statistics for BGEstimate based on top N genotypes per marker,
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment