Commit 6f767e39 authored by Laros's avatar Laros
Browse files

Added lecture.

parent b25e6e74
../../submodules/presentation/Makefile
\ No newline at end of file
../../submodules/presentation-pics/pics/NovaSeq6000.jpg
\ No newline at end of file
../../submodules/presentation/beamerthemelumc.sty
\ No newline at end of file
\documentclass[slidestop]{beamer}
\author{Jeroen F.J. Laros}
\title{Artificial Intelligence in Genetics}
\providecommand{\mySubTitle}{Requirements and examples}
\providecommand{\myConference}{ML/AI meeting LUMC - LIACS}
\providecommand{\myDate}{27-06-2018}
\providecommand{\myGroup}{Research Software Engineering}
\providecommand{\myDepartment}{Department of Human Genetics}
\providecommand{\myCenter}{Center for Human and Clinical Genetics}
\usetheme{lumc}
\usepackage{fancyvrb}
\begin{document}
% This disables the \pause command, handy in the editing phase.
%\renewcommand{\pause}{}
% Make the title slide.
\makeTitleSlide{\includegraphics[height=2.7cm]{sanger_trace}}
% First page of the presentation.
\section{Introduction}
\makeTableOfContents
\section{Sequencing}
\subsection{From DNA to sequences}
\begin{pframe}
\begin{minipage}[t]{0.47\textwidth}\begin{figure}[]
\begin{center}
\includegraphics[width=\textwidth]{NovaSeq6000}
\end{center}
\caption{Illumina NovaSeq 6000.}
\end{figure}
\end{minipage}
\hfill
\begin{minipage}[t]{0.47\textwidth}
\begin{Verbatim}[fontsize=\tiny]
@K0187:120:GFLBXX:1:1101:2950:1191 1:N:0:CTTGAG
TTAGGAAATAATAAATTGTAGTTTTTTTTATGATTTGGTTGAATTGATT
+
AAAFFJJJJJJ-AJFFFJ-FF<F<JJJAFJFFFJAFJJ<-FFFA<FFAA
@K0187:120:GFLBXX:1:1101:7710:1209 1:N:0:CTTGAG
GTCCACTAGAACTTGTAGAGCTGGAACCAACTGATTTGCAAAAGCAAAA
+
AA-FFFJAAAF-FFAJJJFJJJ--AFFJJFFJJFAFA-FJJJJFJJJJF
@K0187:120:GFLBXX:1:1101:17269:1209 1:N:0:CTTGAG
GTACTTGATGAATATTTACTAAAGAATGGAAGGAAAAAAGAAAGAAGGA
+
AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
@K0187:120:GFLBXX:1:1101:28067:1209 1:N:0:CTTGAG
TGGGTGTGTTAAGAATGACATTCAACGCAGTCTCTTTACCACCTCCCCA
+
AAA-FJFJFJFAJJJJFFJFAFJJJJFFJFAJJJJFFJJJAAJ7FFJJA
@K0187:120:GFLBXX:1:1101:1367:1226 1:N:0:CTTGAG
NTAGGTGTAAAAACATGATCATCGAAGAGACAAGAAATAGAACGTATTT
+
#AAFFFJFJJJJJJJJJJJJJJJJFJFJFAFJJJJJJJJJJJJJJJAFF
@K0187:120:GFLBXX:1:1101:8410:1226 1:N:0:CTTGAG
AGTGAGACCCTCTCTCTAAAAAGAAAAAAGAAAAAAAATTATGATGTTT
+
AAFAFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
\end{Verbatim}
\end{minipage}
\end{pframe}
\section{Background}
\subsection{Current status and requirements}
\begin{pframe}
We work a lot with \emph{sequences} (over an alphabet of four letters).
\begin{itemize}
\item Alignment / variant calling.
\item \textit{De novo} assembly / gene prediction.
\item $k$-mer profiling.
\end{itemize}
\bigskip
For most of these problems, there are efficient deterministic algorithms
available, with the exception of \textit{de novo} assembly.
\bigskip
\pause
We have a strong need for being able to \emph{explain} results.
\begin{itemize}
\item Techniques like decision trees.
\item Optimisation of procedures, which are in the end very clear.
\end{itemize}
\end{pframe}
\section{Farmacogenetics}
\subsection{Personalised Medicine}
\begin{pframe}
Predict drug response from patient genetics.
\begin{itemize}
\item The current gold standard $r^2 \approx 0.55$.
\end{itemize}
\bigskip
Over the years, we have collected quite some data.
\begin{itemize}
\item High quality genotypes from sequencing.
\item $550$ \textit{in vivo} metabolite measurements.
\end{itemize}
\bigskip
\pause
The approach, a neural network with:
\begin{itemize}
\item Binary vectors indicating presence/absence of genetic features (two
sets of inputs due to ploidy) as input.
\item Predicted metabolite measurement (scalar) as output.
\end{itemize}
\vfill
\permfoot{Guy Allard}
\end{pframe}
\begin{pframe}
\vspace{-0.5cm}
\begin{figure}[]
\begin{center}
\includegraphics[height=0.8\textheight]{pm_network}
\end{center}
\caption{Model architecture.}
\end{figure}
\end{pframe}
\begin{pframe}
Techniques and libraries:
\begin{itemize}
\item Model constructed and trained using TensorFlow.
\item Allele submodules share the same layers (same model).
\end{itemize}
\begin{figure}[]
\begin{center}
\includegraphics[width=\textwidth]{allele}
\end{center}
\caption{Visualising contribution of features.}
\end{figure}
\vspace{-0.5cm}
Results:
\begin{itemize}
\item $10$-fold cross validation, $r^2 \approx 0.7$.
\item Allele submodule ($p_{a1}$) can be interrogated and the effects of
genetic features explored.
\end{itemize}
\vfill
\permfoot{Guy Allard}
\end{pframe}
%\section{Single cell sequencing}
%\subsection{???}
%\begin{pframe}
% Slides here.
%\end{pframe}
\section{Clinical Genetics}
% Use case 2: Variant classification for the purposes of clinical diagnostics
% in the clinic is currently a tedious manual task. Clinicians have to go
% through lists of dozens of variants, and manually curate them. This task can
% take up to several hours per patient. It would greatly speed up diagnosis if
% the clinical could have an automated ranking, which would select the best
% candidate hit first. As variants are automatically annotated with dozens of
% annotation fields, we reasoned we could very well use some machine learnings
% methods for this purpose. Our first attempt was to use a decision tree, or
% ensemble of decision trees, as this is a white-box model. A confounding
% factor here is that the vast majority of variants (millions) are
% unclassified, with just a few thousand classified variants. This is currently
% an ongoing project in cooperation with the ICT department.
\subsection{Variant classification}
\begin{pframe}
From the tens of thousands of genetic variants, we are only interested in the
one that causes a disease.
\begin{itemize}
\item Filtering strategies narrow it down to a few dozens of variants.
\item Manual curation takes a few hours per patient.
\end{itemize}
\bigskip
Can this be done automatically?
\bigskip
\pause
Challenges:
\begin{itemize}
\item Make the selection explainable (decision trees).
\item Large number of unclassified variants.
\end{itemize}
\vfill
\permfoot{Sander Bollen}
\end{pframe}
% Use case 1: Classifying reads to the lab protocol they were sequenced with.
% Within the department of clinical genetics, several lab protocols are used
% for the generation of Next-Generation Sequencing. Two different capture kits
% are used (WES and IDP), as well as two different sequencers (Hiseq4000 and
% NextSeq500). Downstream analysis can be slightly different for each protocol
% used, which requires run metadata to be correct. Unfortunately, this is not
% always the case, and a way of validating the input metadata is required. We
% have used machine learning to accomplish this task. Briefly, k-mers were
% counted for each NGS read, after which an SVM was trained on the dataset of
% several hundred thousand reads. Nextseq reads separate well from all other
% classes, but both hiseq4000 classes were more difficult to separate. This
% method may also be useful for other purposes where separating reads into
% classes is required, e.g. separating virus from host reads.
\subsection{Detecting lab protocol from raw data}
\begin{pframe}
Differences in preprocessing (lab) steps:
\begin{itemize}
\item Capture kit (selection of part of the genome).
\item Different sequencers.
\end{itemize}
\bigskip
Validation of this metadata is needed because downstream analysis depends on
it.
\bigskip
\pause
Approach:
\begin{itemize}
\item $k$-mer counts of every read.
\item Training on over $100,\!000$ examples:
\begin{itemize}
\item SVM.
\item Random forest.
\end{itemize}
\end{itemize}
\vfill
\permfoot{Sander Bollen}
\end{pframe}
\begin{pframe}
Distinguishing sequencing platform works very well.
\begin{figure}[]
\begin{center}
\includegraphics[width=0.5\textwidth]{svm_error}
\hfill
\includegraphics[width=0.5\textwidth]{random_forest_error}
\end{center}
\caption{Overall error (left: SVM, right: Random forest).}
\end{figure}
Potential applications in contamination and \emph{infection} detection.
\vfill
\permfoot{Sander Bollen}
\end{pframe}
% Make the acknowledgements slide.
\makeAcknowledgementsSlide{
\begin{tabular}{l}
Guy Allard\\
%Peter van 't Hof\\
Sander Bollen\\
Leon Mei\\
\end{tabular}
}
\end{document}
../../submodules/presentation/logos
\ No newline at end of file
<svg version="1.1" viewBox="0.0 0.0 960.0 540.0" fill="none" stroke="none" stroke-linecap="square" stroke-miterlimit="10" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns="http://www.w3.org/2000/svg"><clipPath id="p.0"><path d="m0 0l960.0 0l0 540.0l-960.0 0l0 -540.0z" clip-rule="nonzero"/></clipPath><g clip-path="url(#p.0)"><path fill="#ffffff" d="m0 0l960.0 0l0 540.0l-960.0 0z" fill-rule="evenodd"/><path fill="#eeeeee" d="m52.748043 67.5089l0 0c0 -13.590977 11.017662 -24.608643 24.608639 -24.608643l795.44415 0c6.5266113 0 12.785889 2.5926895 17.40094 7.2077065c4.61499 4.615013 7.2077026 10.874317 7.2077026 17.400936l0 412.13705c0 13.590973 -11.0177 24.608643 -24.608643 24.608643l-795.44415 0c-13.590977 0 -24.608639 -11.01767 -24.608639 -24.608643z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m52.748043 67.5089l0 0c0 -13.590977 11.017662 -24.608643 24.608639 -24.608643l795.44415 0c6.5266113 0 12.785889 2.5926895 17.40094 7.2077065c4.61499 4.615013 7.2077026 10.874317 7.2077026 17.400936l0 412.13705c0 13.590973 -11.0177 24.608643 -24.608643 24.608643l-795.44415 0c-13.590977 0 -24.608639 -11.01767 -24.608639 -24.608643z" fill-rule="evenodd"/><path fill="#d9d2e9" d="m348.13123 312.5151l0 0c0 -18.879517 15.304901 -34.184387 34.184418 -34.184387l173.93039 0c9.066284 0 17.76123 3.6015625 24.172058 10.01236c6.4107666 6.4108276 10.012329 15.105774 10.012329 24.172028l0 136.73355c0 18.879517 -15.304871 34.184418 -34.184387 34.184418l-173.93039 0c-18.879517 0 -34.184418 -15.304901 -34.184418 -34.184418z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m348.13123 312.5151l0 0c0 -18.879517 15.304901 -34.184387 34.184418 -34.184387l173.93039 0c9.066284 0 17.76123 3.6015625 24.172058 10.01236c6.4107666 6.4108276 10.012329 15.105774 10.012329 24.172028l0 136.73355c0 18.879517 -15.304871 34.184418 -34.184387 34.184418l-173.93039 0c-18.879517 0 -34.184418 -15.304901 -34.184418 -34.184418z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m394.1106 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792297 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m394.1106 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792297 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m414.15784 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792297 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m414.15784 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792297 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m434.20508 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892761 0.63049316 4.4765015 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792297 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m434.20508 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892761 0.63049316 4.4765015 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792297 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m454.25232 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.330719 -5.984253l0 0c1.6789856 0 3.2892456 0.63049316 4.476471 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.4963684 0 -6.330719 -2.6792297 -6.330719 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m454.25232 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.330719 -5.984253l0 0c1.6789856 0 3.2892456 0.63049316 4.476471 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.4963684 0 -6.330719 -2.6792297 -6.330719 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m474.2861 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792297 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m474.2861 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792297 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m494.33334 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792297 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m494.33334 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222839 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792297 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m514.38055 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3307495 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4764404 1.7527466c1.1872559 1.1222839 1.854248 2.6443787 1.854248 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.496399 0 -6.3307495 -2.6792297 -6.3307495 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m514.38055 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3307495 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4764404 1.7527466c1.1872559 1.1222839 1.854248 2.6443787 1.854248 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.496399 0 -6.3307495 -2.6792297 -6.3307495 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m434.2047 410.90552l0 0c0 -3.3050232 2.834381 -5.984253 6.330719 -5.984253l0 0c1.6790161 0 3.2892456 0.63046265 4.4765015 1.7527466c1.1872253 1.1222534 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3049927 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.330719 -2.6792603 -6.330719 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m434.2047 410.90552l0 0c0 -3.3050232 2.834381 -5.984253 6.330719 -5.984253l0 0c1.6790161 0 3.2892456 0.63046265 4.4765015 1.7527466c1.1872253 1.1222534 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3049927 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.330719 -2.6792603 -6.330719 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m454.25198 410.90552l0 0c0 -3.3050232 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63046265 4.4765015 1.7527466c1.1872253 1.1222534 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3049927 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792603 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m454.25198 410.90552l0 0c0 -3.3050232 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63046265 4.4765015 1.7527466c1.1872253 1.1222534 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3049927 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792603 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m474.29922 410.90552l0 0c0 -3.3050232 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63046265 4.4765015 1.7527466c1.1872253 1.1222534 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3049927 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792603 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m474.29922 410.90552l0 0c0 -3.3050232 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63046265 4.4765015 1.7527466c1.1872253 1.1222534 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3049927 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792603 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m494.34647 410.90552l0 0c0 -3.3050232 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63046265 4.4765015 1.7527466c1.1872253 1.1222534 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3049927 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792603 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m494.34647 410.90552l0 0c0 -3.3050232 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63046265 4.4765015 1.7527466c1.1872253 1.1222534 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3049927 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.3306885 -2.6792603 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m534.4278 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3307495 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1871948 1.1222839 1.854187 2.6443787 1.854187 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.496399 0 -6.3307495 -2.6792297 -6.3307495 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m534.4278 362.5538l0 0c0 -3.3049927 2.8343506 -5.984253 6.3307495 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1871948 1.1222839 1.854187 2.6443787 1.854187 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.496399 0 -6.3307495 -2.6792297 -6.3307495 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m464.8035 458.55334l0 0c0 -3.3050232 2.8343506 -5.984253 6.330719 -5.984253l0 0c1.6789856 0 3.2892456 0.63049316 4.476471 1.7527466c1.1872559 1.1222534 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.4963684 0 -6.330719 -2.6792297 -6.330719 -5.984253z" fill-rule="evenodd"/><path stroke="#000000" stroke-width="3.0" stroke-linejoin="round" stroke-linecap="butt" d="m464.8035 458.55334l0 0c0 -3.3050232 2.8343506 -5.984253 6.330719 -5.984253l0 0c1.6789856 0 3.2892456 0.63049316 4.476471 1.7527466c1.1872559 1.1222534 1.8542175 2.6443787 1.8542175 4.2315063l0 0c0 3.3050232 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.4963684 0 -6.330719 -2.6792297 -6.330719 -5.984253z" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m440.53543 404.92126l-40.094482 -36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m440.53543 404.92126l-40.094482 -36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m460.58267 404.92126l-60.125977 -36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m460.58267 404.92126l-60.125977 -36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m480.6299 404.92126l-80.188965 -36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m480.6299 404.92126l-80.188965 -36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m500.67715 404.92126l-100.22046 -36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m500.67715 404.92126l-100.22046 -36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m420.48853 368.53806l20.031494 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m420.48853 368.53806l20.031494 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m420.4882 368.5433l40.094482 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m420.4882 368.5433l40.094482 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m420.48853 368.53806l60.126007 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m420.48853 368.53806l60.126007 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m420.48853 368.53806l80.188995 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m420.48853 368.53806l80.188995 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m440.53577 368.53806l0 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m440.53577 368.53806l0 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m440.53577 368.53806l20.031494 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m440.53577 368.53806l20.031494 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m440.53577 368.53806l40.094513 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m440.53577 368.53806l40.094513 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m440.53577 368.53806l60.126007 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m440.53577 368.53806l60.126007 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m460.58304 368.53806l-20.063019 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m460.58304 368.53806l-20.063019 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m460.58304 368.53806l0 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m460.58304 368.53806l0 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m460.58304 368.53806l20.031494 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m460.58304 368.53806l20.031494 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m460.58304 368.53806l40.094482 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m460.58304 368.53806l40.094482 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m480.6168 368.53806l-40.094482 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m480.6168 368.53806l-40.094482 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m480.6168 368.53806l-20.031494 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m480.6168 368.53806l-20.031494 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m480.6168 368.53806l0 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m480.6168 368.53806l0 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m480.6168 368.53806l20.062988 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m480.6168 368.53806l20.062988 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m500.66403 368.53806l-60.125977 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m500.66403 368.53806l-60.125977 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m500.66403 368.53806l-40.094482 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m500.66403 368.53806l-40.094482 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m500.66403 368.53806l-20.031494 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m500.66403 368.53806l-20.031494 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m500.66403 368.53806l0 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m500.66403 368.53806l0 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m520.7113 368.53806l-80.188995 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m520.7113 368.53806l-80.188995 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m520.7113 368.53806l-60.126007 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m520.7113 368.53806l-60.126007 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m520.7113 368.53806l-40.094513 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m520.7113 368.53806l-40.094513 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m520.7113 368.53806l-20.031525 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m520.7113 368.53806l-20.031525 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m540.75854 368.53806l-100.22049 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m540.75854 368.53806l-100.22049 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m540.75854 368.53806l-80.188995 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m540.75854 368.53806l-80.188995 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m540.75854 368.53806l-60.126007 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m540.75854 368.53806l-60.126007 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m540.75854 368.53806l-40.094513 36.37796" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m540.75854 368.53806l-40.094513 36.37796" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m440.53543 416.88977l30.614166 35.685028" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m440.53543 416.88977l30.614166 35.685028" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m460.58267 416.88977l10.551178 35.685028" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m460.58267 416.88977l10.551178 35.685028" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m480.6299 416.88977l-9.480316 35.685028" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m480.6299 416.88977l-9.480316 35.685028" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m500.67715 416.88977l-29.543304 35.685028" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m500.67715 416.88977l-29.543304 35.685028" fill-rule="evenodd"/><path fill="#eeeeee" d="m418.01056 296.78955l27.433075 0l0 26.740173l-27.433075 0z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m418.01056 296.78955l27.433075 0l0 26.740173l-27.433075 0z" fill-rule="evenodd"/><path fill="#000000" d="m422.41388 315.33707l0 -11.484375l1.28125 0l0 1.078125q0.453125 -0.640625 1.015625 -0.953125q0.578125 -0.3125 1.390625 -0.3125q1.0625 0 1.875 0.546875q0.8125 0.546875 1.21875 1.546875q0.421875 0.984375 0.421875 2.171875q0 1.28125 -0.46875 2.296875q-0.453125 1.015625 -1.328125 1.5625q-0.859375 0.546875 -1.828125 0.546875q-0.703125 0 -1.265625 -0.296875q-0.546875 -0.296875 -0.90625 -0.75l0 4.046875l-1.40625 0zm1.265625 -7.296875q0 1.609375 0.640625 2.375q0.65625 0.765625 1.578125 0.765625q0.9375 0 1.609375 -0.796875q0.671875 -0.796875 0.671875 -2.453125q0 -1.59375 -0.65625 -2.375q-0.65625 -0.796875 -1.5625 -0.796875q-0.890625 0 -1.59375 0.84375q-0.6875 0.84375 -0.6875 2.4375z" fill-rule="nonzero"/><path fill="#000000" d="m434.56232 317.46207q-0.53125 0.453125 -1.015625 0.640625q-0.46875 0.171875 -1.015625 0.171875q-0.921875 0 -1.40625 -0.4375q-0.484375 -0.453125 -0.484375 -1.140625q0 -0.40625 0.171875 -0.734375q0.1875 -0.34375 0.484375 -0.546875q0.3125 -0.203125 0.6875 -0.3125q0.265625 -0.0625 0.828125 -0.140625q1.125 -0.125 1.671875 -0.3125q0 -0.203125 0 -0.25q0 -0.578125 -0.265625 -0.8125q-0.359375 -0.3125 -1.0625 -0.3125q-0.65625 0 -0.984375 0.234375q-0.3125 0.234375 -0.453125 0.8125l-0.921875 -0.125q0.125 -0.578125 0.40625 -0.9375q0.296875 -0.375 0.828125 -0.5625q0.546875 -0.203125 1.25 -0.203125q0.71875 0 1.15625 0.171875q0.4375 0.171875 0.640625 0.421875q0.21875 0.25 0.296875 0.640625q0.046875 0.234375 0.046875 0.859375l0 1.25q0 1.296875 0.0625 1.65625q0.0625 0.34375 0.234375 0.65625l-0.96875 0q-0.15625 -0.296875 -0.1875 -0.6875zm-0.078125 -2.078125q-0.515625 0.203125 -1.53125 0.34375q-0.578125 0.078125 -0.828125 0.1875q-0.234375 0.109375 -0.359375 0.3125q-0.125 0.1875 -0.125 0.4375q0 0.375 0.28125 0.625q0.28125 0.25 0.828125 0.25q0.53125 0 0.953125 -0.234375q0.421875 -0.234375 0.625 -0.65625q0.15625 -0.3125 0.15625 -0.9375l0 -0.328125zm5.6608887 2.765625l-0.9375 0l0 -5.96875q-0.34375 0.328125 -0.890625 0.65625q-0.546875 0.3125 -0.984375 0.46875l0 -0.90625q0.796875 -0.359375 1.375 -0.890625q0.59375 -0.53125 0.828125 -1.015625l0.609375 0l0 7.65625z" fill-rule="nonzero"/><path fill="#eeeeee" d="m497.48376 297.0533l27.433105 0l0 26.740143l-27.433105 0z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m497.48376 297.0533l27.433105 0l0 26.740143l-27.433105 0z" fill-rule="evenodd"/><path fill="#000000" d="m501.8871 315.6008l0 -11.484375l1.28125 0l0 1.078125q0.453125 -0.640625 1.015625 -0.953125q0.578125 -0.3125 1.390625 -0.3125q1.0625 0 1.875 0.546875q0.8125 0.546875 1.21875 1.546875q0.421875 0.984375 0.421875 2.171875q0 1.28125 -0.46875 2.296875q-0.453125 1.015625 -1.328125 1.5625q-0.859375 0.546875 -1.828125 0.546875q-0.703125 0 -1.265625 -0.296875q-0.546875 -0.296875 -0.90625 -0.75l0 4.046875l-1.40625 0zm1.265625 -7.296875q0 1.609375 0.640625 2.375q0.65625 0.765625 1.578125 0.765625q0.9375 0 1.609375 -0.796875q0.671875 -0.796875 0.671875 -2.453125q0 -1.59375 -0.65625 -2.375q-0.65625 -0.796875 -1.5625 -0.796875q-0.890625 0 -1.59375 0.84375q-0.6875 0.84375 -0.6875 2.4375z" fill-rule="nonzero"/><path fill="#000000" d="m514.0355 317.7258q-0.53125 0.453125 -1.015625 0.640625q-0.46875 0.171875 -1.015625 0.171875q-0.921875 0 -1.40625 -0.4375q-0.484375 -0.453125 -0.484375 -1.140625q0 -0.40625 0.171875 -0.734375q0.1875 -0.34375 0.484375 -0.546875q0.3125 -0.203125 0.6875 -0.3125q0.265625 -0.0625 0.828125 -0.140625q1.125 -0.125 1.671875 -0.3125q0 -0.203125 0 -0.25q0 -0.578125 -0.265625 -0.8125q-0.359375 -0.3125 -1.0625 -0.3125q-0.65625 0 -0.984375 0.234375q-0.3125 0.234375 -0.453125 0.8125l-0.921875 -0.125q0.125 -0.578125 0.40625 -0.9375q0.296875 -0.375 0.828125 -0.5625q0.546875 -0.203125 1.25 -0.203125q0.71875 0 1.15625 0.171875q0.4375 0.171875 0.640625 0.421875q0.21875 0.25 0.296875 0.640625q0.046875 0.234375 0.046875 0.859375l0 1.25q0 1.296875 0.0625 1.65625q0.0625 0.34375 0.234375 0.65625l-0.96875 0q-0.15625 -0.296875 -0.1875 -0.6875zm-0.078125 -2.078125q-0.515625 0.203125 -1.53125 0.34375q-0.578125 0.078125 -0.828125 0.1875q-0.234375 0.109375 -0.359375 0.3125q-0.125 0.1875 -0.125 0.4375q0 0.375 0.28125 0.625q0.28125 0.25 0.828125 0.25q0.53125 0 0.953125 -0.234375q0.421875 -0.234375 0.625 -0.65625q0.15625 -0.3125 0.15625 -0.9375l0 -0.328125zm7.0515137 1.859375l0 0.90625l-5.03125 0q-0.015625 -0.34375 0.109375 -0.65625q0.1875 -0.515625 0.609375 -1.015625q0.421875 -0.5 1.234375 -1.140625q1.234375 -1.03125 1.671875 -1.625q0.4375 -0.59375 0.4375 -1.125q0 -0.5625 -0.40625 -0.9375q-0.390625 -0.390625 -1.03125 -0.390625q-0.671875 0 -1.078125 0.40625q-0.40625 0.40625 -0.40625 1.125l-0.96875 -0.09375q0.09375 -1.078125 0.734375 -1.640625q0.65625 -0.5625 1.734375 -0.5625q1.109375 0 1.75 0.609375q0.640625 0.609375 0.640625 1.5q0 0.46875 -0.1875 0.90625q-0.1875 0.4375 -0.625 0.9375q-0.4375 0.484375 -1.453125 1.328125q-0.828125 0.71875 -1.078125 0.96875q-0.234375 0.25 -0.390625 0.5l3.734375 0z" fill-rule="nonzero"/><path fill="#000000" fill-opacity="0.0" d="m431.7271 323.52972l-31.275604 33.039368" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m431.7271 323.52972l-31.275604 33.039368" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m431.7271 323.52972l-11.24411 33.039368" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m431.7271 323.52972l-11.24411 33.039368" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m431.7271 323.52972l8.818878 33.039368" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m431.7271 323.52972l8.818878 33.039368" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m431.7271 323.52972l28.850372 33.039368" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m431.7271 323.52972l28.850372 33.039368" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m431.7271 323.52972l48.881866 33.039368" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m431.7271 323.52972l48.881866 33.039368" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m431.7271 323.52972l68.944855 33.039368" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m431.7271 323.52972l68.944855 33.039368" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m431.7271 323.52972l88.97638 33.039368" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m431.7271 323.52972l88.97638 33.039368" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m431.7271 323.52972l109.03937 33.039368" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m431.7271 323.52972l109.03937 33.039368" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m511.20032 323.79346l-110.77167 32.787415" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m511.20032 323.79346l-110.77167 32.787415" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m511.20032 323.79346l-90.70865 32.787415" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m511.20032 323.79346l-90.70865 32.787415" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m511.20032 323.79346l-70.677155 32.787415" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m511.20032 323.79346l-70.677155 32.787415" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m511.20032 323.79346l-50.614166 32.787415" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m511.20032 323.79346l-50.614166 32.787415" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m511.20032 323.79346l-30.582672 32.787415" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m511.20032 323.79346l-30.582672 32.787415" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m511.20032 323.79346l-10.551178 32.787415" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m511.20032 323.79346l-10.551178 32.787415" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m511.20032 323.79346l9.51178 32.787415" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m511.20032 323.79346l9.51178 32.787415" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m511.20032 323.79346l29.543335 32.787415" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m511.20032 323.79346l29.543335 32.787415" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m92.96588 128.67455l109.03937 0l0 77.60629l-109.03937 0z" fill-rule="evenodd"/><path fill="#000000" d="m116.86007 155.59454l5.125 -13.359375l1.90625 0l5.4687424 13.359375l-2.0156174 0l-1.546875 -4.046875l-5.59375 0l-1.46875 4.046875l-1.875 0zm3.859375 -5.484375l4.53125 0l-1.40625 -3.703125q-0.625 -1.6875 -0.9375 -2.765625q-0.265625 1.28125 -0.71875 2.546875l-1.46875 3.921875zm9.80294 5.484375l0 -13.359375l1.640625 0l0 13.359375l-1.640625 0zm4.144821 0l0 -13.359375l1.640625 0l0 13.359375l-1.640625 0zm10.816696 -3.109375l1.6875 0.203125q-0.40625 1.484375 -1.484375 2.3125q-1.078125 0.8125 -2.765625 0.8125q-2.125 0 -3.375 -1.296875q-1.234375 -1.3125 -1.234375 -3.671875q0 -2.453125 1.25 -3.796875q1.265625 -1.34375 3.265625 -1.34375q1.9375 0 3.15625 1.328125q1.234375 1.3125 1.234375 3.703125q0 0.15625 0 0.4375l-7.21875 0q0.09375 1.59375 0.90625 2.453125q0.8125 0.84375 2.015625 0.84375q0.90625 0 1.546875 -0.46875q0.640625 -0.484375 1.015625 -1.515625zm-5.390625 -2.65625l5.40625 0q-0.109375 -1.21875 -0.625 -1.828125q-0.78125 -0.953125 -2.03125 -0.953125q-1.125 0 -1.90625 0.765625q-0.765625 0.75 -0.84375 2.015625zm9.094467 5.765625l0 -13.359375l1.640625 0l0 13.359375l-1.640625 0zm10.816696 -3.109375l1.6875 0.203125q-0.40625 1.484375 -1.484375 2.3125q-1.078125 0.8125 -2.765625 0.8125q-2.125 0 -3.375 -1.296875q-1.234375 -1.3125 -1.234375 -3.671875q0 -2.453125 1.25 -3.796875q1.265625 -1.34375 3.265625 -1.34375q1.9375 0 3.15625 1.328125q1.234375 1.3125 1.234375 3.703125q0 0.15625 0 0.4375l-7.21875 0q0.09375 1.59375 0.90625 2.453125q0.8125 0.84375 2.015625 0.84375q0.90625 0 1.546875 -0.46875q0.640625 -0.484375 1.015625 -1.515625zm-5.390625 -2.65625l5.40625 0q-0.109375 -1.21875 -0.625 -1.828125q-0.78125 -0.953125 -2.03125 -0.953125q-1.125 0 -1.90625 0.765625q-0.765625 0.75 -0.84375 2.015625zm20.043396 5.765625l-1.640625 0l0 -10.453125q-0.59375 0.5625 -1.5625 1.140625q-0.953125 0.5625 -1.71875 0.84375l0 -1.59375q1.375 -0.640625 2.40625 -1.5625q1.03125 -0.921875 1.453125 -1.78125l1.0625 0l0 13.40625z" fill-rule="nonzero"/><path fill="#000000" d="m107.61752 174.70392l1.625 -0.25q0.125 0.96875 0.75 1.5q0.625 0.515625 1.75 0.515625q1.125 0 1.671875 -0.453125q0.546875 -0.46875 0.546875 -1.09375q0 -0.546875 -0.484375 -0.875q-0.328125 -0.21875 -1.671875 -0.546875q-1.8125 -0.46875 -2.515625 -0.796875q-0.6875 -0.328125 -1.046875 -0.90625q-0.359375 -0.59375 -0.359375 -1.3125q0 -0.640625 0.296875 -1.1875q0.296875 -0.5625 0.8125 -0.921875q0.375 -0.28125 1.03125 -0.46875q0.671875 -0.203125 1.421875 -0.203125q1.140625 0 2.0 0.328125q0.859375 0.328125 1.265625 0.890625q0.421875 0.5625 0.578125 1.5l-1.609375 0.21875q-0.109375 -0.75 -0.640625 -1.171875q-0.515625 -0.421875 -1.46875 -0.421875q-1.140625 0 -1.625 0.375q-0.46875 0.375 -0.46875 0.875q0 0.3125 0.1875 0.578125q0.203125 0.265625 0.640625 0.4375q0.234375 0.09375 1.4375 0.421875q1.75 0.453125 2.4375 0.75q0.6875 0.296875 1.078125 0.859375q0.390625 0.5625 0.390625 1.40625q0 0.828125 -0.484375 1.546875q-0.46875 0.71875 -1.375 1.125q-0.90625 0.390625 -2.046875 0.390625q-1.875 0 -2.875 -0.78125q-0.984375 -0.78125 -1.25 -2.328125zm16.3125 2.890625l0 -1.421875q-1.125 1.640625 -3.0625 1.640625q-0.859375 0 -1.609375 -0.328125q-0.734375 -0.328125 -1.09375 -0.828125q-0.359375 -0.5 -0.5 -1.21875q-0.109375 -0.46875 -0.109375 -1.53125l0 -5.984375l1.640625 0l0 5.359375q0 1.28125 0.109375 1.734375q0.15625 0.640625 0.65625 1.015625q0.5 0.375 1.234375 0.375q0.734375 0 1.375 -0.375q0.65625 -0.390625 0.921875 -1.03125q0.265625 -0.65625 0.265625 -1.890625l0 -5.1875l1.640625 0l0 9.671875l-1.46875 0zm5.547592 0l-1.515625 0l0 -13.359375l1.640625 0l0 4.765625q1.046875 -1.296875 2.65625 -1.296875q0.890625 0 1.6875 0.359375q0.796875 0.359375 1.3125 1.015625q0.515625 0.640625 0.796875 1.5625q0.296875 0.921875 0.296875 1.96875q0 2.484375 -1.234375 3.84375q-1.21875 1.359375 -2.953125 1.359375q-1.703125 0 -2.6875 -1.4375l0 1.21875zm-0.015625 -4.90625q0 1.734375 0.484375 2.515625q0.765625 1.265625 2.09375 1.265625q1.078125 0 1.859375 -0.9375q0.78125 -0.9375 0.78125 -2.78125q0 -1.890625 -0.75 -2.796875q-0.75 -0.90625 -1.828125 -0.90625q-1.0625 0 -1.859375 0.9375q-0.78125 0.9375 -0.78125 2.703125zm8.891342 4.90625l0 -9.671875l1.46875 0l0 1.359375q0.453125 -0.71875 1.203125 -1.140625q0.765625 -0.4375 1.71875 -0.4375q1.078125 0 1.765625 0.453125q0.6875 0.4375 0.96875 1.234375q1.15625 -1.6875 2.984375 -1.6875q1.453125 0 2.21875 0.796875q0.78125 0.796875 0.78125 2.453125l0 6.640625l-1.640625 0l0 -6.09375q0 -0.984375 -0.15625 -1.40625q-0.15625 -0.4375 -0.578125 -0.703125q-0.421875 -0.265625 -0.984375 -0.265625q-1.015625 0 -1.6875 0.6875q-0.671875 0.671875 -0.671875 2.15625l0 5.625l-1.640625 0l0 -6.28125q0 -1.09375 -0.40625 -1.640625q-0.40625 -0.546875 -1.3125 -0.546875q-0.6875 0 -1.28125 0.359375q-0.59375 0.359375 -0.859375 1.0625q-0.25 0.703125 -0.25 2.03125l0 5.015625l-1.640625 0zm14.931427 -4.84375q0 -2.6875 1.484375 -3.96875q1.25 -1.078125 3.046875 -1.078125q2.0 0 3.265625 1.3125q1.265625 1.296875 1.265625 3.609375q0 1.859375 -0.5625 2.9375q-0.5625 1.0625 -1.640625 1.65625q-1.0625 0.59375 -2.328125 0.59375q-2.03125 0 -3.28125 -1.296875q-1.25 -1.3125 -1.25 -3.765625zm1.6875 0q0 1.859375 0.796875 2.796875q0.8125 0.921875 2.046875 0.921875q1.21875 0 2.03125 -0.921875q0.8125 -0.9375 0.8125 -2.84375q0 -1.796875 -0.8125 -2.71875q-0.8125 -0.921875 -2.03125 -0.921875q-1.234375 0 -2.046875 0.921875q-0.796875 0.90625 -0.796875 2.765625zm15.563217 4.84375l0 -1.21875q-0.90625 1.4375 -2.703125 1.4375q-1.15625 0 -2.125 -0.640625q-0.96875 -0.640625 -1.5 -1.78125q-0.53125 -1.140625 -0.53125 -2.625q0 -1.453125 0.484375 -2.625q0.484375 -1.1875 1.4375 -1.8125q0.96875 -0.625 2.171875 -0.625q0.875 0 1.546875 0.375q0.6875 0.359375 1.109375 0.953125l0 -4.796875l1.640625 0l0 13.359375l-1.53125 0zm-5.171875 -4.828125q0 1.859375 0.78125 2.78125q0.78125 0.921875 1.84375 0.921875q1.078125 0 1.828125 -0.875q0.75 -0.890625 0.75 -2.6875q0 -1.984375 -0.765625 -2.90625q-0.765625 -0.9375 -1.890625 -0.9375q-1.078125 0 -1.8125 0.890625q-0.734375 0.890625 -0.734375 2.8125zm15.906967 1.71875l1.6875 0.203125q-0.40625 1.484375 -1.484375 2.3125q-1.078125 0.8125 -2.765625 0.8125q-2.125 0 -3.375 -1.296875q-1.234375 -1.3125 -1.234375 -3.671875q0 -2.453125 1.25 -3.796875q1.265625 -1.34375 3.265625 -1.34375q1.9375 0 3.15625 1.328125q1.234375 1.3125 1.234375 3.703125q0 0.15625 0 0.4375l-7.21875 0q0.09375 1.59375 0.90625 2.453125q0.8125 0.84375 2.015625 0.84375q0.90625 0 1.546875 -0.46875q0.640625 -0.484375 1.015625 -1.515625zm-5.390625 -2.65625l5.40625 0q-0.109375 -1.21875 -0.625 -1.828125q-0.78125 -0.953125 -2.03125 -0.953125q-1.125 0 -1.90625 0.765625q-0.765625 0.75 -0.84375 2.015625zm9.094467 5.765625l0 -13.359375l1.640625 0l0 13.359375l-1.640625 0z" fill-rule="nonzero"/><path fill="#b6d7a8" d="m200.35062 118.71178l0 0c0 -13.466743 10.916946 -24.38369 24.383682 -24.38369l207.92555 0c6.4669495 0 12.669037 2.568985 17.241852 7.141815c4.5728455 4.57283 7.141815 10.774918 7.141815 17.241875l0 97.53183c0 13.466736 -10.916931 24.383698 -24.383667 24.383698l-207.92555 0c-13.466736 0 -24.383682 -10.916962 -24.383682 -24.383698z" fill-rule="evenodd"/><path stroke="#000000" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m200.35062 118.71178l0 0c0 -13.466743 10.916946 -24.38369 24.383682 -24.38369l207.92555 0c6.4669495 0 12.669037 2.568985 17.241852 7.141815c4.5728455 4.57283 7.141815 10.774918 7.141815 17.241875l0 97.53183c0 13.466736 -10.916931 24.383698 -24.383667 24.383698l-207.92555 0c-13.466736 0 -24.383682 -10.916962 -24.383682 -24.383698z" fill-rule="evenodd"/><path fill="#eeeeee" d="m260.57108 101.362206l27.433075 0l0 26.74015l-27.433075 0z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m260.57108 101.362206l27.433075 0l0 26.74015l-27.433075 0z" fill-rule="evenodd"/><path fill="#000000" d="m268.158 115.690956q-0.78125 0.671875 -1.5 0.953125q-0.71875 0.265625 -1.546875 0.265625q-1.375 0 -2.109375 -0.671875q-0.734375 -0.671875 -0.734375 -1.703125q0 -0.609375 0.28125 -1.109375q0.28125 -0.515625 0.71875 -0.8125q0.453125 -0.3125 1.015625 -0.46875q0.421875 -0.109375 1.25 -0.203125q1.703125 -0.203125 2.515625 -0.484375q0 -0.296875 0 -0.375q0 -0.859375 -0.390625 -1.203125q-0.546875 -0.484375 -1.609375 -0.484375q-0.984375 0 -1.46875 0.359375q-0.46875 0.34375 -0.6875 1.21875l-1.375 -0.1875q0.1875 -0.875 0.609375 -1.421875q0.4375 -0.546875 1.25 -0.828125q0.8125 -0.296875 1.875 -0.296875q1.0625 0 1.71875 0.25q0.671875 0.25 0.984375 0.625q0.3125 0.375 0.4375 0.953125q0.078125 0.359375 0.078125 1.296875l0 1.875q0 1.96875 0.078125 2.484375q0.09375 0.515625 0.359375 1.0l-1.46875 0q-0.21875 -0.4375 -0.28125 -1.03125zm-0.109375 -3.140625q-0.765625 0.3125 -2.296875 0.53125q-0.875 0.125 -1.234375 0.28125q-0.359375 0.15625 -0.5625 0.46875q-0.1875 0.296875 -0.1875 0.65625q0 0.5625 0.421875 0.9375q0.4375 0.375 1.25 0.375q0.8125 0 1.4375 -0.34375q0.640625 -0.359375 0.9375 -0.984375q0.234375 -0.46875 0.234375 -1.40625l0 -0.515625z" fill-rule="nonzero"/><path fill="#000000" d="m274.55643 122.722206l-0.9375 0l0 -5.96875q-0.34375 0.328125 -0.890625 0.65625q-0.546875 0.3125 -0.984375 0.46875l0 -0.90625q0.796875 -0.359375 1.375 -0.890625q0.59375 -0.53125 0.828125 -1.015625l0.609375 0l0 7.65625z" fill-rule="nonzero"/><path fill="#000000" d="m277.90482 116.722206l0 -7.203125l-1.234375 0l0 -1.09375l1.234375 0l0 -0.890625q0 -0.828125 0.15625 -1.234375q0.203125 -0.546875 0.703125 -0.890625q0.515625 -0.34375 1.4375 -0.34375q0.59375 0 1.3125 0.140625l-0.203125 1.234375q-0.4375 -0.078125 -0.828125 -0.078125q-0.640625 0 -0.90625 0.28125q-0.265625 0.265625 -0.265625 1.015625l0 0.765625l1.609375 0l0 1.09375l-1.609375 0l0 7.203125l-1.40625 0z" fill-rule="nonzero"/><path fill="#000000" d="m284.92825 122.722206l-0.9375 0l0 -5.96875q-0.34375 0.328125 -0.890625 0.65625q-0.546875 0.3125 -0.984375 0.46875l0 -0.90625q0.796875 -0.359375 1.375 -0.890625q0.59375 -0.53125 0.828125 -1.015625l0.609375 0l0 7.65625z" fill-rule="nonzero"/><path fill="#eeeeee" d="m299.51596 101.362206l27.433075 0l0 26.74015l-27.433075 0z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m299.51596 101.362206l27.433075 0l0 26.74015l-27.433075 0z" fill-rule="evenodd"/><path fill="#000000" d="m307.10287 115.690956q-0.78125 0.671875 -1.5 0.953125q-0.71875 0.265625 -1.546875 0.265625q-1.375 0 -2.109375 -0.671875q-0.734375 -0.671875 -0.734375 -1.703125q0 -0.609375 0.28125 -1.109375q0.28125 -0.515625 0.71875 -0.8125q0.453125 -0.3125 1.015625 -0.46875q0.421875 -0.109375 1.25 -0.203125q1.703125 -0.203125 2.515625 -0.484375q0 -0.296875 0 -0.375q0 -0.859375 -0.390625 -1.203125q-0.546875 -0.484375 -1.609375 -0.484375q-0.984375 0 -1.46875 0.359375q-0.46875 0.34375 -0.6875 1.21875l-1.375 -0.1875q0.1875 -0.875 0.609375 -1.421875q0.4375 -0.546875 1.25 -0.828125q0.8125 -0.296875 1.875 -0.296875q1.0625 0 1.71875 0.25q0.671875 0.25 0.984375 0.625q0.3125 0.375 0.4375 0.953125q0.078125 0.359375 0.078125 1.296875l0 1.875q0 1.96875 0.078125 2.484375q0.09375 0.515625 0.359375 1.0l-1.46875 0q-0.21875 -0.4375 -0.28125 -1.03125zm-0.109375 -3.140625q-0.765625 0.3125 -2.296875 0.53125q-0.875 0.125 -1.234375 0.28125q-0.359375 0.15625 -0.5625 0.46875q-0.1875 0.296875 -0.1875 0.65625q0 0.5625 0.421875 0.9375q0.4375 0.375 1.25 0.375q0.8125 0 1.4375 -0.34375q0.640625 -0.359375 0.9375 -0.984375q0.234375 -0.46875 0.234375 -1.40625l0 -0.515625z" fill-rule="nonzero"/><path fill="#000000" d="m313.5013 122.722206l-0.9375 0l0 -5.96875q-0.34375 0.328125 -0.890625 0.65625q-0.546875 0.3125 -0.984375 0.46875l0 -0.90625q0.796875 -0.359375 1.375 -0.890625q0.59375 -0.53125 0.828125 -1.015625l0.609375 0l0 7.65625z" fill-rule="nonzero"/><path fill="#000000" d="m316.8497 116.722206l0 -7.203125l-1.234375 0l0 -1.09375l1.234375 0l0 -0.890625q0 -0.828125 0.15625 -1.234375q0.203125 -0.546875 0.703125 -0.890625q0.515625 -0.34375 1.4375 -0.34375q0.59375 0 1.3125 0.140625l-0.203125 1.234375q-0.4375 -0.078125 -0.828125 -0.078125q-0.640625 0 -0.90625 0.28125q-0.265625 0.265625 -0.265625 1.015625l0 0.765625l1.609375 0l0 1.09375l-1.609375 0l0 7.203125l-1.40625 0z" fill-rule="nonzero"/><path fill="#000000" d="m325.26376 121.815956l0 0.90625l-5.03125 0q-0.015625 -0.34375 0.109375 -0.65625q0.1875 -0.515625 0.609375 -1.015625q0.421875 -0.5 1.234375 -1.140625q1.234375 -1.03125 1.671875 -1.625q0.4375 -0.59375 0.4375 -1.125q0 -0.5625 -0.40625 -0.9375q-0.390625 -0.390625 -1.03125 -0.390625q-0.671875 0 -1.078125 0.40625q-0.40625 0.40625 -0.40625 1.125l-0.96875 -0.09375q0.09375 -1.078125 0.734375 -1.640625q0.65625 -0.5625 1.734375 -0.5625q1.109375 0 1.75 0.609375q0.640625 0.609375 0.640625 1.5q0 0.46875 -0.1875 0.90625q-0.1875 0.4375 -0.625 0.9375q-0.4375 0.484375 -1.453125 1.328125q-0.828125 0.71875 -1.078125 0.96875q-0.234375 0.25 -0.390625 0.5l3.734375 0z" fill-rule="nonzero"/><path fill="#000000" fill-opacity="0.0" d="m330.46085 101.362206l27.433075 0l0 26.74015l-27.433075 0z" fill-rule="evenodd"/><path fill="#000000" d="m334.51724 120.592285l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0zm8.890625 0l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0zm8.890625 0l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0z" fill-rule="nonzero"/><path fill="#eeeeee" d="m369.40573 101.362206l27.433075 0l0 26.74015l-27.433075 0z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m369.40573 101.362206l27.433075 0l0 26.74015l-27.433075 0z" fill-rule="evenodd"/><path fill="#000000" d="m376.99265 115.690956q-0.78125 0.671875 -1.5 0.953125q-0.71875 0.265625 -1.546875 0.265625q-1.375 0 -2.109375 -0.671875q-0.734375 -0.671875 -0.734375 -1.703125q0 -0.609375 0.28125 -1.109375q0.28125 -0.515625 0.71875 -0.8125q0.453125 -0.3125 1.015625 -0.46875q0.421875 -0.109375 1.25 -0.203125q1.703125 -0.203125 2.515625 -0.484375q0 -0.296875 0 -0.375q0 -0.859375 -0.390625 -1.203125q-0.546875 -0.484375 -1.609375 -0.484375q-0.984375 0 -1.46875 0.359375q-0.46875 0.34375 -0.6875 1.21875l-1.375 -0.1875q0.1875 -0.875 0.609375 -1.421875q0.4375 -0.546875 1.25 -0.828125q0.8125 -0.296875 1.875 -0.296875q1.0625 0 1.71875 0.25q0.671875 0.25 0.984375 0.625q0.3125 0.375 0.4375 0.953125q0.078125 0.359375 0.078125 1.296875l0 1.875q0 1.96875 0.078125 2.484375q0.09375 0.515625 0.359375 1.0l-1.46875 0q-0.21875 -0.4375 -0.28125 -1.03125zm-0.109375 -3.140625q-0.765625 0.3125 -2.296875 0.53125q-0.875 0.125 -1.234375 0.28125q-0.359375 0.15625 -0.5625 0.46875q-0.1875 0.296875 -0.1875 0.65625q0 0.5625 0.421875 0.9375q0.4375 0.375 1.25 0.375q0.8125 0 1.4375 -0.34375q0.640625 -0.359375 0.9375 -0.984375q0.234375 -0.46875 0.234375 -1.40625l0 -0.515625z" fill-rule="nonzero"/><path fill="#000000" d="m383.39108 122.722206l-0.9375 0l0 -5.96875q-0.34375 0.328125 -0.890625 0.65625q-0.546875 0.3125 -0.984375 0.46875l0 -0.90625q0.796875 -0.359375 1.375 -0.890625q0.59375 -0.53125 0.828125 -1.015625l0.609375 0l0 7.65625z" fill-rule="nonzero"/><path fill="#000000" d="m386.73944 116.722206l0 -7.203125l-1.234375 0l0 -1.09375l1.234375 0l0 -0.890625q0 -0.828125 0.15625 -1.234375q0.203125 -0.546875 0.703125 -0.890625q0.515625 -0.34375 1.4375 -0.34375q0.59375 0 1.3125 0.140625l-0.203125 1.234375q-0.4375 -0.078125 -0.828125 -0.078125q-0.640625 0 -0.90625 0.28125q-0.265625 0.265625 -0.265625 1.015625l0 0.765625l1.609375 0l0 1.09375l-1.609375 0l0 7.203125l-1.40625 0z" fill-rule="nonzero"/><path fill="#000000" d="m390.49725 122.722206l0 -5.53125l0.84375 0l0 0.796875q0.609375 -0.921875 1.75 -0.921875q0.5 0 0.921875 0.1875q0.421875 0.171875 0.625 0.46875q0.21875 0.296875 0.296875 0.6875q0.046875 0.265625 0.046875 0.921875l0 3.390625l-0.9375 0l0 -3.359375q0 -0.578125 -0.109375 -0.859375q-0.109375 -0.28125 -0.390625 -0.453125q-0.265625 -0.171875 -0.640625 -0.171875q-0.59375 0 -1.03125 0.390625q-0.4375 0.375 -0.4375 1.4375l0 3.015625l-0.9375 0z" fill-rule="nonzero"/><path fill="#9fc5e8" d="m276.39557 175.30183l0 0c0 -3.305008 2.834381 -5.984253 6.330719 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222687 1.8542175 2.644394 1.8542175 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.330719 -2.679245 -6.330719 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m276.39557 175.30183l0 0c0 -3.305008 2.834381 -5.984253 6.330719 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222687 1.8542175 2.644394 1.8542175 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.330719 -2.679245 -6.330719 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m306.90213 175.30183l0 0c0 -3.305008 2.834381 -5.984253 6.330719 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222687 1.8542175 2.644394 1.8542175 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.330719 -2.679245 -6.330719 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m306.90213 175.30183l0 0c0 -3.305008 2.834381 -5.984253 6.330719 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872253 1.1222687 1.8542175 2.644394 1.8542175 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.330719 5.984253l0 0c-3.496338 0 -6.330719 -2.679245 -6.330719 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m368.7919 175.30183l0 0c0 -3.305008 2.8343506 -5.984253 6.330719 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.476471 1.7527466c1.1872559 1.1222687 1.8542175 2.644394 1.8542175 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.4963684 0 -6.330719 -2.679245 -6.330719 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m368.7919 175.30183l0 0c0 -3.305008 2.8343506 -5.984253 6.330719 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.476471 1.7527466c1.1872559 1.1222687 1.8542175 2.644394 1.8542175 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.4963684 0 -6.330719 -2.679245 -6.330719 -5.984253z" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m330.46085 157.35912l27.433075 0l0 26.740158l-27.433075 0z" fill-rule="evenodd"/><path fill="#000000" d="m334.51724 176.5892l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0zm8.890625 0l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0zm8.890625 0l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0z" fill-rule="nonzero"/><path fill="#000000" fill-opacity="0.0" d="m274.28763 128.10236l8.4409485 41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m274.28763 128.10236l8.4409485 41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m313.23285 169.31758l-38.960632 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m313.23285 169.31758l-38.960632 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m375.12262 169.31758l-100.8504 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m375.12262 169.31758l-100.8504 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m282.7263 169.31758l30.519684 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m282.7263 169.31758l30.519684 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m282.7263 169.31758l100.409454 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m282.7263 169.31758l100.409454 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m313.23285 169.31758l0 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m313.23285 169.31758l0 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m313.23285 169.31758l69.88977 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m313.23285 169.31758l69.88977 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m375.12262 169.31758l-61.88977 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m375.12262 169.31758l-61.88977 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m375.12262 169.31758l8.0 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m375.12262 169.31758l8.0 -41.228348" fill-rule="evenodd"/><path fill="#9fc5e8" d="m322.3667 229.45407l0 0c0 -3.305008 2.8343506 -5.984253 6.330719 -5.984253l0 0c1.6790161 0 3.2892456 0.6304779 4.476471 1.7527466c1.1872559 1.1222687 1.854248 2.6443787 1.854248 4.2315063l0 0c0 3.305008 -2.834381 5.984253 -6.330719 5.984253l0 0c-3.4963684 0 -6.330719 -2.679245 -6.330719 -5.984253z" fill-rule="evenodd"/><path stroke="#000000" stroke-width="3.0" stroke-linejoin="round" stroke-linecap="butt" d="m322.3667 229.45407l0 0c0 -3.305008 2.8343506 -5.984253 6.330719 -5.984253l0 0c1.6790161 0 3.2892456 0.6304779 4.476471 1.7527466c1.1872559 1.1222687 1.854248 2.6443787 1.854248 4.2315063l0 0c0 3.305008 -2.834381 5.984253 -6.330719 5.984253l0 0c-3.4963684 0 -6.330719 -2.679245 -6.330719 -5.984253z" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m328.69742 223.46982l-45.984253 -42.173233" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m328.69742 223.46982l-45.984253 -42.173233" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m328.69742 223.46982l-15.464569 -42.173233" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m328.69742 223.46982l-15.464569 -42.173233" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m328.69742 223.46982l46.4252 -42.173233" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m328.69742 223.46982l46.4252 -42.173233" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m293.45395 216.26282l27.433075 0l0 33.039368l-27.433075 0z" fill-rule="evenodd"/><path fill="#000000" d="m297.85727 234.81032l0 -11.484375l1.28125 0l0 1.078125q0.453125 -0.640625 1.015625 -0.953125q0.578125 -0.3125 1.390625 -0.3125q1.0625 0 1.875 0.546875q0.8125 0.546875 1.21875 1.546875q0.421875 0.984375 0.421875 2.171875q0 1.28125 -0.46875 2.296875q-0.453125 1.015625 -1.328125 1.5625q-0.859375 0.546875 -1.828125 0.546875q-0.703125 0 -1.265625 -0.296875q-0.546875 -0.296875 -0.90625 -0.75l0 4.046875l-1.40625 0zm1.265625 -7.296875q0 1.609375 0.640625 2.375q0.65625 0.765625 1.578125 0.765625q0.9375 0 1.609375 -0.796875q0.671875 -0.796875 0.671875 -2.453125q0 -1.59375 -0.65625 -2.375q-0.65625 -0.796875 -1.5625 -0.796875q-0.890625 0 -1.59375 0.84375q-0.6875 0.84375 -0.6875 2.4375z" fill-rule="nonzero"/><path fill="#000000" d="m310.0057 236.93532q-0.53125 0.453125 -1.015625 0.640625q-0.46875 0.171875 -1.015625 0.171875q-0.921875 0 -1.40625 -0.4375q-0.484375 -0.453125 -0.484375 -1.140625q0 -0.40625 0.171875 -0.734375q0.1875 -0.34375 0.484375 -0.546875q0.3125 -0.203125 0.6875 -0.3125q0.265625 -0.0625 0.828125 -0.140625q1.125 -0.125 1.671875 -0.3125q0 -0.203125 0 -0.25q0 -0.578125 -0.265625 -0.8125q-0.359375 -0.3125 -1.0625 -0.3125q-0.65625 0 -0.984375 0.234375q-0.3125 0.234375 -0.453125 0.8125l-0.921875 -0.125q0.125 -0.578125 0.40625 -0.9375q0.296875 -0.375 0.828125 -0.5625q0.546875 -0.203125 1.25 -0.203125q0.71875 0 1.15625 0.171875q0.4375 0.171875 0.640625 0.421875q0.21875 0.25 0.296875 0.640625q0.046875 0.234375 0.046875 0.859375l0 1.25q0 1.296875 0.0625 1.65625q0.0625 0.34375 0.234375 0.65625l-0.96875 0q-0.15625 -0.296875 -0.1875 -0.6875zm-0.078125 -2.078125q-0.515625 0.203125 -1.53125 0.34375q-0.578125 0.078125 -0.828125 0.1875q-0.234375 0.109375 -0.359375 0.3125q-0.125 0.1875 -0.125 0.4375q0 0.375 0.28125 0.625q0.28125 0.25 0.828125 0.25q0.53125 0 0.953125 -0.234375q0.421875 -0.234375 0.625 -0.65625q0.15625 -0.3125 0.15625 -0.9375l0 -0.328125zm5.6608887 2.765625l-0.9375 0l0 -5.96875q-0.34375 0.328125 -0.890625 0.65625q-0.546875 0.3125 -0.984375 0.46875l0 -0.90625q0.796875 -0.359375 1.375 -0.890625q0.59375 -0.53125 0.828125 -1.015625l0.609375 0l0 7.65625z" fill-rule="nonzero"/><path fill="#d9ead3" d="m488.69708 118.71178l0 0c0 -13.466743 10.916931 -24.38369 24.383667 -24.38369l207.92554 0c6.46698 0 12.669067 2.568985 17.241882 7.141815c4.572815 4.57283 7.1418457 10.774918 7.1418457 17.241875l0 97.53183c0 13.466736 -10.916992 24.383698 -24.383728 24.383698l-207.92554 0c-13.466736 0 -24.383667 -10.916962 -24.383667 -24.383698z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m488.69708 118.71178l0 0c0 -13.466743 10.916931 -24.38369 24.383667 -24.38369l207.92554 0c6.46698 0 12.669067 2.568985 17.241882 7.141815c4.572815 4.57283 7.1418457 10.774918 7.1418457 17.241875l0 97.53183c0 13.466736 -10.916992 24.383698 -24.383728 24.383698l-207.92554 0c-13.466736 0 -24.383667 -10.916962 -24.383667 -24.383698z" fill-rule="evenodd"/><path fill="#eeeeee" d="m548.91754 101.362206l27.433044 0l0 26.74015l-27.433044 0z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m548.91754 101.362206l27.433044 0l0 26.74015l-27.433044 0z" fill-rule="evenodd"/><path fill="#000000" d="m556.50446 115.690956q-0.78125 0.671875 -1.5 0.953125q-0.71875 0.265625 -1.546875 0.265625q-1.375 0 -2.109375 -0.671875q-0.734375 -0.671875 -0.734375 -1.703125q0 -0.609375 0.28125 -1.109375q0.28125 -0.515625 0.71875 -0.8125q0.453125 -0.3125 1.015625 -0.46875q0.421875 -0.109375 1.25 -0.203125q1.703125 -0.203125 2.515625 -0.484375q0 -0.296875 0 -0.375q0 -0.859375 -0.390625 -1.203125q-0.546875 -0.484375 -1.609375 -0.484375q-0.984375 0 -1.46875 0.359375q-0.46875 0.34375 -0.6875 1.21875l-1.375 -0.1875q0.1875 -0.875 0.609375 -1.421875q0.4375 -0.546875 1.25 -0.828125q0.8125 -0.296875 1.875 -0.296875q1.0625 0 1.71875 0.25q0.671875 0.25 0.984375 0.625q0.3125 0.375 0.4375 0.953125q0.078125 0.359375 0.078125 1.296875l0 1.875q0 1.96875 0.078125 2.484375q0.09375 0.515625 0.359375 1.0l-1.46875 0q-0.21875 -0.4375 -0.28125 -1.03125zm-0.109375 -3.140625q-0.765625 0.3125 -2.296875 0.53125q-0.875 0.125 -1.234375 0.28125q-0.359375 0.15625 -0.5625 0.46875q-0.1875 0.296875 -0.1875 0.65625q0 0.5625 0.421875 0.9375q0.4375 0.375 1.25 0.375q0.8125 0 1.4375 -0.34375q0.640625 -0.359375 0.9375 -0.984375q0.234375 -0.46875 0.234375 -1.40625l0 -0.515625z" fill-rule="nonzero"/><path fill="#000000" d="m564.2935 121.815956l0 0.90625l-5.03125 0q-0.015625 -0.34375 0.109375 -0.65625q0.1875 -0.515625 0.609375 -1.015625q0.421875 -0.5 1.234375 -1.140625q1.234375 -1.03125 1.671875 -1.625q0.4375 -0.59375 0.4375 -1.125q0 -0.5625 -0.40625 -0.9375q-0.390625 -0.390625 -1.03125 -0.390625q-0.671875 0 -1.078125 0.40625q-0.40625 0.40625 -0.40625 1.125l-0.96875 -0.09375q0.09375 -1.078125 0.734375 -1.640625q0.65625 -0.5625 1.734375 -0.5625q1.109375 0 1.75 0.609375q0.640625 0.609375 0.640625 1.5q0 0.46875 -0.1875 0.90625q-0.1875 0.4375 -0.625 0.9375q-0.4375 0.484375 -1.453125 1.328125q-0.828125 0.71875 -1.078125 0.96875q-0.234375 0.25 -0.390625 0.5l3.734375 0z" fill-rule="nonzero"/><path fill="#000000" d="m566.2513 116.722206l0 -7.203125l-1.234375 0l0 -1.09375l1.234375 0l0 -0.890625q0 -0.828125 0.15625 -1.234375q0.203125 -0.546875 0.703125 -0.890625q0.515625 -0.34375 1.4375 -0.34375q0.59375 0 1.3125 0.140625l-0.203125 1.234375q-0.4375 -0.078125 -0.828125 -0.078125q-0.640625 0 -0.90625 0.28125q-0.265625 0.265625 -0.265625 1.015625l0 0.765625l1.609375 0l0 1.09375l-1.609375 0l0 7.203125l-1.40625 0z" fill-rule="nonzero"/><path fill="#000000" d="m573.2747 122.722206l-0.9375 0l0 -5.96875q-0.34375 0.328125 -0.890625 0.65625q-0.546875 0.3125 -0.984375 0.46875l0 -0.90625q0.796875 -0.359375 1.375 -0.890625q0.59375 -0.53125 0.828125 -1.015625l0.609375 0l0 7.65625z" fill-rule="nonzero"/><path fill="#eeeeee" d="m587.8624 101.362206l27.433044 0l0 26.74015l-27.433044 0z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m587.8624 101.362206l27.433044 0l0 26.74015l-27.433044 0z" fill-rule="evenodd"/><path fill="#000000" d="m595.44934 115.690956q-0.78125 0.671875 -1.5 0.953125q-0.71875 0.265625 -1.546875 0.265625q-1.375 0 -2.109375 -0.671875q-0.734375 -0.671875 -0.734375 -1.703125q0 -0.609375 0.28125 -1.109375q0.28125 -0.515625 0.71875 -0.8125q0.453125 -0.3125 1.015625 -0.46875q0.421875 -0.109375 1.25 -0.203125q1.703125 -0.203125 2.515625 -0.484375q0 -0.296875 0 -0.375q0 -0.859375 -0.390625 -1.203125q-0.546875 -0.484375 -1.609375 -0.484375q-0.984375 0 -1.46875 0.359375q-0.46875 0.34375 -0.6875 1.21875l-1.375 -0.1875q0.1875 -0.875 0.609375 -1.421875q0.4375 -0.546875 1.25 -0.828125q0.8125 -0.296875 1.875 -0.296875q1.0625 0 1.71875 0.25q0.671875 0.25 0.984375 0.625q0.3125 0.375 0.4375 0.953125q0.078125 0.359375 0.078125 1.296875l0 1.875q0 1.96875 0.078125 2.484375q0.09375 0.515625 0.359375 1.0l-1.46875 0q-0.21875 -0.4375 -0.28125 -1.03125zm-0.109375 -3.140625q-0.765625 0.3125 -2.296875 0.53125q-0.875 0.125 -1.234375 0.28125q-0.359375 0.15625 -0.5625 0.46875q-0.1875 0.296875 -0.1875 0.65625q0 0.5625 0.421875 0.9375q0.4375 0.375 1.25 0.375q0.8125 0 1.4375 -0.34375q0.640625 -0.359375 0.9375 -0.984375q0.234375 -0.46875 0.234375 -1.40625l0 -0.515625z" fill-rule="nonzero"/><path fill="#000000" d="m603.2384 121.815956l0 0.90625l-5.03125 0q-0.015625 -0.34375 0.109375 -0.65625q0.1875 -0.515625 0.609375 -1.015625q0.421875 -0.5 1.234375 -1.140625q1.234375 -1.03125 1.671875 -1.625q0.4375 -0.59375 0.4375 -1.125q0 -0.5625 -0.40625 -0.9375q-0.390625 -0.390625 -1.03125 -0.390625q-0.671875 0 -1.078125 0.40625q-0.40625 0.40625 -0.40625 1.125l-0.96875 -0.09375q0.09375 -1.078125 0.734375 -1.640625q0.65625 -0.5625 1.734375 -0.5625q1.109375 0 1.75 0.609375q0.640625 0.609375 0.640625 1.5q0 0.46875 -0.1875 0.90625q-0.1875 0.4375 -0.625 0.9375q-0.4375 0.484375 -1.453125 1.328125q-0.828125 0.71875 -1.078125 0.96875q-0.234375 0.25 -0.390625 0.5l3.734375 0z" fill-rule="nonzero"/><path fill="#000000" d="m605.19617 116.722206l0 -7.203125l-1.234375 0l0 -1.09375l1.234375 0l0 -0.890625q0 -0.828125 0.15625 -1.234375q0.203125 -0.546875 0.703125 -0.890625q0.515625 -0.34375 1.4375 -0.34375q0.59375 0 1.3125 0.140625l-0.203125 1.234375q-0.4375 -0.078125 -0.828125 -0.078125q-0.640625 0 -0.90625 0.28125q-0.265625 0.265625 -0.265625 1.015625l0 0.765625l1.609375 0l0 1.09375l-1.609375 0l0 7.203125l-1.40625 0z" fill-rule="nonzero"/><path fill="#000000" d="m613.6102 121.815956l0 0.90625l-5.03125 0q-0.015625 -0.34375 0.109375 -0.65625q0.1875 -0.515625 0.609375 -1.015625q0.421875 -0.5 1.234375 -1.140625q1.234375 -1.03125 1.671875 -1.625q0.4375 -0.59375 0.4375 -1.125q0 -0.5625 -0.40625 -0.9375q-0.390625 -0.390625 -1.03125 -0.390625q-0.671875 0 -1.078125 0.40625q-0.40625 0.40625 -0.40625 1.125l-0.96875 -0.09375q0.09375 -1.078125 0.734375 -1.640625q0.65625 -0.5625 1.734375 -0.5625q1.109375 0 1.75 0.609375q0.640625 0.609375 0.640625 1.5q0 0.46875 -0.1875 0.90625q-0.1875 0.4375 -0.625 0.9375q-0.4375 0.484375 -1.453125 1.328125q-0.828125 0.71875 -1.078125 0.96875q-0.234375 0.25 -0.390625 0.5l3.734375 0z" fill-rule="nonzero"/><path fill="#000000" fill-opacity="0.0" d="m618.8073 101.362206l27.433044 0l0 26.74015l-27.433044 0z" fill-rule="evenodd"/><path fill="#000000" d="m622.8637 120.592285l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0zm8.890625 0l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0zm8.890625 0l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0z" fill-rule="nonzero"/><path fill="#eeeeee" d="m657.7522 101.362206l27.433044 0l0 26.74015l-27.433044 0z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m657.7522 101.362206l27.433044 0l0 26.74015l-27.433044 0z" fill-rule="evenodd"/><path fill="#000000" d="m665.3391 115.690956q-0.78125 0.671875 -1.5 0.953125q-0.71875 0.265625 -1.546875 0.265625q-1.375 0 -2.109375 -0.671875q-0.734375 -0.671875 -0.734375 -1.703125q0 -0.609375 0.28125 -1.109375q0.28125 -0.515625 0.71875 -0.8125q0.453125 -0.3125 1.015625 -0.46875q0.421875 -0.109375 1.25 -0.203125q1.703125 -0.203125 2.515625 -0.484375q0 -0.296875 0 -0.375q0 -0.859375 -0.390625 -1.203125q-0.546875 -0.484375 -1.609375 -0.484375q-0.984375 0 -1.46875 0.359375q-0.46875 0.34375 -0.6875 1.21875l-1.375 -0.1875q0.1875 -0.875 0.609375 -1.421875q0.4375 -0.546875 1.25 -0.828125q0.8125 -0.296875 1.875 -0.296875q1.0625 0 1.71875 0.25q0.671875 0.25 0.984375 0.625q0.3125 0.375 0.4375 0.953125q0.078125 0.359375 0.078125 1.296875l0 1.875q0 1.96875 0.078125 2.484375q0.09375 0.515625 0.359375 1.0l-1.46875 0q-0.21875 -0.4375 -0.28125 -1.03125zm-0.109375 -3.140625q-0.765625 0.3125 -2.296875 0.53125q-0.875 0.125 -1.234375 0.28125q-0.359375 0.15625 -0.5625 0.46875q-0.1875 0.296875 -0.1875 0.65625q0 0.5625 0.421875 0.9375q0.4375 0.375 1.25 0.375q0.8125 0 1.4375 -0.34375q0.640625 -0.359375 0.9375 -0.984375q0.234375 -0.46875 0.234375 -1.40625l0 -0.515625z" fill-rule="nonzero"/><path fill="#000000" d="m673.1282 121.815956l0 0.90625l-5.03125 0q-0.015625 -0.34375 0.109375 -0.65625q0.1875 -0.515625 0.609375 -1.015625q0.421875 -0.5 1.234375 -1.140625q1.234375 -1.03125 1.671875 -1.625q0.4375 -0.59375 0.4375 -1.125q0 -0.5625 -0.40625 -0.9375q-0.390625 -0.390625 -1.03125 -0.390625q-0.671875 0 -1.078125 0.40625q-0.40625 0.40625 -0.40625 1.125l-0.96875 -0.09375q0.09375 -1.078125 0.734375 -1.640625q0.65625 -0.5625 1.734375 -0.5625q1.109375 0 1.75 0.609375q0.640625 0.609375 0.640625 1.5q0 0.46875 -0.1875 0.90625q-0.1875 0.4375 -0.625 0.9375q-0.4375 0.484375 -1.453125 1.328125q-0.828125 0.71875 -1.078125 0.96875q-0.234375 0.25 -0.390625 0.5l3.734375 0z" fill-rule="nonzero"/><path fill="#000000" d="m675.08594 116.722206l0 -7.203125l-1.234375 0l0 -1.09375l1.234375 0l0 -0.890625q0 -0.828125 0.15625 -1.234375q0.203125 -0.546875 0.703125 -0.890625q0.515625 -0.34375 1.4375 -0.34375q0.59375 0 1.3125 0.140625l-0.203125 1.234375q-0.4375 -0.078125 -0.828125 -0.078125q-0.640625 0 -0.90625 0.28125q-0.265625 0.265625 -0.265625 1.015625l0 0.765625l1.609375 0l0 1.09375l-1.609375 0l0 7.203125l-1.40625 0z" fill-rule="nonzero"/><path fill="#000000" d="m678.84375 122.722206l0 -5.53125l0.84375 0l0 0.796875q0.609375 -0.921875 1.75 -0.921875q0.5 0 0.921875 0.1875q0.421875 0.171875 0.625 0.46875q0.21875 0.296875 0.296875 0.6875q0.046875 0.265625 0.046875 0.921875l0 3.390625l-0.9375 0l0 -3.359375q0 -0.578125 -0.109375 -0.859375q-0.109375 -0.28125 -0.390625 -0.453125q-0.265625 -0.171875 -0.640625 -0.171875q-0.59375 0 -1.03125 0.390625q-0.4375 0.375 -0.4375 1.4375l0 3.015625l-0.9375 0z" fill-rule="nonzero"/><path fill="#9fc5e8" d="m564.74207 175.30183l0 0c0 -3.305008 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1871948 1.1222687 1.854187 2.644394 1.854187 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.496338 0 -6.3306885 -2.679245 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m564.74207 175.30183l0 0c0 -3.305008 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1871948 1.1222687 1.854187 2.644394 1.854187 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.496338 0 -6.3306885 -2.679245 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m595.2486 175.30183l0 0c0 -3.305008 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872559 1.1222687 1.854248 2.644394 1.854248 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.3307495 5.984253l0 0c-3.496338 0 -6.3306885 -2.679245 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m595.2486 175.30183l0 0c0 -3.305008 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872559 1.1222687 1.854248 2.644394 1.854248 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.3307495 5.984253l0 0c-3.496338 0 -6.3306885 -2.679245 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#9fc5e8" d="m657.13837 175.30183l0 0c0 -3.305008 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872559 1.1222687 1.854248 2.644394 1.854248 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.3307495 5.984253l0 0c-3.496338 0 -6.3306885 -2.679245 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m657.13837 175.30183l0 0c0 -3.305008 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.63049316 4.4765015 1.7527466c1.1872559 1.1222687 1.854248 2.644394 1.854248 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.3307495 5.984253l0 0c-3.496338 0 -6.3306885 -2.679245 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m618.8073 157.35912l27.433044 0l0 26.740158l-27.433044 0z" fill-rule="evenodd"/><path fill="#000000" d="m622.8637 176.5892l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0zm8.890625 0l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0zm8.890625 0l0 -1.609375l1.609375 0l0 1.609375l-1.609375 0z" fill-rule="nonzero"/><path fill="#000000" fill-opacity="0.0" d="m562.6341 128.10236l8.440918 41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m562.6341 128.10236l8.440918 41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m601.5793 169.31758l-38.960632 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m601.5793 169.31758l-38.960632 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m663.46906 169.31758l-100.8504 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m663.46906 169.31758l-100.8504 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m571.07275 169.31758l30.519653 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m571.07275 169.31758l30.519653 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m571.07275 169.31758l100.409424 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m571.07275 169.31758l100.409424 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m601.5793 169.31758l0 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m601.5793 169.31758l0 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m601.5793 169.31758l69.88977 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m601.5793 169.31758l69.88977 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m663.46906 169.31758l-61.88977 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m663.46906 169.31758l-61.88977 -41.228348" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m663.46906 169.31758l8.0 -41.228348" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m663.46906 169.31758l8.0 -41.228348" fill-rule="evenodd"/><path fill="#9fc5e8" d="m610.7132 229.45407l0 0c0 -3.305008 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.6304779 4.4765015 1.7527466c1.1871948 1.1222687 1.854187 2.6443787 1.854187 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.496338 0 -6.3306885 -2.679245 -6.3306885 -5.984253z" fill-rule="evenodd"/><path stroke="#000000" stroke-width="3.0" stroke-linejoin="round" stroke-linecap="butt" d="m610.7132 229.45407l0 0c0 -3.305008 2.8343506 -5.984253 6.3306885 -5.984253l0 0c1.6790161 0 3.2892456 0.6304779 4.4765015 1.7527466c1.1871948 1.1222687 1.854187 2.6443787 1.854187 4.2315063l0 0c0 3.305008 -2.8343506 5.984253 -6.3306885 5.984253l0 0c-3.496338 0 -6.3306885 -2.679245 -6.3306885 -5.984253z" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m617.0439 223.46982l-45.984253 -42.173233" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m617.0439 223.46982l-45.984253 -42.173233" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m617.0439 223.46982l-15.4646 -42.173233" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m617.0439 223.46982l-15.4646 -42.173233" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m617.0439 223.46982l46.42517 -42.173233" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m617.0439 223.46982l46.42517 -42.173233" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m743.20996 133.95013l106.20471 0l0 72.34645l-106.20471 0z" fill-rule="evenodd"/><path fill="#000000" d="m765.6868 160.87013l5.125 -13.359375l1.90625 0l5.46875 13.359375l-2.015625 0l-1.546875 -4.046875l-5.59375 0l-1.46875 4.046875l-1.875 0zm3.859375 -5.484375l4.53125 0l-1.40625 -3.703125q-0.625 -1.6875 -0.9375 -2.765625q-0.265625 1.28125 -0.71875 2.546875l-1.46875 3.921875zm9.8029785 5.484375l0 -13.359375l1.640625 0l0 13.359375l-1.640625 0zm4.1447754 0l0 -13.359375l1.640625 0l0 13.359375l-1.640625 0zm10.816711 -3.109375l1.6875 0.203125q-0.40625 1.484375 -1.484375 2.3125q-1.078125 0.8125 -2.765625 0.8125q-2.125 0 -3.375 -1.296875q-1.234375 -1.3125 -1.234375 -3.671875q0 -2.453125 1.25 -3.796875q1.265625 -1.34375 3.265625 -1.34375q1.9375 0 3.15625 1.328125q1.234375 1.3125 1.234375 3.703125q0 0.15625 0 0.4375l-7.21875 0q0.09375 1.59375 0.90625 2.453125q0.8125 0.84375 2.015625 0.84375q0.90625 0 1.546875 -0.46875q0.640625 -0.484375 1.015625 -1.515625zm-5.390625 -2.65625l5.40625 0q-0.109375 -1.21875 -0.625 -1.828125q-0.78125 -0.953125 -2.03125 -0.953125q-1.125 0 -1.90625 0.765625q-0.765625 0.75 -0.84375 2.015625zm9.094482 5.765625l0 -13.359375l1.640625 0l0 13.359375l-1.640625 0zm10.816711 -3.109375l1.6875 0.203125q-0.40625 1.484375 -1.484375 2.3125q-1.078125 0.8125 -2.765625 0.8125q-2.125 0 -3.375 -1.296875q-1.234375 -1.3125 -1.234375 -3.671875q0 -2.453125 1.25 -3.796875q1.265625 -1.34375 3.265625 -1.34375q1.9375 0 3.15625 1.328125q1.234375 1.3125 1.234375 3.703125q0 0.15625 0 0.4375l-7.21875 0q0.09375 1.59375 0.90625 2.453125q0.8125 0.84375 2.015625 0.84375q0.90625 0 1.546875 -0.46875q0.640625 -0.484375 1.015625 -1.515625zm-5.390625 -2.65625l5.40625 0q-0.109375 -1.21875 -0.625 -1.828125q-0.78125 -0.953125 -2.03125 -0.953125q-1.125 0 -1.90625 0.765625q-0.765625 0.75 -0.84375 2.015625zm22.480896 4.1875l0 1.578125l-8.828125 0q-0.015625 -0.59375 0.1875 -1.140625q0.34375 -0.90625 1.078125 -1.78125q0.75 -0.875 2.15625 -2.015625q2.171875 -1.78125 2.9375 -2.828125q0.765625 -1.046875 0.765625 -1.96875q0 -0.984375 -0.703125 -1.640625q-0.6875 -0.671875 -1.8125 -0.671875q-1.1875 0 -1.90625 0.71875q-0.703125 0.703125 -0.703125 1.953125l-1.6875 -0.171875q0.171875 -1.890625 1.296875 -2.875q1.140625 -0.984375 3.03125 -0.984375q1.921875 0 3.046875 1.0625q1.125 1.0625 1.125 2.640625q0 0.796875 -0.328125 1.578125q-0.328125 0.78125 -1.09375 1.640625q-0.75 0.84375 -2.53125 2.34375q-1.46875 1.234375 -1.890625 1.6875q-0.421875 0.4375 -0.6875 0.875l6.546875 0z" fill-rule="nonzero"/><path fill="#000000" d="m756.4443 179.9795l1.625 -0.25q0.125 0.96875 0.75 1.5q0.625 0.515625 1.75 0.515625q1.125 0 1.671875 -0.453125q0.546875 -0.46875 0.546875 -1.09375q0 -0.546875 -0.484375 -0.875q-0.328125 -0.21875 -1.671875 -0.546875q-1.8125 -0.46875 -2.515625 -0.796875q-0.6875 -0.328125 -1.046875 -0.90625q-0.359375 -0.59375 -0.359375 -1.3125q0 -0.640625 0.296875 -1.1875q0.296875 -0.5625 0.8125 -0.921875q0.375 -0.28125 1.03125 -0.46875q0.671875 -0.203125 1.421875 -0.203125q1.140625 0 2.0 0.328125q0.859375 0.328125 1.265625 0.890625q0.421875 0.5625 0.578125 1.5l-1.609375 0.21875q-0.109375 -0.75 -0.640625 -1.171875q-0.515625 -0.421875 -1.46875 -0.421875q-1.140625 0 -1.625 0.375q-0.46875 0.375 -0.46875 0.875q0 0.3125 0.1875 0.578125q0.203125 0.265625 0.640625 0.4375q0.234375 0.09375 1.4375 0.421875q1.75 0.453125 2.4375 0.75q0.6875 0.296875 1.078125 0.859375q0.390625 0.5625 0.390625 1.40625q0 0.828125 -0.484375 1.546875q-0.46875 0.71875 -1.375 1.125q-0.90625 0.390625 -2.046875 0.390625q-1.875 0 -2.875 -0.78125q-0.984375 -0.78125 -1.25 -2.328125zm16.3125 2.890625l0 -1.421875q-1.125 1.640625 -3.0625 1.640625q-0.859375 0 -1.609375 -0.328125q-0.734375 -0.328125 -1.09375 -0.828125q-0.359375 -0.5 -0.5 -1.21875q-0.109375 -0.46875 -0.109375 -1.53125l0 -5.984375l1.640625 0l0 5.359375q0 1.28125 0.109375 1.734375q0.15625 0.640625 0.65625 1.015625q0.5 0.375 1.234375 0.375q0.734375 0 1.375 -0.375q0.65625 -0.390625 0.921875 -1.03125q0.265625 -0.65625 0.265625 -1.890625l0 -5.1875l1.640625 0l0 9.671875l-1.46875 0zm5.5476074 0l-1.515625 0l0 -13.359375l1.640625 0l0 4.765625q1.046875 -1.296875 2.65625 -1.296875q0.890625 0 1.6875 0.359375q0.796875 0.359375 1.3125 1.015625q0.515625 0.640625 0.796875 1.5625q0.296875 0.921875 0.296875 1.96875q0 2.484375 -1.234375 3.84375q-1.21875 1.359375 -2.953125 1.359375q-1.703125 0 -2.6875 -1.4375l0 1.21875zm-0.015625 -4.90625q0 1.734375 0.484375 2.515625q0.765625 1.265625 2.09375 1.265625q1.078125 0 1.859375 -0.9375q0.78125 -0.9375 0.78125 -2.78125q0 -1.890625 -0.75 -2.796875q-0.75 -0.90625 -1.828125 -0.90625q-1.0625 0 -1.859375 0.9375q-0.78125 0.9375 -0.78125 2.703125zm8.891357 4.90625l0 -9.671875l1.46875 0l0 1.359375q0.453125 -0.71875 1.203125 -1.140625q0.765625 -0.4375 1.71875 -0.4375q1.078125 0 1.765625 0.453125q0.6875 0.4375 0.96875 1.234375q1.15625 -1.6875 2.984375 -1.6875q1.453125 0 2.21875 0.796875q0.78125 0.796875 0.78125 2.453125l0 6.640625l-1.640625 0l0 -6.09375q0 -0.984375 -0.15625 -1.40625q-0.15625 -0.4375 -0.578125 -0.703125q-0.421875 -0.265625 -0.984375 -0.265625q-1.015625 0 -1.6875 0.6875q-0.671875 0.671875 -0.671875 2.15625l0 5.625l-1.640625 0l0 -6.28125q0 -1.09375 -0.40625 -1.640625q-0.40625 -0.546875 -1.3125 -0.546875q-0.6875 0 -1.28125 0.359375q-0.59375 0.359375 -0.859375 1.0625q-0.25 0.703125 -0.25 2.03125l0 5.015625l-1.640625 0zm14.9313965 -4.84375q0 -2.6875 1.484375 -3.96875q1.25 -1.078125 3.046875 -1.078125q2.0 0 3.265625 1.3125q1.265625 1.296875 1.265625 3.609375q0 1.859375 -0.5625 2.9375q-0.5625 1.0625 -1.640625 1.65625q-1.0625 0.59375 -2.328125 0.59375q-2.03125 0 -3.28125 -1.296875q-1.25 -1.3125 -1.25 -3.765625zm1.6875 0q0 1.859375 0.796875 2.796875q0.8125 0.921875 2.046875 0.921875q1.21875 0 2.03125 -0.921875q0.8125 -0.9375 0.8125 -2.84375q0 -1.796875 -0.8125 -2.71875q-0.8125 -0.921875 -2.03125 -0.921875q-1.234375 0 -2.046875 0.921875q-0.796875 0.90625 -0.796875 2.765625zm15.563232 4.84375l0 -1.21875q-0.90625 1.4375 -2.703125 1.4375q-1.15625 0 -2.125 -0.640625q-0.96875 -0.640625 -1.5 -1.78125q-0.53125 -1.140625 -0.53125 -2.625q0 -1.453125 0.484375 -2.625q0.484375 -1.1875 1.4375 -1.8125q0.96875 -0.625 2.171875 -0.625q0.875 0 1.546875 0.375q0.6875 0.359375 1.109375 0.953125l0 -4.796875l1.640625 0l0 13.359375l-1.53125 0zm-5.171875 -4.828125q0 1.859375 0.78125 2.78125q0.78125 0.921875 1.84375 0.921875q1.078125 0 1.828125 -0.875q0.75 -0.890625 0.75 -2.6875q0 -1.984375 -0.765625 -2.90625q-0.765625 -0.9375 -1.890625 -0.9375q-1.078125 0 -1.8125 0.890625q-0.734375 0.890625 -0.734375 2.8125zm15.906982 1.71875l1.6875 0.203125q-0.40625 1.484375 -1.484375 2.3125q-1.078125 0.8125 -2.765625 0.8125q-2.125 0 -3.375 -1.296875q-1.234375 -1.3125 -1.234375 -3.671875q0 -2.453125 1.25 -3.796875q1.265625 -1.34375 3.265625 -1.34375q1.9375 0 3.15625 1.328125q1.234375 1.3125 1.234375 3.703125q0 0.15625 0 0.4375l-7.21875 0q0.09375 1.59375 0.90625 2.453125q0.8125 0.84375 2.015625 0.84375q0.90625 0 1.546875 -0.46875q0.640625 -0.484375 1.015625 -1.515625zm-5.390625 -2.65625l5.40625 0q-0.109375 -1.21875 -0.625 -1.828125q-0.78125 -0.953125 -2.03125 -0.953125q-1.125 0 -1.90625 0.765625q-0.765625 0.75 -0.84375 2.015625zm9.094482 5.765625l0 -13.359375l1.640625 0l0 13.359375l-1.640625 0z" fill-rule="nonzero"/><path fill="#000000" fill-opacity="0.0" d="m626.8167 216.26282l27.433105 0l0 33.039368l-27.433105 0z" fill-rule="evenodd"/><path fill="#000000" d="m631.22003 234.81032l0 -11.484375l1.28125 0l0 1.078125q0.453125 -0.640625 1.015625 -0.953125q0.578125 -0.3125 1.390625 -0.3125q1.0625 0 1.875 0.546875q0.8125 0.546875 1.21875 1.546875q0.421875 0.984375 0.421875 2.171875q0 1.28125 -0.46875 2.296875q-0.453125 1.015625 -1.328125 1.5625q-0.859375 0.546875 -1.828125 0.546875q-0.703125 0 -1.265625 -0.296875q-0.546875 -0.296875 -0.90625 -0.75l0 4.046875l-1.40625 0zm1.265625 -7.296875q0 1.609375 0.640625 2.375q0.65625 0.765625 1.578125 0.765625q0.9375 0 1.609375 -0.796875q0.671875 -0.796875 0.671875 -2.453125q0 -1.59375 -0.65625 -2.375q-0.65625 -0.796875 -1.5625 -0.796875q-0.890625 0 -1.59375 0.84375q-0.6875 0.84375 -0.6875 2.4375z" fill-rule="nonzero"/><path fill="#000000" d="m643.36847 236.93532q-0.53125 0.453125 -1.015625 0.640625q-0.46875 0.171875 -1.015625 0.171875q-0.921875 0 -1.40625 -0.4375q-0.484375 -0.453125 -0.484375 -1.140625q0 -0.40625 0.171875 -0.734375q0.1875 -0.34375 0.484375 -0.546875q0.3125 -0.203125 0.6875 -0.3125q0.265625 -0.0625 0.828125 -0.140625q1.125 -0.125 1.671875 -0.3125q0 -0.203125 0 -0.25q0 -0.578125 -0.265625 -0.8125q-0.359375 -0.3125 -1.0625 -0.3125q-0.65625 0 -0.984375 0.234375q-0.3125 0.234375 -0.453125 0.8125l-0.921875 -0.125q0.125 -0.578125 0.40625 -0.9375q0.296875 -0.375 0.828125 -0.5625q0.546875 -0.203125 1.25 -0.203125q0.71875 0 1.15625 0.171875q0.4375 0.171875 0.640625 0.421875q0.21875 0.25 0.296875 0.640625q0.046875 0.234375 0.046875 0.859375l0 1.25q0 1.296875 0.0625 1.65625q0.0625 0.34375 0.234375 0.65625l-0.96875 0q-0.15625 -0.296875 -0.1875 -0.6875zm-0.078125 -2.078125q-0.515625 0.203125 -1.53125 0.34375q-0.578125 0.078125 -0.828125 0.1875q-0.234375 0.109375 -0.359375 0.3125q-0.125 0.1875 -0.125 0.4375q0 0.375 0.28125 0.625q0.28125 0.25 0.828125 0.25q0.53125 0 0.953125 -0.234375q0.421875 -0.234375 0.625 -0.65625q0.15625 -0.3125 0.15625 -0.9375l0 -0.328125zm7.0515137 1.859375l0 0.90625l-5.03125 0q-0.015625 -0.34375 0.109375 -0.65625q0.1875 -0.515625 0.609375 -1.015625q0.421875 -0.5 1.234375 -1.140625q1.234375 -1.03125 1.671875 -1.625q0.4375 -0.59375 0.4375 -1.125q0 -0.5625 -0.40625 -0.9375q-0.390625 -0.390625 -1.03125 -0.390625q-0.671875 0 -1.078125 0.40625q-0.40625 0.40625 -0.40625 1.125l-0.96875 -0.09375q0.09375 -1.078125 0.734375 -1.640625q0.65625 -0.5625 1.734375 -0.5625q1.109375 0 1.75 0.609375q0.640625 0.609375 0.640625 1.5q0 0.46875 -0.1875 0.90625q-0.1875 0.4375 -0.625 0.9375q-0.4375 0.484375 -1.453125 1.328125q-0.828125 0.71875 -1.078125 0.96875q-0.234375 0.25 -0.390625 0.5l3.734375 0z" fill-rule="nonzero"/><path fill="#000000" fill-opacity="0.0" d="m237.36482 344.70865l106.20473 0l0 72.346466l-106.20473 0z" fill-rule="evenodd"/><path fill="#000000" d="m260.99887 366.94116l1.765625 0.453125q-0.5625 2.171875 -2.0 3.328125q-1.4375 1.140625 -3.53125 1.140625q-2.1562347 0 -3.5156097 -0.875q-1.34375 -0.890625 -2.0625 -2.546875q-0.703125 -1.671875 -0.703125 -3.59375q0 -2.078125 0.796875 -3.625q0.796875 -1.5625 2.265625 -2.359375q1.484375 -0.8125 3.2499847 -0.8125q2.0 0 3.359375 1.015625q1.375 1.015625 1.90625 2.875l-1.734375 0.40625q-0.46875 -1.453125 -1.359375 -2.109375q-0.875 -0.671875 -2.203125 -0.671875q-1.5468597 0 -2.5781097 0.734375q-1.03125 0.734375 -1.453125 1.984375q-0.421875 1.234375 -0.421875 2.5625q0 1.703125 0.5 2.96875q0.5 1.265625 1.546875 1.90625q1.046875 0.625 2.2656097 0.625q1.484375 0 2.515625 -0.859375q1.03125 -0.859375 1.390625 -2.546875zm3.1292114 -0.15625q0 -2.6875 1.484375 -3.96875q1.25 -1.078125 3.046875 -1.078125q2.0 0 3.265625 1.3125q1.265625 1.296875 1.265625 3.609375q0 1.859375 -0.5625 2.9375q-0.5625 1.0625 -1.640625 1.65625q-1.0625 0.59375 -2.328125 0.59375q-2.03125 0 -3.28125 -1.296875q-1.25 -1.3125 -1.25 -3.765625zm1.6875 0q0 1.859375 0.796875 2.796875q0.8125 0.921875 2.046875 0.921875q1.21875 0 2.03125 -0.921875q0.8125 -0.9375 0.8125 -2.84375q0 -1.796875 -0.8125 -2.71875q-0.8125 -0.921875 -2.03125 -0.921875q-1.234375 0 -2.046875 0.921875q-0.796875 0.90625 -0.796875 2.765625zm9.297577 4.84375l0 -9.671875l1.46875 0l0 1.359375q0.453125 -0.71875 1.203125 -1.140625q0.765625 -0.4375 1.71875 -0.4375q1.078125 0 1.765625 0.453125q0.6875 0.4375 0.96875 1.234375q1.15625 -1.6875 2.984375 -1.6875q1.453125 0 2.21875 0.796875q0.78125 0.796875 0.78125 2.453125l0 6.640625l-1.640625 0l0 -6.09375q0 -0.984375 -0.15625 -1.40625q-0.15625 -0.4375 -0.578125 -0.703125q-0.421875 -0.265625 -0.984375 -0.265625q-1.015625 0 -1.6875 0.6875q-0.671875 0.671875 -0.671875 2.15625l0 5.625l-1.640625 0l0 -6.28125q0 -1.09375 -0.40625 -1.640625q-0.40625 -0.546875 -1.3125 -0.546875q-0.6875 0 -1.28125 0.359375q-0.59375 0.359375 -0.859375 1.0625q-0.25 0.703125 -0.25 2.03125l0 5.015625l-1.640625 0zm17.040802 0l-1.515625 0l0 -13.359375l1.640625 0l0 4.765625q1.046875 -1.296875 2.65625 -1.296875q0.890625 0 1.6875 0.359375q0.796875 0.359375 1.3125 1.015625q0.515625 0.640625 0.796875 1.5625q0.296875 0.921875 0.296875 1.96875q0 2.484375 -1.234375 3.84375q-1.21875 1.359375 -2.953125 1.359375q-1.703125 0 -2.6875 -1.4375l0 1.21875zm-0.015625 -4.90625q0 1.734375 0.484375 2.515625q0.765625 1.265625 2.09375 1.265625q1.078125 0 1.859375 -0.9375q0.78125 -0.9375 0.78125 -2.78125q0 -1.890625 -0.75 -2.796875q-0.75 -0.90625 -1.828125 -0.90625q-1.0625 0 -1.859375 0.9375q-0.78125 0.9375 -0.78125 2.703125zm8.891357 -6.5625l0 -1.890625l1.640625 0l0 1.890625l-1.640625 0zm0 11.46875l0 -9.671875l1.640625 0l0 9.671875l-1.640625 0zm4.144806 0l0 -9.671875l1.46875 0l0 1.375q1.0625 -1.59375 3.078125 -1.59375q0.875 0 1.609375 0.3125q0.734375 0.3125 1.09375 0.828125q0.375 0.5 0.515625 1.203125q0.09375 0.453125 0.09375 1.59375l0 5.953125l-1.640625 0l0 -5.890625q0 -1.0 -0.203125 -1.484375q-0.1875 -0.5 -0.671875 -0.796875q-0.484375 -0.296875 -1.140625 -0.296875q-1.046875 0 -1.8125 0.671875q-0.75 0.65625 -0.75 2.515625l0 5.28125l-1.640625 0zm17.000732 -3.109375l1.6875 0.203125q-0.40625 1.484375 -1.484375 2.3125q-1.078125 0.8125 -2.765625 0.8125q-2.125 0 -3.375 -1.296875q-1.234375 -1.3125 -1.234375 -3.671875q0 -2.453125 1.25 -3.796875q1.265625 -1.34375 3.265625 -1.34375q1.9375 0 3.15625 1.328125q1.234375 1.3125 1.234375 3.703125q0 0.15625 0 0.4375l-7.21875 0q0.09375 1.59375 0.90625 2.453125q0.8125 0.84375 2.015625 0.84375q0.90625 0 1.546875 -0.46875q0.640625 -0.484375 1.015625 -1.515625zm-5.390625 -2.65625l5.40625 0q-0.109375 -1.21875 -0.625 -1.828125q-0.78125 -0.953125 -2.03125 -0.953125q-1.125 0 -1.90625 0.765625q-0.765625 0.75 -0.84375 2.015625zm9.125702 5.765625l0 -9.671875l1.46875 0l0 1.46875q0.5625 -1.03125 1.03125 -1.359375q0.484375 -0.328125 1.0625 -0.328125q0.828125 0 1.6875 0.53125l-0.5625 1.515625q-0.609375 -0.359375 -1.203125 -0.359375q-0.546875 0 -0.96875 0.328125q-0.421875 0.328125 -0.609375 0.890625q-0.28125 0.875 -0.28125 1.921875l0 5.0625l-1.625 0z" fill-rule="nonzero"/><path fill="#000000" d="m250.59915 390.73804l1.625 -0.25q0.125 0.96875 0.75 1.5q0.625 0.515625 1.75 0.515625q1.125 0 1.671875 -0.453125q0.546875 -0.46875 0.546875 -1.09375q0 -0.546875 -0.484375 -0.875q-0.328125 -0.21875 -1.671875 -0.546875q-1.8125 -0.46875 -2.515625 -0.796875q-0.6875 -0.328125 -1.046875 -0.90625q-0.359375 -0.59375 -0.359375 -1.3125q0 -0.640625 0.296875 -1.1875q0.296875 -0.5625 0.8125 -0.921875q0.375 -0.28125 1.03125 -0.46875q0.671875 -0.203125 1.421875 -0.203125q1.140625 0 2.0 0.328125q0.859375 0.328125 1.265625 0.890625q0.421875 0.5625 0.578125 1.5l-1.609375 0.21875q-0.109375 -0.75 -0.640625 -1.171875q-0.515625 -0.421875 -1.46875 -0.421875q-1.140625 0 -1.625 0.375q-0.46875 0.375 -0.46875 0.875q0 0.3125 0.1875 0.578125q0.203125 0.265625 0.640625 0.4375q0.234375 0.09375 1.4375 0.421875q1.75 0.453125 2.4375 0.75q0.6875 0.296875 1.078125 0.859375q0.390625 0.5625 0.390625 1.40625q0 0.828125 -0.484375 1.546875q-0.46875 0.71875 -1.375 1.125q-0.90625 0.390625 -2.046875 0.390625q-1.875 0 -2.875 -0.78125q-0.984375 -0.78125 -1.25 -2.328125zm16.3125 2.890625l0 -1.421875q-1.125 1.640625 -3.0625 1.640625q-0.859375 0 -1.609375 -0.328125q-0.734375 -0.328125 -1.09375 -0.828125q-0.359375 -0.5 -0.5 -1.21875q-0.109375 -0.46875 -0.109375 -1.53125l0 -5.984375l1.640625 0l0 5.359375q0 1.28125 0.109375 1.734375q0.15625 0.640625 0.65625 1.015625q0.5 0.375 1.234375 0.375q0.734375 0 1.375 -0.375q0.65625 -0.390625 0.921875 -1.03125q0.265625 -0.65625 0.265625 -1.890625l0 -5.1875l1.640625 0l0 9.671875l-1.46875 0zm5.547577 0l-1.515625 0l0 -13.359375l1.640625 0l0 4.765625q1.046875 -1.296875 2.65625 -1.296875q0.890625 0 1.6875 0.359375q0.796875 0.359375 1.3125 1.015625q0.515625 0.640625 0.796875 1.5625q0.296875 0.921875 0.296875 1.96875q0 2.484375 -1.234375 3.84375q-1.21875 1.359375 -2.953125 1.359375q-1.703125 0 -2.6875 -1.4375l0 1.21875zm-0.015625 -4.90625q0 1.734375 0.484375 2.515625q0.765625 1.265625 2.09375 1.265625q1.078125 0 1.859375 -0.9375q0.78125 -0.9375 0.78125 -2.78125q0 -1.890625 -0.75 -2.796875q-0.75 -0.90625 -1.828125 -0.90625q-1.0625 0 -1.859375 0.9375q-0.78125 0.9375 -0.78125 2.703125zm8.891357 4.90625l0 -9.671875l1.46875 0l0 1.359375q0.453125 -0.71875 1.203125 -1.140625q0.765625 -0.4375 1.71875 -0.4375q1.078125 0 1.765625 0.453125q0.6875 0.4375 0.96875 1.234375q1.15625 -1.6875 2.984375 -1.6875q1.453125 0 2.21875 0.796875q0.78125 0.796875 0.78125 2.453125l0 6.640625l-1.640625 0l0 -6.09375q0 -0.984375 -0.15625 -1.40625q-0.15625 -0.4375 -0.578125 -0.703125q-0.421875 -0.265625 -0.984375 -0.265625q-1.015625 0 -1.6875 0.6875q-0.671875 0.671875 -0.671875 2.15625l0 5.625l-1.640625 0l0 -6.28125q0 -1.09375 -0.40625 -1.640625q-0.40625 -0.546875 -1.3125 -0.546875q-0.6875 0 -1.28125 0.359375q-0.59375 0.359375 -0.859375 1.0625q-0.25 0.703125 -0.25 2.03125l0 5.015625l-1.640625 0zm14.931427 -4.84375q0 -2.6875 1.484375 -3.96875q1.25 -1.078125 3.046875 -1.078125q2.0 0 3.265625 1.3125q1.265625 1.296875 1.265625 3.609375q0 1.859375 -0.5625 2.9375q-0.5625 1.0625 -1.640625 1.65625q-1.0625 0.59375 -2.328125 0.59375q-2.03125 0 -3.28125 -1.296875q-1.25 -1.3125 -1.25 -3.765625zm1.6875 0q0 1.859375 0.796875 2.796875q0.8125 0.921875 2.046875 0.921875q1.21875 0 2.03125 -0.921875q0.8125 -0.9375 0.8125 -2.84375q0 -1.796875 -0.8125 -2.71875q-0.8125 -0.921875 -2.03125 -0.921875q-1.234375 0 -2.046875 0.921875q-0.796875 0.90625 -0.796875 2.765625zm15.563202 4.84375l0 -1.21875q-0.90625 1.4375 -2.703125 1.4375q-1.15625 0 -2.125 -0.640625q-0.96875 -0.640625 -1.5 -1.78125q-0.53125 -1.140625 -0.53125 -2.625q0 -1.453125 0.484375 -2.625q0.484375 -1.1875 1.4375 -1.8125q0.96875 -0.625 2.171875 -0.625q0.875 0 1.546875 0.375q0.6875 0.359375 1.109375 0.953125l0 -4.796875l1.640625 0l0 13.359375l-1.53125 0zm-5.171875 -4.828125q0 1.859375 0.78125 2.78125q0.78125 0.921875 1.84375 0.921875q1.078125 0 1.828125 -0.875q0.75 -0.890625 0.75 -2.6875q0 -1.984375 -0.765625 -2.90625q-0.765625 -0.9375 -1.890625 -0.9375q-1.078125 0 -1.8125 0.890625q-0.734375 0.890625 -0.734375 2.8125zm15.906982 1.71875l1.6875 0.203125q-0.40625 1.484375 -1.484375 2.3125q-1.078125 0.8125 -2.765625 0.8125q-2.125 0 -3.375 -1.296875q-1.234375 -1.3125 -1.234375 -3.671875q0 -2.453125 1.25 -3.796875q1.265625 -1.34375 3.265625 -1.34375q1.9375 0 3.15625 1.328125q1.234375 1.3125 1.234375 3.703125q0 0.15625 0 0.4375l-7.21875 0q0.09375 1.59375 0.90625 2.453125q0.8125 0.84375 2.015625 0.84375q0.90625 0 1.546875 -0.46875q0.640625 -0.484375 1.015625 -1.515625zm-5.390625 -2.65625l5.40625 0q-0.109375 -1.21875 -0.625 -1.828125q-0.78125 -0.953125 -2.03125 -0.953125q-1.125 0 -1.90625 0.765625q-0.765625 0.75 -0.84375 2.015625zm9.094452 5.765625l0 -13.359375l1.640625 0l0 13.359375l-1.640625 0z" fill-rule="nonzero"/><path fill="#000000" fill-opacity="0.0" d="m473.76218 445.88763l70.677155 0l0 33.039368l-70.677155 0z" fill-rule="evenodd"/><path fill="#000000" d="m482.6116 464.43512l0 -11.484375l1.28125 0l0 1.078125q0.453125 -0.640625 1.015625 -0.953125q0.578125 -0.3125 1.390625 -0.3125q1.0625 0 1.875 0.546875q0.8125 0.546875 1.21875 1.546875q0.421875 0.984375 0.421875 2.171875q0 1.28125 -0.46875 2.296875q-0.453125 1.015625 -1.328125 1.5625q-0.859375 0.546875 -1.828125 0.546875q-0.703125 0 -1.265625 -0.296875q-0.546875 -0.296875 -0.90625 -0.75l0 4.046875l-1.40625 0zm1.265625 -7.296875q0 1.609375 0.640625 2.375q0.65625 0.765625 1.578125 0.765625q0.9375 0 1.609375 -0.796875q0.671875 -0.796875 0.671875 -2.453125q0 -1.59375 -0.65625 -2.375q-0.65625 -0.796875 -1.5625 -0.796875q-0.890625 0 -1.59375 0.84375q-0.6875 0.84375 -0.6875 2.4375z" fill-rule="nonzero"/><path fill="#000000" d="m494.76004 465.21637l0.921875 0.125q-0.15625 0.953125 -0.78125 1.5q-0.625 0.53125 -1.53125 0.53125q-1.125 0 -1.8125 -0.734375q-0.6875 -0.75 -0.6875 -2.125q0 -0.90625 0.296875 -1.578125q0.296875 -0.671875 0.890625 -1.0q0.609375 -0.34375 1.328125 -0.34375q0.890625 0 1.46875 0.46875q0.578125 0.453125 0.734375 1.28125l-0.90625 0.140625q-0.140625 -0.546875 -0.46875 -0.828125q-0.328125 -0.28125 -0.796875 -0.28125q-0.703125 0 -1.15625 0.515625q-0.4375 0.5 -0.4375 1.59375q0 1.109375 0.421875 1.625q0.4375 0.5 1.125 0.5q0.546875 0 0.90625 -0.34375q0.375 -0.34375 0.484375 -1.046875zm1.375 -0.734375q0 -1.53125 0.84375 -2.265625q0.71875 -0.625 1.734375 -0.625q1.140625 0 1.859375 0.75q0.734375 0.75 0.734375 2.0625q0 1.0625 -0.328125 1.6875q-0.3125 0.609375 -0.921875 0.953125q-0.609375 0.328125 -1.34375 0.328125q-1.15625 0 -1.875 -0.734375q-0.703125 -0.75 -0.703125 -2.15625zm0.953125 0q0 1.0625 0.46875 1.59375q0.46875 0.53125 1.15625 0.53125q0.703125 0 1.15625 -0.53125q0.46875 -0.53125 0.46875 -1.625q0 -1.015625 -0.46875 -1.546875q-0.453125 -0.53125 -1.15625 -0.53125q-0.6875 0 -1.15625 0.53125q-0.46875 0.515625 -0.46875 1.578125zm5.3171387 2.765625l0 -5.53125l0.84375 0l0 0.78125q0.25 -0.40625 0.6875 -0.65625q0.4375 -0.25 0.984375 -0.25q0.609375 0 1.0 0.265625q0.390625 0.25 0.5625 0.703125q0.65625 -0.96875 1.703125 -0.96875q0.828125 0 1.265625 0.46875q0.4375 0.453125 0.4375 1.390625l0 3.796875l-0.921875 0l0 -3.484375q0 -0.5625 -0.09375 -0.796875q-0.09375 -0.25 -0.34375 -0.40625q-0.234375 -0.15625 -0.546875 -0.15625q-0.59375 0 -0.984375 0.390625q-0.375 0.390625 -0.375 1.25l0 3.203125l-0.9375 0l0 -3.59375q0 -0.625 -0.234375 -0.9375q-0.21875 -0.3125 -0.75 -0.3125q-0.390625 0 -0.734375 0.21875q-0.328125 0.203125 -0.484375 0.609375q-0.140625 0.390625 -0.140625 1.15625l0 2.859375l-0.9375 0zm9.7361145 0l-0.859375 0l0 -7.625l0.9375 0l0 2.71875q0.59375 -0.75 1.5 -0.75q0.515625 0 0.96875 0.21875q0.453125 0.203125 0.75 0.578125q0.296875 0.359375 0.453125 0.890625q0.171875 0.53125 0.171875 1.125q0 1.421875 -0.703125 2.203125q-0.703125 0.765625 -1.6875 0.765625q-0.96875 0 -1.53125 -0.8125l0 0.6875zm0 -2.796875q0 0.984375 0.265625 1.421875q0.4375 0.734375 1.1875 0.734375q0.625 0 1.0625 -0.53125q0.453125 -0.546875 0.453125 -1.59375q0 -1.078125 -0.4375 -1.59375q-0.421875 -0.515625 -1.03125 -0.515625q-0.609375 0 -1.0625 0.53125q-0.4375 0.53125 -0.4375 1.546875zm5.0671387 -3.75l0 -1.078125l0.9375 0l0 1.078125l-0.9375 0zm0 6.546875l0 -5.53125l0.9375 0l0 5.53125l-0.9375 0zm2.3674316 0l0 -5.53125l0.84375 0l0 0.796875q0.609375 -0.921875 1.75 -0.921875q0.5 0 0.921875 0.1875q0.421875 0.171875 0.625 0.46875q0.21875 0.296875 0.296875 0.6875q0.046875 0.265625 0.046875 0.921875l0 3.390625l-0.9375 0l0 -3.359375q0 -0.578125 -0.109375 -0.859375q-0.109375 -0.28125 -0.390625 -0.453125q-0.265625 -0.171875 -0.640625 -0.171875q-0.59375 0 -1.03125 0.390625q-0.4375 0.375 -0.4375 1.4375l0 3.015625l-0.9375 0zm9.707764 -1.78125l0.96875 0.125q-0.234375 0.84375 -0.859375 1.3125q-0.609375 0.46875 -1.578125 0.46875q-1.203125 0 -1.921875 -0.75q-0.703125 -0.75 -0.703125 -2.09375q0 -1.390625 0.71875 -2.15625q0.71875 -0.78125 1.859375 -0.78125q1.109375 0 1.8125 0.765625q0.703125 0.75 0.703125 2.125q0 0.078125 0 0.234375l-4.125 0q0.046875 0.921875 0.515625 1.40625q0.46875 0.484375 1.15625 0.484375q0.515625 0 0.875 -0.265625q0.359375 -0.28125 0.578125 -0.875zm-3.078125 -1.515625l3.09375 0q-0.0625 -0.6875 -0.359375 -1.046875q-0.453125 -0.53125 -1.15625 -0.53125q-0.640625 0 -1.09375 0.4375q-0.4375 0.421875 -0.484375 1.140625zm8.801514 3.296875l0 -0.703125q-0.515625 0.828125 -1.546875 0.828125q-0.65625 0 -1.21875 -0.359375q-0.546875 -0.375 -0.859375 -1.015625q-0.296875 -0.65625 -0.296875 -1.5q0 -0.828125 0.28125 -1.5q0.28125 -0.6875 0.828125 -1.046875q0.546875 -0.359375 1.234375 -0.359375q0.5 0 0.890625 0.21875q0.390625 0.203125 0.625 0.546875l0 -2.734375l0.9375 0l0 7.625l-0.875 0zm-2.953125 -2.75q0 1.046875 0.4375 1.578125q0.453125 0.53125 1.0625 0.53125q0.609375 0 1.03125 -0.5q0.4375 -0.515625 0.4375 -1.53125q0 -1.140625 -0.4375 -1.671875q-0.4375 -0.53125 -1.078125 -0.53125q-0.609375 0 -1.03125 0.515625q-0.421875 0.5 -0.421875 1.609375z" fill-rule="nonzero"/><path fill="#000000" fill-opacity="0.0" d="m55.559402 39.82314l163.87401 0l0 36.56693l-163.87401 0z" fill-rule="evenodd"/><path fill="#000000" d="m65.95003 66.74313l0 -13.359371l2.65625 0l3.15625 9.453125q0.4375 1.3281212 0.640625 1.9843712q0.234375 -0.734375 0.703125 -2.1406212l3.203125 -9.296875l2.375 0l0 13.359371l-1.703125 0l0 -11.171871l-3.875 11.171871l-1.59375 0l-3.859375 -11.374996l0 11.374996l-1.703125 0zm22.009552 -3.1093712l1.6875 0.203125q-0.40625 1.4843712 -1.484375 2.3124962q-1.078125 0.8125 -2.765625 0.8125q-2.125 0 -3.375 -1.296875q-1.234375 -1.3125 -1.234375 -3.6718712q0 -2.453125 1.25 -3.796875q1.265625 -1.34375 3.265625 -1.34375q1.9375 0 3.15625 1.328125q1.234375 1.3125 1.234375 3.703125q0 0.15625 0 0.4375l-7.21875 0q0.09375 1.59375 0.90625 2.4531212q0.8125 0.84375 2.015625 0.84375q0.90625 0 1.546875 -0.46875q0.640625 -0.484375 1.015625 -1.5156212zm-5.390625 -2.65625l5.40625 0q-0.109375 -1.21875 -0.625 -1.828125q-0.78125 -0.953125 -2.03125 -0.953125q-1.125 0 -1.90625 0.765625q-0.765625 0.75 -0.84375 2.015625zm12.719467 4.296871l0.234375 1.453125q-0.6875 0.140625 -1.234375 0.140625q-0.890625 0 -1.390625 -0.28125q-0.484375 -0.28125 -0.6875 -0.734375q-0.203125 -0.46875 -0.203125 -1.9374962l0 -5.578125l-1.203125 0l0 -1.265625l1.203125 0l0 -2.390625l1.625 -0.984375l0 3.375l1.65625 0l0 1.265625l-1.65625 0l0 5.671871q0 0.6875 0.078125 0.890625q0.09375 0.203125 0.28125 0.328125q0.203125 0.109375 0.578125 0.109375q0.265625 0 0.71875 -0.0625zm7.917679 0.28125q-0.921875 0.765625 -1.765625 1.09375q-0.828125 0.3125 -1.796875 0.3125q-1.59375 0 -2.453125 -0.78125q-0.859375 -0.78125 -0.859375 -1.984375q0 -0.7187462 0.328125 -1.2968712q0.328125 -0.59375 0.84375 -0.9375q0.53125 -0.359375 1.1875 -0.546875q0.46875 -0.125 1.453125 -0.25q1.984375 -0.234375 2.921875 -0.5625q0.015625 -0.34375 0.015625 -0.421875q0 -1.0 -0.46875 -1.421875q-0.625 -0.546875 -1.875 -0.546875q-1.15625 0 -1.703125 0.40625q-0.546875 0.40625 -0.8125 1.421875l-1.609375 -0.21875q0.21875 -1.015625 0.71875 -1.640625q0.5 -0.640625 1.453125 -0.984375q0.953125 -0.34375 2.1875 -0.34375q1.25 0 2.015625 0.296875q0.78125 0.28125 1.140625 0.734375q0.375 0.4375 0.515625 1.109375q0.078125 0.421875 0.078125 1.515625l0 2.1875q0 2.2812462 0.109375 2.8906212q0.109375 0.59375 0.40625 1.15625l-1.703125 0q-0.265625 -0.515625 -0.328125 -1.1875zm-0.140625 -3.6718712q-0.890625 0.375 -2.671875 0.625q-1.015625 0.140625 -1.4375 0.328125q-0.421875 0.1875 -0.65625 0.53125q-0.21875 0.34375 -0.21875 0.7812462q0 0.65625 0.5 1.09375q0.5 0.4375 1.453125 0.4375q0.9375 0 1.671875 -0.40625q0.75 -0.421875 1.09375 -1.140625q0.265625 -0.5624962 0.265625 -1.6406212l0 -0.609375zm3.5632172 0.84375l0 -1.640625l5.03125 0l0 1.640625l-5.03125 0zm6.853302 4.015621l0 -9.671871l1.46875 0l0 1.359375q0.453125 -0.71875 1.203125 -1.140625q0.765625 -0.4375 1.71875 -0.4375q1.078125 0 1.765625 0.453125q0.6875 0.4375 0.96875 1.234375q1.15625 -1.6875 2.984375 -1.6875q1.453125 0 2.21875 0.796875q0.78125 0.796875 0.78125 2.453125l0 6.640621l-1.640625 0l0 -6.093746q0 -0.984375 -0.15625 -1.40625q-0.15625 -0.4375 -0.578125 -0.703125q-0.421875 -0.265625 -0.984375 -0.265625q-1.015625 0 -1.6875 0.6875q-0.671875 0.671875 -0.671875 2.15625l0 5.624996l-1.640625 0l0 -6.281246q0 -1.09375 -0.40625 -1.640625q-0.40625 -0.546875 -1.3125 -0.546875q-0.6875 0 -1.28125 0.359375q-0.59375 0.359375 -0.859375 1.0625q-0.25 0.703125 -0.25 2.03125l0 5.015621l-1.640625 0zm14.931427 -4.843746q0 -2.6875 1.484375 -3.96875q1.25 -1.078125 3.046875 -1.078125q2.0 0 3.265625 1.3125q1.265625 1.296875 1.265625 3.609375q0 1.859375 -0.5625 2.9374962q-0.5625 1.0625 -1.640625 1.65625q-1.0625 0.59375 -2.328125 0.59375q-2.03125 0 -3.28125 -1.296875q-1.25 -1.3125 -1.25 -3.7656212zm1.6875 0q0 1.859375 0.796875 2.7968712q0.8125 0.921875 2.046875 0.921875q1.21875 0 2.03125 -0.921875q0.8125 -0.9374962 0.8125 -2.8437462q0 -1.796875 -0.8125 -2.71875q-0.8125 -0.921875 -2.03125 -0.921875q-1.234375 0 -2.046875 0.921875q-0.796875 0.90625 -0.796875 2.765625zm15.563217 4.843746l0 -1.21875q-0.90625 1.4375 -2.703125 1.4375q-1.15625 0 -2.125 -0.640625q-0.96875 -0.640625 -1.5 -1.78125q-0.53125 -1.1406212 -0.53125 -2.6249962q0 -1.453125 0.484375 -2.625q0.484375 -1.1875 1.4375 -1.8125q0.96875 -0.625 2.171875 -0.625q0.875 0 1.546875 0.375q0.6875 0.359375 1.109375 0.953125l0 -4.796875l1.640625 0l0 13.359371l-1.53125 0zm-5.171875 -4.828121q0 1.859375 0.78125 2.7812462q0.78125 0.921875 1.84375 0.921875q1.078125 0 1.828125 -0.875q0.75 -0.8906212 0.75 -2.6874962q0 -1.984375 -0.765625 -2.90625q-0.765625 -0.9375 -1.890625 -0.9375q-1.078125 0 -1.8125 0.890625q-0.734375 0.890625 -0.734375 2.8125zm15.906967 1.71875l1.6875 0.203125q-0.40625 1.4843712 -1.484375 2.3124962q-1.078125 0.8125 -2.765625 0.8125q-2.125 0 -3.375 -1.296875q-1.234375 -1.3125 -1.234375 -3.6718712q0 -2.453125 1.25 -3.796875q1.265625 -1.34375 3.265625 -1.34375q1.9375 0 3.15625 1.328125q1.234375 1.3125 1.234375 3.703125q0 0.15625 0 0.4375l-7.21875 0q0.09375 1.59375 0.90625 2.4531212q0.8125 0.84375 2.015625 0.84375q0.90625 0 1.546875 -0.46875q0.640625 -0.484375 1.015625 -1.5156212zm-5.390625 -2.65625l5.40625 0q-0.109375 -1.21875 -0.625 -1.828125q-0.78125 -0.953125 -2.03125 -0.953125q-1.125 0 -1.90625 0.765625q-0.765625 0.75 -0.84375 2.015625zm9.094467 5.765621l0 -13.359371l1.640625 0l0 13.359371l-1.640625 0z" fill-rule="nonzero"/><path fill="#000000" fill-opacity="0.0" d="m617.0439 235.43832l-105.85828 61.606293" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m617.0439 235.43832l-105.85828 61.606293" fill-rule="evenodd"/><path fill="#000000" fill-opacity="0.0" d="m328.69742 235.43832l103.02362 61.35434" fill-rule="evenodd"/><path stroke="#595959" stroke-width="1.0" stroke-linejoin="round" stroke-linecap="butt" d="m328.69742 235.43832l103.02362 61.35434" fill-rule="evenodd"/></g></svg>
\ No newline at end of file
../../submodules/presentation-pics/pics/sanger_trace.jpg
\ No newline at end of file
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment