Commit b53d7346 authored by Mihai's avatar Mihai

Merge branch 'biopython-2018' into 'master'

Biopython 2018

See merge request !5
parents bea75ce7 c3261aa9
This diff is collapsed.
>NM_000207.2 Homo sapiens insulin (INS), transcript variant 1, mRNA
AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGATCACTGTCCTTCTGCCATGGCCCTGTG
GATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAAC
CAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACA
CACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGC
AGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACC
AGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCACACCCG
CCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGCAAAA
>NM_001008996.2 Pan troglodytes insulin (INS), mRNA
AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGATCACTGTCCTTCTGCCATGGCCCTGTG
GATGCGCCTCCTGCCCCTGCTGGTGCTGCTGGCCCTCTGGGGACCTGACCCAGCCTCGGCCTTTGTGAAC
CAACACCTGTGCGGCTCCCACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACA
CACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGC
AGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGTATCGTGGAACAATGCTGTACC
AGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGATGGAATAAAGCCCTTGAACCAGC
>NM_001185083.2 Mus musculus insulin II (Ins2), transcript variant 1, mRNA
GGGGACCCAGTAACCACCAGCCCTAAGTGATCCGCTACAATCAAAAACCATCAGCAAGCAGGAAGGTTAT
TGTTTCAACATGGCCCTGTGGATGCGCTTCCTGCCCCTGCTGGCCCTGCTCTTCCTCTGGGAGTCCCACC
CCACCCAGGCTTTTGTCAAGCAGCACCTTTGTGGTTCCCACCTGGTGGAGGCTCTCTACCTGGTGTGTGG
GGAGCGTGGCTTCTTCTACACACCCATGTCCCGCCGTGAAGTGGAGGACCCACAAGTGGCACAACTGGAG
CTGGGTGGAGGCCCGGGAGCAGGTGACCTTCAGACCTTGGCACTGGAGGTGGCCCAGCAGAAGCGTGGCA
TTGTAGATCAGTGCTGCACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACCCACCA
CTACCCAGCCTACCCCTCTGCAATGAATAAAACCTTTGAATGAGCACAAAAAA
>NM_019130.2 Rattus norvegicus insulin 2 (Ins2), mRNA
AGCCCTAAGTGACCAGCTACAGTCGGAAACCATCAGCAAGCAGGTCATTGTTCCAACATGGCCCTGTGGA
TCCGCTTCCTGCCCCTGCTGGCCCTGCTCATCCTCTGGGAGCCCCGCCCTGCCCAGGCTTTTGTCAAACA
GCACCTTTGTGGTTCTCACTTGGTGGAAGCTCTCTACCTGGTGTGTGGGGAGCGTGGATTCTTCTACACA
CCCATGTCCCGCCGCGAAGTGGAGGACCCACAAGTGGCACAACTGGAGCTGGGTGGAGGCCCGGGGGCAG
GTGACCTTCAGACCTTGGCACTGGAGGTGGCCCGGCAGAAGCGCGGCATCGTGGATCAGTGCTGCACCAG
CATCTGCTCTCTCTACCAACTGGAGAACTACTGCAACTAGGCCCACCACTACCCTGTCCACCCCTCTGCA
ATGAATAAAACCTTTGAAAGAGCACTACAAAAAAAAAAAAAAAA
>NM_205222.3 Gallus gallus insulin (INS-IGF2), mRNA
ATATAAATATGGGAAAGAGAATGGGGAAATTTCTACCAGTCTTCATCTCTGAGAGCAAACTTCTCTGCAT
CTCTTTCTCTCTTCTCTGGGCCTCCCCCAGCTCATCATGGCTCTCTGGATCCGATCACTGCCTCTTCTGG
CTCTCCTTGTCTTTTCTGGCCCTGGAACCAGCTATGCAGCTGCCAACCAGCACCTCTGTGGCTCCCACTT
GGTGGAGGCTCTCTACCTGGTGTGTGGAGAGCGTGGCTTCTTCTACTCCCCCAAAGCCCGACGGGATGTC
GAGCAGCCCCTAGTGAGCAGTCCCTTGCGTGGCGAGGCAGGAGTGCTGCCTTTCCAGCAGGAGGAATACG
AGAAAGTCAAGCGAGGGATTGTTGAGCAATGCTGCCATAACACGTGTTCCCTCTACCAACTGGAGAACTA
CTGCAACTAGCCAAGAAGCCGGAAGCGGGCACAGACATACACTTACTCTATCGCACCTTCAAAGCATTTG
AATAAACCTTGTTGGTCTACTGGAAGACTTGTGCC
>NM_001100236.1 Xenopus tropicalis insulin (ins), mRNA
CCTCCTTTTGATCTTTCCAGCACTTGTCCAGCTCCCACTATCCTCTATCATGGCTCTTTGGATGCAGTGT
CTGCCCCTGGTACTTGTGCTCCTTTTCTCTACACCCAACACCGAAGCTCTAGCTAACCAACACCTGTGTG
GGTCTCACCTGGTAGAAGCCCTGTATCTAGTATGTGGGGATCGAGGCTTCTTCTACTACCCCAAGATCAA
ACGGGACATCGAACAAGCAATGGTCAATGGACCCCAGGACAACGAGTTGGATGGAATGCAGCTCCAGCCT
CAGGAGTACCAGAAAATGAAGAGGGGAATTGTGGAGCAATGCTGCCACAGCACATGTTCTCTCTTCCAGC
TGGAGAGCTACTGCAACTAGGGGACCAGGCAAATGCTCTCTTACCAAGGCACCTTCAAGGCAAATCCATT
ATGCCAAAACAACAGGACAACGAGCATTGTCTAACGGCACCAAGAACTTCTAACAATGTATATTTATTCC
ATATAAATTAGACATCGGTATCCCAACTAATCTGTTCTTAGTAGAAGGAGTTATATAGAGTAATTCTATG
TGACAGGACAAGAAATATCTGTTATTTTTGCATTTTAATTTGCTCAGAAACCACCACTTTAATGCTACTT
TAACATGGCTGTCATCAGCAAAGTACTGTGCAAGTCGGAAAGACCTTGTTTTAGGAGAGACCGGGCAGGT
TACATTGATAAAGTTCAAAAAAGAAAGTATCTGGAAGAAAAAGAGCCACCCAAAATGTTATTCCGATCTT
GCTTTTAAGTGCCTTGACCTACTGTATTTACTGTCTCTCTGTCTCACTGCAAATAAATGTAAGCTGAAGA
GCTAAAAAAAAAAAAAAAAAAA
>NM_131056.1 Danio rerio preproinsulin (ins), mRNA
CCATATCCACCATTCCTCGCCTCTGCTTCGAGAACAGTGTGACCATGGCAGTGTGGCTTCAGGCTGGTGC
TCTGTTGGTCCTGTTGGTCGTGTCCAGTGTAAGCACTAACCCAGGCACACCGCAGCACCTGTGTGGATCT
CATCTGGTCGATGCCCTTTATCTGGTCTGTGGCCCAACAGGCTTCTTCTACAACCCCAAGAGAGACGTTG
AGCCCCTTCTGGGTTTCCTTCCTCCTAAATCTGCCCAGGAAACTGAGGTGGCTGACTTTGCATTTAAAGA
TCATGCCGAGCTGATAAGGAAGAGAGGCATTGTAGAGCAGTGCTGCCACAAACCCTGCAGCATCTTTGAG
CTGCAGAACTACTGTAACTGAAGAGATTTGCCCACCGCCAATGCCAGAAACACCTGTTTGCACACAGGCC
TTAATGCTCTCCGTTTGTTTTTACAGAAAAAATAAAACTATCAAATGA
\ No newline at end of file
>chr6:57316079-57316087
ccaccacca
>chr7:73761746-73761754
ccgccacca
>chr20:59571443-59571454
aggaggtggagg
>chrY:15809432-15809440
CCACCTCCT
>chr17:40068950-40068958
CCTCCACCT
>chr14:65103070-65103078
CCGCCACCT
>chr19:54239423-54239431
cctccgcct
>chr6:150434480-150434488
CCACCACCG
>chr7:33812110-33812121
tggaggtggagg
>chr5:153717375-153717383
ccaccacca
>chr6:7914979-7914987
ccgcctcct
>chr22:27012040-27012051
aggaggaggagg
>chr3:69390851-69390859
aggaggtgg
>chr9:117615118-117615126
aggaggcgg
>chr15:84899756-84899767
aggaggaggagg
>chr3:129325550-129325561
CGGAggcggcgg
>chr7:137343473-137343481
CCTCCTCCT
>chr9:35997152-35997163
cctccgcctcca
>chr6:35548397-35548405
cctccgcct
>chr9:111229018-111229029
TGGTGGTGGAGG
>chr12:66746168-66746176
aggaggtgg
>chr8:35193429-35193437
ccaccacca
>chr2:100306477-100306485
aggtggagg
>chr4:88917359-88917367
cctccacct
>chr3:72299621-72299629
tggaggtgg
>chr7:6140042-6140053
cctccgcctcct
>chr1:30429604-30429612
CCACCACCT
>chr9:84454516-84454524
ccaccacca
>chr4:24681618-24681626
tggtggcgg
>chr6:39016541-39016549
CCGCCACCA
>chr19:47957834-47957845
aggaggtggagg
>chr2:121438697-121438705
CCACCACCG
>chr4:6606145-6606153
AGGCGGTGG
>chr10:54496597-54496605
CCACCACCA
>chr1:121283711-121283719
tggtggcgg
>chr15:83623612-83623620
cctccgcct
>chr10:96161580-96161588
ccgccacca
>chrX:153674870-153674878
aggaggCGG
>chr7:116353954-116353962
CCACCTCCA
>chr3:44738060-44738068
aggtggagg
>chr14:88795532-88795540
CCACCTCCT
>chr1:24149591-24149602
aggaggaggagg
>chr1:26463722-26463730
aggtggagg
>chrX:70882170-70882178
CCTCCACCT
>chr2:138133373-138133381
TGGAGGAGG
>chr5:179540966-179540974
tggaggagg
>chr12:108703822-108703833
tggaggaggtgg
>chr15:59788732-59788740
aggcggagg
>chr12:48567647-48567655
aggcggagg
>chr11:118709199-118709210
cctccacctcct
>chr16:83742554-83742565
aggaggcggagg
>chr21:21636262-21636270
aggcggagg
>chr16:66928929-66928937
AGGCGGAGG
>chr14:56018822-56018830
ccgccacca
>chr16:78283154-78283162
ccgcctcca
>chr17:27620974-27620985
tggtggtggtgg
>chr20:40577705-40577713
ccacctcct
>chrX:88694903-88694911
TGGAGGTGG
>chr1:12630736-12630744
AGGTGGAGG
>chr12:47635287-47635295
ccgccacca
>chr14:104575359-104575370
TGGAGGTGGTGG
>chr14:82091013-82091021
CCTCCTCCT
>chr7:138971990-138971998
CCTCCTCCT
>chr11:65620965-65620973
CCACCACCA
>chr10:14803680-14803688
cctccacct
>chr4:55794226-55794234
cctccacct
>chr1:158182140-158182151
tggtggtggtgg
>chr1:24622336-24622344
AGGTGGAGG
>chr11:125240043-125240051
CCACCTCCA
>chr5:87790918-87790926
ccaccacca
>chr6:17539578-17539586
CCTCCTCCA
>chr1:112985394-112985402
cctccgcct
>chr3:50185889-50185897
tggaggagg
>chr1:9406001-9406009
TGGTGGTGG
>chr9:107660691-107660699
tggtggtgg
>chr10:88410633-88410641
aggaggagg
>chr17:7450571-7450579
cctccacct
>chr18:54316735-54316743
aggaggtgg
>chr7:94732764-94732772
ccgcctcct
>chrX:110238366-110238374
CCTCCTCCT
>chr5:150716893-150716901
CGGAGGAGG
>chr9:6097303-6097311
ccacctcca
>chrUn_gl000219:120741-120752
AGGTGGAGGTGG
>chr10:30397169-30397177
aggtggagg
>chr5:3099125-3099133
AGGAGGTGG
>chr10:106022363-106022371
aggaggcgg
>chr3:107519161-107519169
TGGAGGAGG
>chr5:145007968-145007976
cctccacct
>chr9:33624940-33624948
CCACCTCCA
>chr17:41898360-41898368
CCGCCTCCT
>chr16:15915078-15915086
CCTCCTCCA
>chr13:20332903-20332911
aggtggagg
>chr10:34392633-34392644
cctccacctcct
>chrX:545065-545086
aggaggaggctggaggaggagg
>chr1:23931841-23931849
aggcggagg
>chr2:106719902-106719910
TGGAGGAGG
>chr2:92261744-92261752
CCGCCGCCG
>chr8:10983660-10983668
cctccgcct
>chr16:68583444-68583452
tggtggcgg
>chr8:145706955-145706963
aggcggagg
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment