{ "metadata": { "name": "", "signature": "sha256:d11069ce9b749246162211b80f3188e37d3bc1dee0e41fe1179c96aa2817bff0" }, "nbformat": 3, "nbformat_minor": 0, "worksheets": [ { "cells": [ { "cell_type": "markdown", "metadata": { "slideshow": { "slide_type": "-" } }, "source": [ "\n", "***\n", "\n", "[Michiel van Galen](mailto:m.van_galen@lumc.nl), [Department of Human Genetics, Leiden University Medical Center](http://humgen.nl)\n", "\n", "Examples and ideas taken from: [IPython Documentation](http://nbviewer.ipython.org/github/ipython/ipython/blob/2.x/examples/Index.ipynb) and [The role of computing in science](http://www.socrates.if.usp.br/~wtc/?q=role-computing-science)\n", "\n", "License: [Creative Commons Attribution 3.0 License (CC-by)](http://creativecommons.org/licenses/by/3.0)" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Foreword" ] }, { "cell_type": "heading", "level": 2, "metadata": {}, "source": [ "Requirements on scientific computing\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "\"High-profile journals have called for increased openness in computational sciences. Some prestigious journals, including Science, have even started to demand of authors to provide the source code for simulation software used in publications to readers upon request.\"" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Reproducible Research in Computational Science, Roger D. Peng, Science 334, 1226 (2011).\n", "- Shining Light into Black Boxes, A. Morin et al., Science 336, 159-160 (2012).\n", "- The case for open computer programs, D.C. Ince, Nature 482, 485 (2012)." ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "The cornerstone of the scientific method:" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Replication & Reproduction" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "To achieve this in scientific computing (programming):" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Any source code which generates data should be:\n", " - Tracked!\n", " - Backed up and secured\n", " - Ideally published online\n", " - Additionally: Also track external software versions and settings\n" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Revision Control System" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Systems such as \n", " - Git\n", " - SVN\n", " \n", " \n", " \n", "- Online repository\n", " - GitHub" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Check out our one day Git course:" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "[Git course @ LUMC HumGen](https://humgenprojects.lumc.nl/trac/humgenprojects/wiki/gitcourse)" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Python in scientific computing" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Large community of users\n", "- Extensive ecosystem of scientific libraries and environments\n", "- Parallel processing with processes and threads\n", "- Interprocess communication (MPI)\n", "- GPU computing (OpenCL and CUDA)\n", "- Readily available and suitable for use on high-performance computing clusters.\n", "- No license costs, no unnecessary use of research budget." ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Lots of reasons to Python!" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "How to Python?" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "The Python interpreter" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Standard way of running code\n", "- Reads and runs the code in a file\n", "\n", "`$ python my-program.py`" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Alternatively, start the interpreter interactively by simply typing `python`\n", "- Not very convenient due to a number of limitations\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "`$ python`" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "IPython (Interactive Python)" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Interactive shell with improved user friendliness" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "`$ ipython`" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Command history\n", "- Tab auto-completion\n", "- In-line editing of code\n", "- Object introspection, and automatic extract of documentation strings\n", "- Good interaction with operating system shell\n" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "IPython Notebook" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Started by typing '`ipython notebook`' in the directory where you want to store notebooks\n", "- Opens a new browser window with an index page where existing notebooks are shown\n", "- New notebooks can be created in that same directory" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "`$ ipython notebook`" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "IPython Notebook" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Cell based executable workflow\n", "- Interactive computational documents\n", "- Add elegant explanatory text\n", "- Direct output of computations\n", "- Add figures and video\n", "- Integration in Git\n", "- Export your notebooks to PDF or HTML (nbconvert)\n", "- Share notebooks easily with nbviewer" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "http://nbviewer.ipython.org/" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Why Notebook?" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "\"Web-based interactive computational environment where you can combine code execution, text, mathematics, plots and rich media into a single document.\"" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "\"It is based on the IPython shell, but provides a cell-based environment with great interactivity, where calculations can be organized documented in a structured way.\"" ] }, { "cell_type": "heading", "level": 3, "metadata": {}, "source": [ "<br></br><br></br><br></br><br></br>\n", "<font color='darkgreen'>Track, store and share elegant code using IPython Notebooks & Git!</font>\n" ] }, { "cell_type": "heading", "level": 3, "metadata": {}, "source": [ "<font color='darkgreen'>Replicability & Reproducibility</font>\n", "<br></br><br></br><br></br><br></br>" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Getting started with IPython Notebook" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Where to Notebook?" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Install locally\n", " - See instructions in this course\n", " - Linux, Windows\n", " - Type '`ipython notebook`'\n", " \n", " \n", "- Remotely, Shark cluster LUMC\n", " - Connect to shark\n", " - Type '`notebook`' and click the given URL" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "The notebook user interface" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Cell based workflow\n", "- Move between cells with the arrow keys or clicks with the mouse" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "There are two different modes from which always one is active" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Edit mode\n", " - Hit **ENTER** or click the edit area to change to edit mode\n", " - Indicated with a <font color='green'>**green**</font> cell border\n", " - Edit your cell as if a normal text editor\n", " \n", "\n", "\n", "\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Command mode\n", " - Hit **ESCAPE** to change into command mode\n", " - Indicated with a <font color='grey'>**grey**</font> cell border\n", " - Edit the notebook as a whole\n", "\n", "Note: Different shortcuts apply in both modes!\n", "\n", "\n" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "For example. Press 'b' to add a cell below in command mode to add a cell" ] }, { "cell_type": "code", "collapsed": false, "input": [], "language": "python", "metadata": {}, "outputs": [] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "The toolbar is clickable" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Edit mode shortcuts" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "\n", "\n", "- esc : command mode\n", "- shift+enter : run cell\n", "- ctrl+enter : run cell, select below\n" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Command mode shortcuts" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- enter : edit mode\n", "- shift+enter : run cell\n", "- ctrl+enter : run cell, select below\n", "\n", "\n", "- y : to code\n", "- m : to markdown\n", "\n", "\n", "- ctrl+k : move cell up\n", "- ctrl+j : move cell down\n", "\n", "\n", "- a : insert cell above\n", "- b : insert cell below\n", "\n", "\n", "- x : cut cell\n", "- c : copy cell\n", "- v : paste cell below\n", "\n", "\n", "- z : undo last delete\n", "- d : delete cell (press twice)" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Press '**h**' to show the help." ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Saving your notebook\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- The notebook automatically saves\n", "- You can manually click the 'save' icon or press **CTRL+s**" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "**Checkpoints**\n", "\n", "Currently only single checkpoints are stored, but multiple checkpoints will be enabled for future versions of IPython and Bookstore. " ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Two different cell types" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Code cell\n", " - Contains code \n", " - Inline comments\n", " - Python or system calls\n" ] }, { "cell_type": "code", "collapsed": false, "input": [ "# This is a code cell\n", "x = 10" ], "language": "python", "metadata": {}, "outputs": [], "prompt_number": 42 }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Markdown cell\n", " - Format your notebook\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "This is a markdown cell which allows to format your document **nicely** and add *context* to code cells." ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Set the cell type of the selected cell" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Select the type from the dropdown box in the toolbar\n", "- In command mode only: Press '**y**' for code or '**m**' for markdown" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Code cells" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Mainly contain Python code" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "All of the python goodness works inside code cells!" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Running cells\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Cells can be run individually\n", "- Results are persistent\n", "- Save time by running intensive code blocks only once" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Run a code cell by pressing the play button or **SHIFT+ENTER**." ] }, { "cell_type": "code", "collapsed": false, "input": [ "# Assign a value\n", "a = 12\n", "# Output a to the power of 3\n", "print a**3" ], "language": "python", "metadata": {}, "outputs": [ { "output_type": "stream", "stream": "stdout", "text": [ "1728\n" ] } ], "prompt_number": 10 }, { "cell_type": "markdown", "metadata": {}, "source": [ "Use the 'Cell' option in the toolbar to run multiple cells at once." ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- If the kernel is busy running it states 'Busy' in the header of the window or tab\n", "- The indicator in the top right corner shows the kernel state" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Other uses of code cells\n" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Except for code, some system aliases are available such as 'ls':" ] }, { "cell_type": "code", "collapsed": false, "input": [ "ls" ], "language": "python", "metadata": {}, "outputs": [ { "output_type": "stream", "stream": "stdout", "text": [ "biopython.ipynb \u001b[0m\u001b[01;34mimages\u001b[0m/ person.py \u001b[01;34msolutions\u001b[0m/\r\n", "classes.ipynb INSTALL.md python.ipynb \u001b[01;34mstyles\u001b[0m/\r\n", "\u001b[01;34mdata\u001b[0m/ matplotlib.ipynb README.md welcome.ipynb\r\n", "\u001b[01;34mexamples\u001b[0m/ more-python.ipynb \u001b[01;32mseq_toolbox.py\u001b[0m*\r\n", "exercises.ipynb Notebook.ipynb sequencer.ipynb\r\n", "git.ipynb numpy.ipynb sequencer_old.py\r\n" ] } ], "prompt_number": 69 }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Any command line program can be run using '!' with string interpolation from Python variables:" ] }, { "cell_type": "code", "collapsed": false, "input": [ "message = 'Some text'\n", "!echo $message" ], "language": "python", "metadata": {}, "outputs": [ { "output_type": "stream", "stream": "stdout", "text": [ "Some text\r\n" ] } ], "prompt_number": 70 }, { "cell_type": "code", "collapsed": false, "input": [ "!samtools" ], "language": "python", "metadata": {}, "outputs": [ { "output_type": "stream", "stream": "stdout", "text": [ "\r\n", "Program: samtools (Tools for alignments in the SAM format)\r\n", "Version: 0.1.19-44428cd\r\n", "\r\n", "Usage: samtools <command> [options]\r\n", "\r\n", "Command: view SAM<->BAM conversion\r\n", " sort sort alignment file\r\n", " mpileup multi-way pileup\r\n", " depth compute the depth\r\n", " faidx index/extract FASTA\r\n", " tview text alignment viewer\r\n", " index index alignment\r\n", " idxstats BAM index stats (r595 or later)\r\n", " fixmate fix mate information\r\n", " flagstat simple stats\r\n", " calmd recalculate MD/NM tags and '=' bases\r\n", " merge merge sorted alignments\r\n", " rmdup remove PCR duplicates\r\n", " reheader replace BAM header\r\n", " cat concatenate BAMs\r\n", " bedcov read depth per BED region\r\n", " targetcut cut fosmid regions (for fosmid pool only)\r\n", " phase phase heterozygotes\r\n", " bamshuf shuffle and group alignments by name\r\n", "\r\n" ] } ], "prompt_number": 45 }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Autocompletion works by pressing TAB:" ] }, { "cell_type": "code", "collapsed": false, "input": [ "import numpy\n", "numpy.random.random()" ], "language": "python", "metadata": {}, "outputs": [ { "metadata": {}, "output_type": "pyout", "prompt_number": 1, "text": [ "0.21020888481775812" ] } ], "prompt_number": 1 }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "SHIFT-TAB shows help functions" ] }, { "cell_type": "code", "collapsed": false, "input": [ "numpy.random.random()" ], "language": "python", "metadata": {}, "outputs": [ { "metadata": {}, "output_type": "pyout", "prompt_number": 5, "text": [ "0.006939705725762635" ] } ], "prompt_number": 5 }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "\u00a7 Exercise: My first Notebook (1)" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Start a Notebook session.\n", " - `$ ipython notebook`\n", "\n", "This opens a webbrowser and shows existing notebooks.\n", " - Create a new notebook by clicking the '*New notebook*' button.\n", "\n", "A new tab will open with a fresh notebook. Rename your notebook to something useful\n", " - Click on the current name (*Untitled1*) and edit this\n", "\n", "Add the code shown below to some **_code_** cells\n", " - Add cells by pressing the '**+**' button or **ALT+ENTER**\n", " - Remember the keyboard shortcuts or the help function ('**h**')\n", "\n", "\n", "Notice the last cell produced output! We will continue to develop this notebook later this session." ] }, { "cell_type": "code", "collapsed": false, "input": [ "def complement(seq):\n", " complements = {'A': 'T', 'C': 'G', 'T': 'A', 'G': 'C'}\n", " c_seq = ''\n", " for n in seq:\n", " c_seq = c_seq + complements[n]\n", " return c_seq" ], "language": "python", "metadata": {}, "outputs": [], "prompt_number": 40 }, { "cell_type": "code", "collapsed": false, "input": [ "complement('ACGT')" ], "language": "python", "metadata": {}, "outputs": [ { "metadata": {}, "output_type": "pyout", "prompt_number": 41, "text": [ "'TGCA'" ] } ], "prompt_number": 41 }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Output from code cells" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- When a cell is run it can generate output\n", "- This is shown below the cell in the output area\n", "- Output is asynchronous\n", "- Outputs are objects and the last one is available under the variable '`_`'\n", " " ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Example: Show some output and use it in another function" ] }, { "cell_type": "code", "collapsed": false, "input": [ "numpy.random.rand(3)" ], "language": "python", "metadata": {}, "outputs": [ { "metadata": {}, "output_type": "pyout", "prompt_number": 86, "text": [ "array([ 0.96757675, 0.54000181, 0.63633455])" ] } ], "prompt_number": 86 }, { "cell_type": "code", "collapsed": false, "input": [ "numpy.sin(_)\n" ], "language": "python", "metadata": {}, "outputs": [ { "metadata": {}, "output_type": "pyout", "prompt_number": 89, "text": [ "array([ 0.73353825, 0.49178408, 0.55988864])" ] } ], "prompt_number": 89 }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Scrollbars are automatically added for large outputs" ] }, { "cell_type": "code", "collapsed": false, "input": [ "for i in range(2):\n", " print i" ], "language": "python", "metadata": {}, "outputs": [ { "output_type": "stream", "stream": "stdout", "text": [ "0\n", "1\n" ] } ], "prompt_number": 115 }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Exceptions are formatted nicely:" ] }, { "cell_type": "code", "collapsed": false, "input": [ "# Let's distribute a few cookies to nobody\n", "cookies = 3\n", "persons = 0\n", "share = cookies / persons\n", "print share" ], "language": "python", "metadata": {}, "outputs": [ { "ename": "ZeroDivisionError", "evalue": "integer division or modulo by zero", "output_type": "pyerr", "traceback": [ "\u001b[1;31m---------------------------------------------------------------------------\u001b[0m\n\u001b[1;31mZeroDivisionError\u001b[0m Traceback (most recent call last)", "\u001b[1;32m<ipython-input-51-0d805d7db48f>\u001b[0m in \u001b[0;36m<module>\u001b[1;34m()\u001b[0m\n\u001b[0;32m 2\u001b[0m \u001b[0mcookies\u001b[0m \u001b[1;33m=\u001b[0m \u001b[1;36m3\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[0;32m 3\u001b[0m \u001b[0mpersons\u001b[0m \u001b[1;33m=\u001b[0m \u001b[1;36m0\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[1;32m----> 4\u001b[1;33m \u001b[0mshare\u001b[0m \u001b[1;33m=\u001b[0m \u001b[0mcookies\u001b[0m \u001b[1;33m/\u001b[0m \u001b[0mpersons\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[0m\u001b[0;32m 5\u001b[0m \u001b[1;32mprint\u001b[0m \u001b[0mshare\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n", "\u001b[1;31mZeroDivisionError\u001b[0m: integer division or modulo by zero" ] } ], "prompt_number": 51 }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Markdown cells" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Formatted **text** _can_ **_be_** added to IPython Notebooks using Markdown cells. \n", "\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Markdown is a popular markup language that is a superset of HTML. \n", "- Its specification can be found here:\n", " " ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "http://daringfireball.net/projects/markdown/" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "To create a markdown cell:\n", "- First focus on the cell you want to format\n", "- Then select '*Markdown*' the dropdown box in the toolbar or press '**m**' in command mode\n", "- Note that you need to run a markdown cell to show the result\n", " - Click '*play*' or **SHIFT+ENTER**" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Some markdown examples: " ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Headers can be put by using hashes '#'" ] }, { "cell_type": "code", "collapsed": false, "input": [ "# Header 1\n", "## Header 2\n", "### Header 3" ], "language": "python", "metadata": {}, "outputs": [] }, { "cell_type": "markdown", "metadata": {}, "source": [ "# Header 1\n", "## Header 2\n", "### Header 3" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Lists" ] }, { "cell_type": "code", "collapsed": false, "input": [ "- A list\n", " - A sublist\n", " - Yet another level\n", " - And so on" ], "language": "python", "metadata": {}, "outputs": [] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- A list\n", " - A sublist\n", " - Yet another level\n", " - And so on" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "General HTML" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Since markdown is a superset of HTML, this will also work" ] }, { "cell_type": "code", "collapsed": false, "input": [ "<table border=\"1\" style=\"width:200px\">\n", "<tr>\n", " <td>Jill</td>\n", " <td>Smith</td> \n", " <td>50</td>\n", "</tr>\n", "<tr>\n", " <td>Eve</td>\n", " <td>Jackson</td> \n", " <td>94</td>\n", "</tr>\n", "</table>" ], "language": "python", "metadata": {}, "outputs": [] }, { "cell_type": "markdown", "metadata": {}, "source": [ "<table border=\"1\" style=\"width:200px\">\n", "<tr>\n", " <td>Jill</td>\n", " <td>Smith</td> \n", " <td>50</td>\n", "</tr>\n", "<tr>\n", " <td>Eve</td>\n", " <td>Jackson</td> \n", " <td>94</td>\n", "</tr>\n", "</table>" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Markdown also supports formulas" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Nicely formatted" ] }, { "cell_type": "code", "collapsed": false, "input": [ "\\begin{equation*} \\left( \\sum_{k=1}^n a_k b_k \\right)^2 \\leq \\left( \\sum_{k=1}^n a_k^2 \\right) \\left( \\sum_{k=1}^n b_k^2 \\right) \\end{equation*}\n" ], "language": "python", "metadata": {}, "outputs": [] }, { "cell_type": "markdown", "metadata": {}, "source": [ "\\begin{equation*} \\left( \\sum_{k=1}^n a_k b_k \\right)^2 \\leq \\left( \\sum_{k=1}^n a_k^2 \\right) \\left( \\sum_{k=1}^n b_k^2 \\right) \\end{equation*}\n" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "We can also show figures. These can be locally or linked from the www." ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "- Notebook has access to all the files down in the directory" ] }, { "cell_type": "code", "collapsed": false, "input": [ "" ], "language": "python", "metadata": {}, "outputs": [] }, { "cell_type": "markdown", "metadata": {}, "source": [ "" ] }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "<br></br><br></br>\n", "Embed videos using python code" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Python supports videos also. Note this is not a markdown cell, but a code cell using a python package." ] }, { "cell_type": "code", "collapsed": false, "input": [ "from IPython.display import YouTubeVideo\n", "# a talk about IPython at Sage Days at U. Washington, Seattle.\n", "# Video credit: William Stein.\n", "YouTubeVideo('1j_HxD4iLn8')" ], "language": "python", "metadata": {}, "outputs": [ { "html": [ "\n", " <iframe\n", " width=\"400\"\n", " height=300\"\n", " src=\"https://www.youtube.com/embed/1j_HxD4iLn8\"\n", " frameborder=\"0\"\n", " allowfullscreen\n", " ></iframe>\n", " " ], "metadata": {}, "output_type": "pyout", "prompt_number": 4, "text": [ "<IPython.lib.display.YouTubeVideo at 0x1fed5d0>" ] } ], "prompt_number": 4 }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "Output plots with matplotlib " ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "More on this later in the course." ] }, { "cell_type": "code", "collapsed": false, "input": [ "%matplotlib inline\n", "import matplotlib.pyplot as plt\n", "plt.plot([x**2 for x in range(100)])\n", "plt.show()" ], "language": "python", "metadata": {}, "outputs": [ { "metadata": {}, "output_type": "display_data", "png": "iVBORw0KGgoAAAANSUhEUgAAAYcAAAEACAYAAABYq7oeAAAABHNCSVQICAgIfAhkiAAAAAlwSFlz\nAAALEgAACxIB0t1+/AAAHX1JREFUeJzt3XmYFNW5x/HviCASEQQDsgZEUHFBwF2UUREQZVEQEBcS\nkCSiEhNXjDfMjcarPmhERKKICERG9hGQHWlBYFhkERzZBWWQQfZFYLa+f7w1djOydvdMVXf9Ps9T\nT1efqep+p2D67bPUOSAiIiIiIiIiIiIiIiIiIiIiIiIiIuJJHwJZwMqwsgrADGAtMB0oH/az3sA6\nYDXQPKy8sfMa64B+YeVnASOd8nTgd7ENX0REisLNQEOOTg6vA886+88Brzr79YHlQEmgFrAeSHJ+\ntgi41tmfDLR09nsC7zr7nYBPYhq9iIgUmVocnRxWA5Wd/Quc52C1hufCjpsKXA9UAb4NK+8M/Cfs\nmOuc/TOBn2IVtIiIRO6MCM6pjDU14TwWJIqqwJaw47YA1Y5RnumU4zz+4OznAnuxZisREXFRJMkh\nXNDZREQkgZwZwTlZWHPSNqzJaLtTngnUCDuuOlZjyHT2C5cXnFMT2OrEUg7YVfgN69SpE9ywYUME\noYqI+NoG4KJIToyk5jAB6OrsdwXSwso7A6WA2kBdrCN6G7AP61tIAh4CPj3Ga3UAZh3rDTds2EAw\nGNQWDNKnTx/XY/DKpmuha6FrceINqBPBZzxw8ppDKtAUOB/rG/gHNjppFNAd2AR0dI7NcMozsP6D\nnoSanHoCHwFnY6OVpjrlg4Hh2FDWnVhyERERl50sOdx/nPJmxyl/xdkK+wq44hjlRwglFxERicLg\nwXDvvXDeedG/VrQd0lLMkpOT3Q7BM3QtQnQtQvx6LUaPhldegaSkkx97KmL0MkUu6LSfiYhIIWvX\nQpMmMGUKNG4cKk+yTBHR57xqDiIicezQIbjvPvjnP49ODNFSzUFEJI517w6HD8N///vrJqVoag6R\n3OcgIiIeMGQIzJ8PixfHrq+hgGoOIiJxaPlyuOMO+OILqF//2Meoz0FExEf27IEOHeDtt4+fGKKl\nmoOISBwJBu1ehmrV4J13Tnys+hxERHyib1/YuhU+KeLVb1RzEBGJE4EAdO4MixZBzZonP159DiIi\nCW7rVujSBYYNO7XEEC0lBxERj8vJgY4doWdPaN68eN5TzUoiIh735JOwYQN8+imccRpf6dUhLSKS\noFJTYeJEWLLk9BJDtFRzEBHxqJUr4bbbYOZMaNDg9M9Xh7SISILZs8fuZ/j3vyNLDNFSzUFExGPy\n86FtW6hVC/r3j/x11OcgIpJAXn4Zdu+GsWPdi0HJQUTEQz77DN5/32ZaLVXKvTjUrCQi4hHr1sFN\nN0FaGtx4Y/Svpw5pEZE4d+AAtGtnK7rFIjFESzUHERGXBYN2B/S558IHH8Ru4R51SIuIxLHXXoPv\nv7eFe2K9oluklBxERFw0ZYoNV124EEqXdjuaEI/kqJNSs5KIJJz1661/Ydw4aNIk9q+vDmkRkTiz\nf3+oA7ooEkO0VHMQESlm+fnQvj389rfw3ntF18+gDmkRkTjy0kuwfTuMHOmdDujClBxERIrR+PEw\neLAt9enmHdAn49Gc9StqVhKRuLdqFdx6q41Quvrqon8/dUiLiHjcjh3Qpo1NwV0ciSFaqjmIiBSx\nnBxo0QKuucZueCsu0dQclBxERIrY44/Dd9/BhAlQokTxva9GK4mIeNR778GsWZCeXryJIVqqOYiI\nFJFAADp1gi+/hLp1i//91SEtIuIxGzdC587w8cfuJIZoRZMcegPfACuBEcBZQAVgBrAWmA6UL3T8\nOmA10DysvLHzGuuAflHEIyLiCfv2QevW8D//A82auR1NZCJNDrWAHkAj4AqgBNAZeB5LDvWAWc5z\ngPpAJ+exJfAuoarOQKA7UNfZWkYYk4iI6/LyoEsXaNoUHnvM7WgiF2ly2AfkAGWwTu0ywFagDTDU\nOWYo0M7ZbwukOudsAtYD1wFVgLLAIue4YWHniIjEneeeg0OHoF+ct4NEOlppF/AG8D1wCJiG1Rgq\nA1nOMVnOc4CqQHrY+VuAaliy2BJWnumUi4jEncGDbbhqejqULOl2NNGJNDnUAZ7Empf2AqOBBwsd\nE3S2mEhJSfllPzk5meTk5Fi9tIhI1AIBeOEFmDsXKlRwK4YAgUAgJq8V6VDWTsAdwCPO84eA64Hb\ngFuBbViT0WzgEkJ9D686j1OBPsBm55hLnfL7gabAnwu9n4ayiohnrV9vazJ8/DHcfrvb0YS4MZR1\nNZYMznbeuBmQAUwEujrHdAXSnP0JWId1KaA21vG8CEsi+7D+hyQsyRScIyLiebt3w913Q0qKtxJD\ntCJtVlqBdR4vAfKBpcD7WOfyKGz00Sago3N8hlOeAeQCPQk1OfUEPsISzWSsViEi4nk5OdChA9x5\nJ/y5cHtHnNMd0iIiEQgG4U9/gh9/hLQ0b06NobmVRESK2ZtvwsKFNjWGFxNDtJQcREROU1qarcuw\nYAGULet2NEVDzUoiIqdhyRLrY5g6FRo3djuaE9PEeyIixeD776FtW/jgA+8nhmgpOYiInIK9e23I\n6lNPWYJIdGpWEhE5iZwcuOsuuOgiGDAAkuLkk1PLhIqIFJFgEHr0gG3brCP6zDgaxqOhrCIiReT/\n/g+WLoU5c+IrMUTLR7+qiMjpGTHC1oBesADOOcftaIqXmpVERI4hEICOHeHzz+Hyy92OJjIayioi\nEkPffAOdOsEnn8RvYoiWkoOISJitW21k0htvwG23uR2Ne5QcREQc+/ZZYujRAx4svHyZz6jPQUQE\nyM62m9wuvBAGDoyfexlORPc5iIhEIRiE3//eFu4ZNy5xhqzqPgcRkSi8+CKsWWMjkxIlMURLl0FE\nfG3AABg9GubNgzJl3I7GO5QcRMS3xo6FV16BuXPht791OxpvUZ+DiPjSnDm2/vO0adCwodvRFA3d\nBCcichpWrYL77oPU1MRNDNFSchARX9m82VZy69cPbr/d7Wi8S8lBRHxjxw5o3hyefRY6d3Y7Gm9T\nn4OI+MKBAzYdxh13wL/+5XY0xUM3wYmInEB2NrRuDTVqwKBBiXH386lQchAROY68PHjgATh8GMaM\n8ddNbrpDWkTkGIJBeOIJW+Jz6lR/JYZo6VKJSMJKSYGFC2H2bChd2u1o4ouSg4gkpH797D6GL7+E\nc891O5r4o+QgIgln6FBbrGfuXKhUye1o4pM6pEUkoaSlwaOPWlPSJZe4HY271CEtIoJNuf3HP8KU\nKUoM0VJyEJGEkJ4OnTrZcNXGjd2OJv5p+gwRiXsrVkDbttbX0LSp29EkBiUHEYlra9faRHrvvAOt\nWrkdTeJQchCRuLV5s82V9PLLNgW3xE40yaE8MAb4FsgArgMqADOAtcB055gCvYF1wGqgeVh5Y2Cl\n87N+UcQjIj6ydatNuf3UU9Ctm9vRJJ5okkM/YDJwKXAl9qH/PJYc6gGznOcA9YFOzmNL4F1Cw6sG\nAt2Bus7WMoqYRMQHfvrJagzdu0OvXm5Hk5giTQ7lgJuBD53nucBeoA0w1CkbCrRz9tsCqUAOsAlY\nj9U0qgBlgUXOccPCzhER+ZU9e6BFC7jnHujd2+1oElekyaE28BMwBFgKDAJ+A1QGspxjspznAFWB\nLWHnbwGqHaM80ykXEfmVffugZUsbkfTSS25Hk9giTQ5nAo2w5qFGwEFCTUgFgs4mIhK1gwfhrrug\nUSN4803/rMnglkhvgtvibIud52OwDudtwAXOYxVgu/PzTKBG2PnVnfMznf3w8sxjvWFKSsov+8nJ\nySQnJ0cYuojEm0OHoE0bqFvXhqwqMRxbIBAgEAjE5LWiucRzgEewkUkpQBmnfCfwGlaTKO881gdG\nANdizUYzgYuwmsVCoBfW7/AZ8DYwtdB7aW4lEZ86fNj6F847D4YPhxIl3I4ofri1ElwD4AOgFLAB\n+ANQAhgF1MQ6njsCe5zjXwC6YZ3XfwGmOeWNgY+As7HRT8cae6DkIOJD2dlw771QpgyMGKHFek6X\nlgkVkYSTkwMdO1oT0siRULKk2xHFH83KKiIJJScHunSx9Z/HjFFicIOSg4h4Sm4uPPCAjU4aPx5K\nlXI7In9SchARzyhIDPv3W2I46yy3I/IvJQcR8YTcXHjoIdi711ZzK13a7Yj8TclBRFxXkBh27YJP\nP1Vi8AIlBxFxVUFTkmoM3qLkICKuyckJ9TEoMXiLkoOIuCInB+6/36bGGD9eicFrlBxEpNgdOQKd\nOkF+Powbp1FJXqRlQkWkWB0+DO3bwxln2A1uSgzepOQgIsXm0CFo187mSho5Uje4eZmSg4gUiwMH\nbD2GihVtEj1NieFtSg4iUuT27rUV3GrXhmHDNLtqPFByEJEitWsX3HEHXHklDBqk9RjihZKDiBSZ\n7dvh1lvh5pthwADrhJb4oH8qESkSW7bALbfYKm59+2ppz3ij5CAiMbdxoyWG7t0hJUWJIR4pOYhI\nTGVkQNOm8PTT8MwzbkcjkdKYARGJma++suGqffvCgw+6HY1EQ8lBRGJizhzo0AHef99udJP4pmYl\nEYnaZ5/ZlBgjRigxJAolBxGJyogR1vE8aRI0a+Z2NBIralYSkYgNGACvvgqzZsFll7kdjcSSkoOI\nnLZgEP75Txg+3Poaatd2OyKJNSUHETkteXnQqxfMnw/z5kHlym5HJEVByUFETtmRI/DwwzYtRiAA\n5cq5HZEUFXVIi8gp2bfP7mHIzYUpU5QYEp2Sg4ic1LZtkJwMdevCqFFa79kPlBxE5ITWrYObboJ7\n74V339WU236hPgcROa7Fi6FtWxuZ9MgjbkcjxUnJQUSOadIk6NYNBg+G1q3djkaKm5qVRORXBg2C\nHj1g4kQlBr9SzUFEfhEMwj/+YVNizJljHdDiT0oOIgJAdrb1K6xZAwsWQKVKbkckblKzkoiwZw+0\nbAn798Ps2UoMouQg4nubNtlQ1csvhzFjoEwZtyMSL4g2OZQAlgETnecVgBnAWmA6UD7s2N7AOmA1\n0DysvDGw0vlZvyjjEZHTsGiRJYY//Qneflv3MEhItMnhL0AGEHSeP48lh3rALOc5QH2gk/PYEngX\nKFhyfCDQHajrbC2jjElETsH48TYdxsCBNpGeSLhokkN1oBXwAaEP+jbAUGd/KFCwJlRbIBXIATYB\n64HrgCpAWWCRc9ywsHNEpAgEg/D66/DEEzB1KrRp43ZE4kXRjFb6N/AMcG5YWWUgy9nPcp4DVAXS\nw47bAlTDksWWsPJMp1xEikB2Njz6KCxdCunpUL262xGJV0Vac7gb2I71NyQd55ggoeYmEXHZrl3Q\nogXs2AFz5yoxyIlFWnO4EWtCagWUxmoPw7HawgXANqzJaLtzfCZQI+z86liNIdPZDy/PPNYbpqSk\n/LKfnJxMcnJyhKGL+M/q1Xanc9u28Npr6nhOVIFAgEAgEJPXOt63/tPRFHgaaA28DuwEXsM6o8s7\nj/WBEcC1WLPRTOAirGaxEOiF9Tt8BrwNTC30HsFgUJUQkUhMnw4PPmhrPXfr5nY0UpySkpIgws/5\nWN0hXfDJ/SowCht9tAno6JRnOOUZQC7QM+ycnsBHwNnAZH6dGEQkAsEgvPMOvPKK3b9wyy1uRyTx\nJBY1h+KgmoPIacjOhscft2kwJkyA2rXdjkjc4IWag4h4xPbt0L49VKwI8+dD2bJuRyTxSNNniCSQ\nZcvg2mttSc9x45QYJHKqOYgkiNRUu9N5wADo2PHkx4uciJKDSJzLy4MXXoDRo2HmTGjQwO2IJBEo\nOYjEsZ07oUsXyM219Z4rVnQ7IkkU6nMQiVPLl8M118CVV8K0aUoMEluqOYjEoY8/hiefhP79oXNn\nt6ORRKTkIBJHsrPhqadgyhSYNctqDSJFQclBJE5kZsJ998H558OSJVC+/MnPEYmU+hxE4sDs2da/\ncPfdkJamxCBFTzUHEQ/Lz7cJ8/r3h+HDoVkztyMSv1ByEPGoXbvg4Ydh924bpqr1F6Q4qVlJxIMW\nLoRGjaBePQgElBik+KnmIOIhwSD062fTbL/3Htxzj9sRiV8pOYh4xO7dthjPDz/Y+s4XXuh2ROJn\nalYS8YAFC6BhQ6hZE+bNU2IQ96nmIOKi/Hzo2xfeeAPef9/WeBbxAiUHEZds22ajkQ4etNFINWu6\nHZFIiJqVRFwwZYo1I11/PXzxhRKDeI9qDiLF6MgR6N3b1l5ITbUV20S8SMlBpJhkZNjaCxdeaNNt\na4pt8TI1K4kUsWAQBg6Epk3h8cdh7FglBvE+1RxEitC2bdC9O2RlwZdfwsUXux2RyKlRzUGkiKSl\nwVVXWcfzggVKDBJfVHMQibF9+2yVtkDAmpBuusntiEROn2oOIjEUCNjqbCVLwooVSgwSv1RzEImB\nn3+Gv/8dRo2CQYOgVSu3IxKJjmoOIlGaP9/6FrKy4OuvlRgkMajmIBKhQ4egTx8YNgwGDID27d2O\nSCR2VHMQicD8+TYK6bvvrLagxCCJRjUHkdPw88/w4os29UX//tChg9sRiRQN1RxETtHnn8MVV1jf\nwsqVSgyS2FRzEDmJ3bvhmWdg+nSbBuOuu9yOSKToqeYgchzBoM2eevnlUKoUrFqlxCD+oZqDyDF8\n/z089hhs3Gj3LuhmNvEb1RxEwuTmwptvQqNGcN11sGyZEoP4U6TJoQYwG/gGWAX0csorADOAtcB0\noHzYOb2BdcBqoHlYeWNgpfOzfhHGIxK1RYvgmmtg8mQbqvrii9acJOJHkSaHHOCvwGXA9cBjwKXA\n81hyqAfMcp4D1Ac6OY8tgXeBJOdnA4HuQF1naxlhTCIR2bULHn0U2raFp5+GGTOgXj23oxJxV6TJ\nYRuw3Nk/AHwLVAPaAEOd8qFAO2e/LZCKJZVNwHrgOqAKUBZY5Bw3LOwckSKVnw9DhkD9+nDGGbZS\n2wMPQFLSyc8VSXSx6JCuBTQEFgKVgSynPMt5DlAVSA87ZwuWTHKc/QKZTrlIkVq2DJ54ArKzYdIk\nuPpqtyMS8ZZok8M5wFjgL8D+Qj8LOltMpKSk/LKfnJxMslZmlwjs2mV9CWPHwssvQ7duUKKE21GJ\nxEYgECAQCMTktaKpQJcEJgFTgLecstVAMtbsVAXrtL6EUN/Dq87jVKAPsNk55lKn/H6gKfDnQu8V\nDAZjlmfEh/LybCrtPn3szuaXXoIKFdyOSqRoJVkbaUSf85H2OSQBg4EMQokBYALQ1dnvCqSFlXcG\nSgG1sY7nRVgS2Yf1PyQBD4WdIxITX3xhQ1NTU2HaNJtBVYlB5MQirTk0AeYAXxNqOuqNfeCPAmpi\nHc8dgT3Oz18AugG5WDPUNKe8MfARcDYwmdCw2HCqOchp27gRnn0WFi+Gvn2txqDOZvGTaGoO8fKn\nouQgp2zvXvjXv+DDD+Gvf4W//Q3OPtvtqESKnxvNSiKek5NjTUYXXww7d9rMqX//uxKDSCQ0t5LE\nvWAQ0tLg+efhd7+zfoUGDdyOSiS+KTlIXJs3z/oV9u+Ht9+GFi3cjkgkMSg5SFzKyIDevWH5chuW\n+sADul9BJJbU5yBxZdMm6NoVbr0VbrkF1qyBhx9WYhCJNSUHiQs//mjTXTRuDLVqwbp18NRTULq0\n25GJJCYlB/G0n36ymVILVmP79lv43/+Fc891OzKRxKbkIJ60Y4f1KVxyCRw+bMNS33gDKlVyOzIR\nf1ByEE8pSAoXXwx79tjsqe+8A1Wruh2ZiL8oOYgn/PijNR+FJ4WBA6FmTbcjE/EnJQdx1ebN8Pjj\ncNlldofzihVKCiJeoOQgrsjIsCGpjRrBb35jz/v1g+rV3Y5MREA3wUkxmzcPXn8d0tOhVy/YsAHK\nl3c7KhEpTMlBilxeHkyYYNNmb9tmfQupqVCmjNuRicjxKDlIkTlwAD76CN56CypWtKRw7726m1kk\nHig5SMxt3mzDT4cMsSkuhg6FG2/UQjsi8UQd0hITwSAEAtC+vXUy5+fDokUwbhzcdJMSg0i8Uc1B\norJ/P/z3v7bITn6+DUsdOhTOOcftyEQkGkoOEpEVK+A//4FPPrEZUvv3h+Rk1RBEEoWSg5yygwdh\n5EgYNAi2bIEePWDVKqhWze3IRCTW4uV7XjAYDLodgy8Fg7BkCQweDKNGQZMm8Mgj0KoVnKmvFiKe\nlmRV+Yg+5/XnLceUlWV9CUOGwKFD8Ic/2MyoqiWI+INqDvKLQ4fsZrVhw+xO5nbtLCncfDOcoXFt\nInEnmpqDkoPP5eXB7NkwYgSkpcHVV9uym/fcY3MeiUj8UnKQ05Kfb3MbjRwJo0fbWgldukCnTmo2\nEkkk6nOQk8rPh4ULYexY61guW9aSwezZtoaCiEg4JYcElpsLc+fC+PF2p3K5ctChA3z2GVxxhdvR\niYiXKTkkmP37YcYM61ieNAlq1bL+gxkz4NJL3Y5OROKF+hwSwIYNMHmyJYP58+GGG6B1axttVKOG\n29GJiFvUIe0zBw/CnDkwbZolhf37oWVLuPtuaN7c+hNERJQcElxuLnz1FXz+OcycabOdNm5sieDO\nO6FBA92HICK/puSQYHJzYdky+OIL2+bOhZo14fbbbWvaVLUDETk5JYc4d/Cg1Qa+/NK29HTrK2ja\n1LbkZKhUye0oRSTeKDnEkbw8WLMGFi+2JJCeDmvXWtNQkya23XgjnH++25GKSLxTcvCo3FxLBEuX\nWjPRV1/ZY6VKcM01cP31tl11FZx1ltvRikiiSYTk0BJ4CygBfAC8Vujnnk4OwSBkZsI339i2ciV8\n/TV8+61NR9GokW0NG9rcRRUquB2xiPhBvCeHEsAaoBmQCSwG7ge+DTvGE8lh3z67p2D9emsKWrMG\nVq+2xzJloH59uOwyu/v4yittP9bLZQYCAZKTk2P7onFK1yJE1yJE1yIk3udWuhZYD2xynn8CtOXo\n5FDk8vNhxw5b4eyHH0Lbpk3w3Xf2+PPPUKcOXHQR1K1ry2M++qjNTVRctQH9xw/RtQjRtQjRtYgN\nLySHasAPYc+3ANdF84J5eTYCaO9e2LPHHnftsm3nTtuysmD7dnv88Ud7LFfOZiitUSO0tWsHtWvb\nNBSVK2uNZBHxBy8kh1NqL2rVyr7d5+dDTk5oO3LEFqkp2A4cgOxsa+YpX94+8MuVg/POg4oVQ9sN\nN1jHcKVKUKUKXHCBOoVFRAp44Xvw9UAK1ikN0BvI5+hO6fVAneINS0Qk7m0ALnI7iEidif0CtYBS\nwHJA84eKiAh3YiOW1mM1BxERERERkdPTElgNrAOeczmW4lYDmA18A6wCejnlFYAZwFpgOlDeleiK\nXwlgGTDRee7X61AeGIMN987ARvf59Vr0xv4+VgIjgLPwz7X4EMjCfvcCJ/rde2Ofo6uB5sUUY5Ep\ngTU11QJK4r/+iAuAq5z9c7Cmt0uB14FnnfLngFeLPzRX/A34GJjgPPfrdRgKdHP2zwTK4c9rUQvY\niCUEgJFAV/xzLW4GGnJ0cjje714f+/wsiV239UBcT/R/AzA17PnzzuZXadid5KuByk7ZBc7zRFcd\nmAncSqjm4MfrUA77QCzMj9eiAvaF6TwsSU4E7sBf16IWRyeH4/3uvTm65WUqNlL0uLyeOY51g1w1\nl2JxWy3sW8JC7B8/yynPIvSfIZH9G3gGG+ZcwI/XoTbwEzAEWAoMAn6DP6/FLuAN4HtgK7AHa1Lx\n47UocLzfvSr2+VngpJ+lXk8O7k+o5A3nAGOBvwD7C/0sSOJfp7uB7Vh/w/HuzfHDdQD7htwIeNd5\nPMiva9N+uRZ1gCexL05Vsb+TBwsd45drcSwn+91PeF28nhwysU7ZAjU4Ovv5QUksMQzHmpXAvhFc\n4OxXwT44E9mNQBvgOyAVuA27Hn67DmD//7dgE1SCdUw3Arbhv2txNTAf2AnkAuOwpmg/XosCx/ub\nKPxZWt0pOy6vJ4clQF1CN8h1ItQZ6QdJwGBsRMpbYeUTsI43nMc0EtsL2H/s2kBn4HPgIfx3HcA+\n+H4A6jnPm2GjdSbiv2uxGms3Pxv7W2mG/a348VoUON7fxATsb6cU9ndUF1hU7NHFmJ9vkGuCtbEv\nx5pUlmFDeytgnbOJPlTvWJoS+oLg1+vQAKs5rMC+LZfDv9fiWUJDWYdiNW2/XItUrK8lG/vC8AdO\n/Lu/gH2OrgZaFGukIiIiIiIiIiIiIiIiIiIiIiIiIiIiIiIiIiIisfT/aY4DA839B3AAAAAASUVO\nRK5CYII=\n", "text": [ "<matplotlib.figure.Figure at 0x333b590>" ] } ], "prompt_number": 36 }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "\u00a7 Exercise: My first Notebook (2)" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Let's add some markdown cells to the notebook you created earlier:\n", " - Select the top code cell\n", " - Press **ESC** to go into command mode\n", " - Press '**a**', this will add a cell above the selected cell\n", " - Notice the focus is on the new cell\n", " - Now press '**m**' to set the celltype to 'Markdown'\n", " - Press **ENTER** and add some code (see below for example)\n", " - Run the cell and see if it worked\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Example markdown code:" ] }, { "cell_type": "code", "collapsed": false, "input": [ "### My next notebook\n", "\n", "This notebook is my first notebook with some experimental code.\n", "\n", "Author: [Michiel van Galen](mailto:m.van_galen@lumc.nl)" ], "language": "python", "metadata": {}, "outputs": [] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Now, try to add more python code to the notebook:\n", " - Make sure to set the cell type to code\n", " - Add the '`reverse`' function to your notebook as shown below" ] }, { "cell_type": "code", "collapsed": false, "input": [ "def reverse(seq):\n", " rev = seq[::-1]\n", " return rev" ], "language": "python", "metadata": {}, "outputs": [], "prompt_number": 42 }, { "cell_type": "markdown", "metadata": {}, "source": [ "Try using both the '`reverse`' and '`translate`' function." ] }, { "cell_type": "code", "collapsed": false, "input": [ "reverse('AACGT')" ], "language": "python", "metadata": {}, "outputs": [ { "metadata": {}, "output_type": "pyout", "prompt_number": 45, "text": [ "'TGCAA'" ] } ], "prompt_number": 45 }, { "cell_type": "code", "collapsed": false, "input": [ "translate(_)" ], "language": "python", "metadata": {}, "outputs": [ { "metadata": {}, "output_type": "pyout", "prompt_number": 46, "text": [ "'ACGTT'" ] } ], "prompt_number": 46 }, { "cell_type": "heading", "level": 1, "metadata": {}, "source": [ "\u00a7 Exercise: My first Notebook (3)\n", " " ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "A palindromic sequence is a nucleic acid sequence (DNA or RNA) that is the same whether read 5' (five-prime) to 3' (three prime) on one strand or 5' to 3' on the complementary strand with which it forms a double helix. Palindromic sequences play an important role in molecular biology:\n", "\n", "http://en.wikipedia.org/wiki/Palindromic_sequence\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "\n", "<img src=\"https://git.lumc.nl/humgen/programming-course/raw/master/images/1590px-DNA_palindrome.svg.png\" align=\"center\" width=\"400\" >\n" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "Take some time to develop your notebook further and add the following features to your notebook:\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ " - Think of a function which can test if a sequence is palindromic\n", " - Use the functions '`complement`' and '`reverse`'\n", " - Nicely formatted mardown cell(s) explaining the notebook\n", " - Add links as references like the one above\n", "\n", "**Bonus: Write a function which can test if there are short palindromic sequences in a longer piece of DNA**\n", "\n", "- Try to find the palindromic sequences of at least length 6 in the sequence :\n", "\n", "**GGGAGACATGTCTAACCGTTGTAAAA**\n", " \n", "Hints:\n", "\n", "- Implement your current functions in a new function\n", "- Begin to iterate over a sequence and find a palindrome of size 2\n", "- Continue to work from there and expand your test\n", "- Can a palindromic sequence have an odd length?\n" ] }, { "cell_type": "heading", "level": 4, "metadata": {}, "source": [ "<br></br><br></br><br></br><br></br>\n", "<br></br><br></br><br></br><br></br>\n", "<br></br><br></br><br></br><br></br>\n", "<br></br><br></br><br></br><br></br>\n", "<br></br><br></br><br></br><br></br>\n", "Ignore following code for layout" ] }, { "cell_type": "code", "collapsed": false, "input": [ "from IPython.core.display import HTML\n", "def custom_style():\n", " style = open('styles/notebook.css', 'r').read()\n", " return HTML('<style>' + style + '</style>')\n", "def custom_script():\n", " script = open('styles/notebook.js', 'r').read()\n", " return HTML('<script>' + script + '</script>')" ], "language": "python", "metadata": {}, "outputs": [], "prompt_number": 1 }, { "cell_type": "code", "collapsed": false, "input": [ "custom_style()" ], "language": "python", "metadata": {}, "outputs": [ { "html": [ "<style>/*\n", " https://github.com/CamDavidsonPilon/Probabilistic-Programming-and-Bayesian-Methods-for-Hackers\n", "*/\n", "@font-face {\n", " font-family: \"Computer Modern\";\n", " src: url('http://mirrors.ctan.org/fonts/cm-unicode/fonts/otf/cmunss.otf');\n", "}\n", "div.cell{\n", " width:800px;\n", " margin-left:16% !important;\n", " margin-right:auto;\n", "}\n", "h1 {\n", " font-family: Helvetica, serif;\n", "}\n", "h4{\n", " margin-top:12px;\n", " margin-bottom: 3px;\n", " }\n", "div.text_cell_render{\n", " font-family: Computer Modern, \"Helvetica Neue\", Arial, Helvetica, Geneva, sans-serif;\n", " line-height: 145%;\n", " font-size: 130%;\n", " width:800px;\n", " margin-left:auto;\n", " margin-right:auto;\n", "}\n", ".CodeMirror{\n", " font-family: \"Source Code Pro\", source-code-pro,Consolas, monospace;\n", "}\n", ".prompt{\n", " display: None;\n", "}\n", ".text_cell_render .exercise {\n", " font-weight: 300;\n", " /*font-size: 22pt;*/\n", " color: #4057A1;\n", " font-style: italic;\n", " /*margin-bottom: .5em;\n", " margin-top: 0.5em;\n", " display: block;*/\n", "}\n", ".text_cell_render .example {\n", " font-weight: 300;\n", " color: #40A157;\n", " font-style: italic;\n", "}\n", "\n", ".warning{\n", " color: rgb( 240, 20, 20 )\n", "}\n", "</style>" ], "metadata": {}, "output_type": "pyout", "prompt_number": 2, "text": [ "<IPython.core.display.HTML at 0x1fed690>" ] } ], "prompt_number": 2 }, { "cell_type": "code", "collapsed": false, "input": [ "custom_script()" ], "language": "python", "metadata": {}, "outputs": [ { "html": [ "<script>// https://github.com/CamDavidsonPilon/Probabilistic-Programming-and-Bayesian-Methods-for-Hackers\n", "MathJax.Hub.Config({\n", " TeX: {\n", " extensions: [\"AMSmath.js\"]\n", " },\n", " tex2jax: {\n", " inlineMath: [ ['$','$'], [\"\\\\(\",\"\\\\)\"] ],\n", " displayMath: [ ['$$','$$'], [\"\\\\[\",\"\\\\]\"] ]\n", " },\n", " displayAlign: 'center', // Change this to 'center' to center equations.\n", " \"HTML-CSS\": {\n", " styles: {'.MathJax_Display': {\"margin\": 4}}\n", " }\n", " });\n", "</script>" ], "metadata": {}, "output_type": "pyout", "prompt_number": 3, "text": [ "<IPython.core.display.HTML at 0x1fed910>" ] } ], "prompt_number": 3 } ], "metadata": {} } ] }