From 26dacc4dc90a6cc85f5b6232cb68072386719138 Mon Sep 17 00:00:00 2001
From: Guy Allard <w.g.allard@lumc.nl>
Date: Wed, 20 Sep 2017 19:00:54 +0200
Subject: [PATCH] Added biopython lesson

---
 BioPython/Biopython.ipynb | 861 ++++++++++++++++++++++++++++++++++++++
 1 file changed, 861 insertions(+)
 create mode 100644 BioPython/Biopython.ipynb

diff --git a/BioPython/Biopython.ipynb b/BioPython/Biopython.ipynb
new file mode 100644
index 0000000..4819b54
--- /dev/null
+++ b/BioPython/Biopython.ipynb
@@ -0,0 +1,861 @@
+{
+ "cells": [
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "slide"
+    }
+   },
+   "source": [
+    "# Biopython\n",
+    "\n",
+    "![biopython logo](http://biopython.org/assets/images/biopython_logo_white.png)\n",
+    "\n",
+    "## A quick overview\n",
+    "### [Guy Allard](mailto://w.g.allard@lumc.nl)"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "slide"
+    }
+   },
+   "source": [
+    "# What is Biopython?\n",
+    "\n",
+    "## 'Python Tools for Computational Molecular Biology'\n",
+    "\n",
+    "- Fully open-source\n",
+    "- Actively developed\n",
+    "- Large community"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "slide"
+    }
+   },
+   "source": [
+    "# What can it do?\n",
+    "\n",
+    "Modules, classes and functions for manipulating biological data\n",
+    "\n",
+    "- File parsers and writers.\n",
+    "  - Sequence files: fasta, fastq, genbank, abi, sff, etc.\n",
+    "  - Alignment files: clustal, emboss, phylip, nexus, etc.\n",
+    "  - Sequence search outputs: BLAST, HMMER, BLAT, etc.\n",
+    "  - Phylogenetic trees: newick, nexus, phyloxml, etc.\n",
+    "  - Sequence motifs: AlignAce, TRANSFAC, etc.\n",
+    "  - Others: PDB files, etc.\n",
+    "- Access to remote resources (e.g., Entrez, NCBI BLAST).\n",
+    "- Application wrappers.\n",
+    "- A simple graphing tool.\n",
+    "- Simple algorithms (e.g., pairwise alignment, cluster analysis).\n",
+    "- References such as codon tables and IUPAC sequences."
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "slide"
+    }
+   },
+   "source": [
+    "# Where can I find more information?\n",
+    "\n",
+    "- [Biopython Homepage](http://biopython.org/)\n",
+    "- [Biopython development repository](http://github.com/biopython/biopython)\n",
+    "- [Biopython mailing list](http://lists.open-bio.org/pipermail/biopython/)\n",
+    "- [Biopython 'cookbook'](http://biopython.org/DIST/docs/tutorial/Tutorial.html) (essential reading!)"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "slide"
+    }
+   },
+   "source": [
+    "# Manipulating Sequence Data\n",
+    "\n",
+    "## Bio.SeqIO\n",
+    "\n",
+    "Input and output of sequence files.\n",
+    "\n",
+    "- SeqIO.read\n",
+    "  - Read a file containing a single sequence\n",
+    "- SeqIO.parse \n",
+    "  - Iterate over all sequences in a sequence file\n",
+    "- SeqIO.write\n",
+    "  - write sequences to a file"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 38,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "ID: 1\n",
+      "Name: 1\n",
+      "Description: 1\n",
+      "Number of features: 0\n",
+      "Seq('TGGAACATGTCCCGCTAGCTTCTTCTTGCTAGCAGATTTTTTCAGTTGATCGTC...TCT', SingleLetterAlphabet())\n"
+     ]
+    }
+   ],
+   "source": [
+    "from Bio import SeqIO\n",
+    "\n",
+    "# read the first sequence\n",
+    "for record in SeqIO.parse(\"../data/records.fa\", \"fasta\"):\n",
+    "    dna = record\n",
+    "    break\n",
+    "\n",
+    "print dna"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "source": [
+    "Each record is an object with several fields, including:\n",
+    "\n",
+    "- record.id\n",
+    "  - the sequence id\n",
+    "- record.name\n",
+    "  - sequence name, usually the same as the id\n",
+    "- record.description\n",
+    "  - sequence description\n",
+    "\n",
+    "The actual sequence is a separate object contained within the record which can be accessed using record.seq\n",
+    "\n",
+    "The sequence has an 'alphabet' associated with it which defines which letters are allowed.\n",
+    "\n",
+    "Different alphabets are used for DNA, RNA, protein etc."
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 39,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "TGGAACATGTCCCGCTAGCTTCTTCTTGCTAGCAGATTTTTTCAGTTGATCGTCACATGCGGTAGACTACCCAAGGTGTGACTACTCGCATGCCTGATCT\n"
+     ]
+    }
+   ],
+   "source": [
+    "print dna.seq"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "source": [
+    "There are lots of built in methods that can be used to manipulate the sequence\n",
+    "\n",
+    "The sequence acts like a string in many ways"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 40,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "length:  100\n"
+     ]
+    }
+   ],
+   "source": [
+    "# get the length of the sequence\n",
+    "print \"length: \", len(dna.seq)"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 41,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "TGGAACATGT\n"
+     ]
+    }
+   ],
+   "source": [
+    "# slice and dice\n",
+    "print dna.seq[:10]"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 42,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "tggaacatgtcccgctagcttcttcttgctagcagattttttcagttgatcgtcacatgcggtagactacccaaggtgtgactactcgcatgcctgatct\n"
+     ]
+    }
+   ],
+   "source": [
+    "# change the case\n",
+    "print dna.seq.lower()"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 43,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "TGGAACATGTTGCCTGATCT\n"
+     ]
+    }
+   ],
+   "source": [
+    "# concatenate the first and last 10 nucleotides\n",
+    "print dna.seq[:10] + dna.seq[-10:]"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "source": [
+    "But also has more sequence-specific methods"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 44,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "ACCTTGTACAGGGCGATCGAAGAAGAACGATCGTCTAAAAAAGTCAACTAGCAGTGTACGCCATCTGATGGGTTCCACACTGATGAGCGTACGGACTAGA\n"
+     ]
+    }
+   ],
+   "source": [
+    "# complement\n",
+    "print dna.seq.complement()"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 45,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "AGATCAGGCATGCGAGTAGTCACACCTTGGGTAGTCTACCGCATGTGACGATCAACTGAAAAAATCTGCTAGCAAGAAGAAGCTAGCGGGACATGTTCCA\n"
+     ]
+    }
+   ],
+   "source": [
+    "# reverse complement\n",
+    "print dna.seq.reverse_complement()"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 53,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "UGGAACAUGUCCCGCUAGCUUCUUCUUGCUAGCAGAUUUUUUCAGUUGAUCGUCACAUGCGGUAGACUACCCAAGGUGUGACUACUCGCAUGCCUGAUCU\n"
+     ]
+    }
+   ],
+   "source": [
+    "# transcribe from DNA to RNA\n",
+    "rna = dna.seq.transcribe()\n",
+    "print rna"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 63,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "WNMSR*LLLASRFFQLIVTCGRLPKV*LLACLI\n"
+     ]
+    }
+   ],
+   "source": [
+    "# Translate from nucleotide to protein\n",
+    "protein = dna.seq.translate()\n",
+    "print protein"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "slide"
+    }
+   },
+   "source": [
+    "Sequence records can easily be written to a file.\n",
+    "\n",
+    "Specifying the file type allows conversion between different formats.\n",
+    "\n",
+    "For example, to convert from a fastq file to fasta format:"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 66,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "fragment"
+    }
+   },
+   "outputs": [
+    {
+     "data": {
+      "text/plain": [
+       "1"
+      ]
+     },
+     "execution_count": 66,
+     "metadata": {},
+     "output_type": "execute_result"
+    }
+   ],
+   "source": [
+    "records = SeqIO.parse(\"../data/easy.fastq\", \"fastq\")\n",
+    "SeqIO.write(records, \"tmp.fasta\", \"fasta\")"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "slide"
+    }
+   },
+   "source": [
+    "# Remote files\n",
+    "\n",
+    "NCBI allow for remote querying of their Entrez database, and Biopython allows us to use their services from within python.\n",
+    "\n",
+    "We can use the Entrez.efetch utility to retrieve various records from one of NCBI's databases.\n",
+    "\n",
+    "A full list of these services and their documentation can be found on the [Entrez utilities help page](https://www.ncbi.nlm.nih.gov/books/NBK25500/)"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 69,
+   "metadata": {
+    "collapsed": true,
+    "slideshow": {
+     "slide_type": "fragment"
+    }
+   },
+   "outputs": [],
+   "source": [
+    "from Bio import Entrez"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "fragment"
+    }
+   },
+   "source": [
+    "IMPORTANT:\n",
+    "\n",
+    "To monitor potential excessive use of their services, NCBI requests you to specify your email address with each request.\n",
+    "\n",
+    "With Biopython, you can set it once for your session like this:"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 70,
+   "metadata": {
+    "collapsed": true,
+    "slideshow": {
+     "slide_type": "fragment"
+    }
+   },
+   "outputs": [],
+   "source": [
+    "Entrez.email = 'python@lumc.nl'"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "source": [
+    "Now we can make a query of the database.\n",
+    "\n",
+    "The Entrez.efetch function returns a file-like handle that instead of pointing to a local file, points to a remote resource."
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 77,
+   "metadata": {
+    "collapsed": true,
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [],
+   "source": [
+    "efetch_handle = Entrez.efetch(db=\"nucleotide\", id=\"NM_005804\",\n",
+    "                              rettype=\"gb\", retmode=\"text\")"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "source": [
+    "We can use the handle as if it were a normal file handle opened with ```open(\"filename\", \"r\")```, and read from it using SeqIO.read()"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 78,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "ID: NM_005804.3\n",
+      "Name: NM_005804\n",
+      "Description: Homo sapiens DExD-box helicase 39A (DDX39A), transcript variant 1, mRNA\n",
+      "Number of features: 25\n",
+      "/comment=REVIEWED REFSEQ: This record has been curated by NCBI staff. The\n",
+      "reference sequence was derived from DA432925.1, BC001009.2 and\n",
+      "BM792110.1.\n",
+      "This sequence is a reference standard in the RefSeqGene project.\n",
+      "On Oct 14, 2010 this sequence version replaced gi:21040370.\n",
+      "Summary: This gene encodes a member of the DEAD box protein family.\n",
+      "These proteins are characterized by the conserved motif\n",
+      "Asp-Glu-Ala-Asp (DEAD) and are putative RNA helicases. They are\n",
+      "implicated in a number of cellular processes involving alteration\n",
+      "of RNA secondary structure, such as translation initiation, nuclear\n",
+      "and mitochondrial splicing, and ribosome and spliceosome assembly.\n",
+      "Based on their distribution patterns, some members of the DEAD box\n",
+      "protein family are believed to be involved in embryogenesis,\n",
+      "spermatogenesis, and cellular growth and division. This gene is\n",
+      "thought to play a role in the prognosis of patients with\n",
+      "gastrointestinal stromal tumors. A pseudogene of this gene is\n",
+      "present on chromosome 13. Alternate splicing results in multiple\n",
+      "transcript variants. Additional alternatively spliced transcript\n",
+      "variants of this gene have been described, but their full-length\n",
+      "nature is not known. [provided by RefSeq, Sep 2013].\n",
+      "Transcript Variant: This variant (1) represents the longer\n",
+      "transcript.\n",
+      "Publication Note:  This RefSeq record includes a subset of the\n",
+      "publications that are available for this gene. Please see the Gene\n",
+      "record to access additional publications.\n",
+      "                               SRR1163655.274234.1 [ECO:0000332]\n",
+      "                               SAMEA1965299, SAMEA1966682\n",
+      "                               [ECO:0000350]\n",
+      "COMPLETENESS: complete on the 3' end.\n",
+      "/source=Homo sapiens (human)\n",
+      "/taxonomy=['Eukaryota', 'Metazoa', 'Chordata', 'Craniata', 'Vertebrata', 'Euteleostomi', 'Mammalia', 'Eutheria', 'Euarchontoglires', 'Primates', 'Haplorrhini', 'Catarrhini', 'Hominidae', 'Homo']\n",
+      "/structured_comment=OrderedDict([('Evidence-Data', OrderedDict([('Transcript exon combination', 'SRR1163655.176131.1,'), ('RNAseq introns', 'mixed/partial sample support')]))])\n",
+      "/keywords=['RefSeq']\n",
+      "/references=[Reference(title='The RNA helicase DDX39B and its paralog DDX39A regulate androgen receptor splice variant AR-V7 generation', ...), Reference(title='Identification of DDX39A as a Potential Biomarker for Unfavorable Neuroblastoma Using a Proteomic Approach', ...), Reference(title='Up-regulation of DDX39 in human malignant pleural mesothelioma cell lines compared to normal pleural mesothelial cells', ...), Reference(title='The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts', ...), Reference(title='Clinical proteomics identified ATP-dependent RNA helicase DDX39 as a novel biomarker to predict poor prognosis of patients with gastrointestinal stromal tumor', ...), Reference(title='The closely related RNA helicases, UAP56 and URH49, preferentially form distinct mRNA export machineries and coordinately regulate mitotic progression', ...), Reference(title='Hcc-1 is a novel component of the nuclear matrix with growth inhibitory function', ...), Reference(title='Growth-regulated expression and G0-specific turnover of the mRNA that encodes URH49, a mammalian DExH/D box protein that is highly related to the mRNA export protein UAP56', ...), Reference(title='Analysis of a high-throughput yeast two-hybrid system and its use to predict the function of intracellular proteins encoded within the human MHC class III region', ...), Reference(title='The BAT1 gene in the MHC encodes an evolutionarily conserved putative nuclear RNA helicase of the DEAD family', ...)]\n",
+      "/accessions=['NM_005804']\n",
+      "/molecule_type=mRNA\n",
+      "/data_file_division=PRI\n",
+      "/date=11-JUN-2017\n",
+      "/organism=Homo sapiens\n",
+      "/sequence_version=3\n",
+      "/topology=linear\n",
+      "Seq('AGCAGCAGCCCGACGCAAGAGGCAGGAAGCGCAGCAACTCGTGTCTGAGCGCCC...AAA', IUPACAmbiguousDNA())\n"
+     ]
+    }
+   ],
+   "source": [
+    "ncbi_record = SeqIO.read(efetch_handle, 'genbank')\n",
+    "\n",
+    "print ncbi_record"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "source": [
+    "It is also possible to query for multiple records"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 79,
+   "metadata": {
+    "collapsed": true,
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [],
+   "source": [
+    "efetch_handle = Entrez.efetch(db=\"nucleotide\", id=[\"NM_005804\",\"NM_000967\"],\n",
+    "                              rettype=\"gb\", retmode=\"text\")"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "source": [
+    "Which can then be iterated over using ```SeqIO.parse```"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 81,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "NM_005804.3 Homo sapiens DExD-box helicase 39A (DDX39A), transcript variant 1, mRNA\n",
+      "NM_000967.3 Homo sapiens ribosomal protein L3 (RPL3), transcript variant 1, mRNA\n"
+     ]
+    }
+   ],
+   "source": [
+    "for record in SeqIO.parse(efetch_handle, 'genbank'):\n",
+    "    print record.id, record.description"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "slide"
+    }
+   },
+   "source": [
+    "# Remote Tools\n",
+    "\n",
+    "It is possible to use Biopyton with remote tools.\n",
+    "\n",
+    "For example, we can submit a BLAST search to the NCBI service. ([Documentation here](https://www.ncbi.nlm.nih.gov/BLAST/Doc/urlapi.html))\n",
+    "\n",
+    "We will use qblast function in the Bio.Blast.NCBIWWW module to perform a BLAST search using the record we retrieved earlier.\n",
+    "\n",
+    "NOTE: It can take some time for the search results to become available"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 89,
+   "metadata": {
+    "collapsed": true,
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [],
+   "source": [
+    "from Bio.Blast.NCBIWWW import qblast\n",
+    "blast_handle = qblast('blastn', 'refseq_mrna', ncbi_record.seq)"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "source": [
+    "We can the read from the file handle using the ```Bio.SearchIO``` module."
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 90,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "Program: blastn (2.7.0+)\n",
+      "  Query: No (1558)\n",
+      "         definition line\n",
+      " Target: refseq_mrna\n",
+      "   Hits: ----  -----  ----------------------------------------------------------\n",
+      "            #  # HSP  ID + description\n",
+      "         ----  -----  ----------------------------------------------------------\n",
+      "            0      1  gi|308522777|ref|NM_005804.3|  Homo sapiens DExD-box he...\n",
+      "            1      1  gi|1034056594|ref|XM_016946961.1|  PREDICTED: Pan trogl...\n",
+      "            2      1  gi|1034130164|ref|XM_016935303.1|  PREDICTED: Pan trogl...\n",
+      "            3      1  gi|675689963|ref|XM_003807080.2|  PREDICTED: Pan panisc...\n",
+      "            4      1  gi|1099186172|ref|XM_004060164.2|  PREDICTED: Gorilla g...\n",
+      "            5      1  gi|686757516|ref|XM_002828787.3|  PREDICTED: Pongo abel...\n",
+      "            6      1  gi|795239725|ref|XM_011953207.1|  PREDICTED: Colobus an...\n",
+      "            7      1  gi|1059109912|ref|XM_017851234.1|  PREDICTED: Rhinopith...\n",
+      "            8      1  gi|724815869|ref|XM_010361572.1|  PREDICTED: Rhinopithe...\n",
+      "            9      1  gi|1220191829|ref|XM_009193704.2|  PREDICTED: Papio anu...\n",
+      "           10      1  gi|982311930|ref|XM_005588244.2|  PREDICTED: Macaca fas...\n",
+      "           11      1  gi|967496221|ref|XM_015123082.1|  PREDICTED: Macaca mul...\n",
+      "           12      1  gi|768000518|ref|XM_011527620.1|  PREDICTED: Homo sapie...\n",
+      "           13      1  gi|635036575|ref|XM_007995524.1|  PREDICTED: Chlorocebu...\n",
+      "           14      1  gi|795271240|ref|XM_011768647.1|  PREDICTED: Macaca nem...\n",
+      "           15      1  gi|795144436|ref|XM_011981779.1|  PREDICTED: Mandrillus...\n",
+      "           16      1  gi|1034130166|ref|XM_016935304.1|  PREDICTED: Pan trogl...\n",
+      "           17      1  gi|1034056596|ref|XM_016946962.1|  PREDICTED: Pan trogl...\n",
+      "           18      1  gi|795433285|ref|XM_012094155.1|  PREDICTED: Cercocebus...\n",
+      "           19      1  gi|795433280|ref|XM_012094154.1|  PREDICTED: Cercocebus...\n",
+      "           20      1  gi|795239720|ref|XM_011953206.1|  PREDICTED: Colobus an...\n",
+      "           21      1  gi|1059109914|ref|XM_017851235.1|  PREDICTED: Rhinopith...\n",
+      "           22      1  gi|1220191830|ref|XM_021930788.1|  PREDICTED: Papio anu...\n",
+      "           23      1  gi|685606530|ref|XM_009193706.1|  PREDICTED: Papio anub...\n",
+      "           24      1  gi|1220191832|ref|XM_017952263.2|  PREDICTED: Papio anu...\n",
+      "           25      1  gi|982311931|ref|XM_005588245.2|  PREDICTED: Macaca fas...\n",
+      "           26      1  gi|967496225|ref|XM_015123084.1|  PREDICTED: Macaca mul...\n",
+      "           27      1  gi|967496223|ref|XM_015123083.1|  PREDICTED: Macaca mul...\n",
+      "           28      1  gi|967496227|ref|XM_015123085.1|  PREDICTED: Macaca mul...\n",
+      "           29      1  gi|795271249|ref|XM_011768705.1|  PREDICTED: Macaca nem...\n",
+      "           ~~~\n",
+      "           47      1  gi|826285426|ref|XM_012641398.1|  PREDICTED: Propithecu...\n",
+      "           48      1  gi|947308602|ref|XM_006161013.2|  PREDICTED: Tupaia chi...\n",
+      "           49      1  gi|1220191833|ref|XM_021930789.1|  PREDICTED: Papio anu...\n"
+     ]
+    }
+   ],
+   "source": [
+    "from Bio import SearchIO\n",
+    "qresult = SearchIO.read(blast_handle, 'blast-xml')\n",
+    "print qresult"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 92,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "Query: No\n",
+      "       definition line\n",
+      "  Hit: gi|308522777|ref|NM_005804.3| (1558)\n",
+      "       Homo sapiens DExD-box helicase 39A (DDX39A), transcript variant 1, mRNA\n",
+      " HSPs: ----  --------  ---------  ------  ---------------  ---------------------\n",
+      "          #   E-value  Bit score    Span      Query range              Hit range\n",
+      "       ----  --------  ---------  ------  ---------------  ---------------------\n",
+      "          0         0    2810.93    1558         [0:1558]               [0:1558]\n"
+     ]
+    }
+   ],
+   "source": [
+    "print qresult[0]"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 94,
+   "metadata": {
+    "slideshow": {
+     "slide_type": "subslide"
+    }
+   },
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "Query: No\n",
+      "       definition line\n",
+      "  Hit: gi|1034056594|ref|XM_016946961.1| (1530)\n",
+      "       PREDICTED: Pan troglodytes ATP-dependent RNA helicase DDX39A (LOC1079...\n",
+      " HSPs: ----  --------  ---------  ------  ---------------  ---------------------\n",
+      "          #   E-value  Bit score    Span      Query range              Hit range\n",
+      "       ----  --------  ---------  ------  ---------------  ---------------------\n",
+      "          0         0    2695.52    1519         [0:1519]              [11:1530]\n"
+     ]
+    }
+   ],
+   "source": [
+    "print qresult[1]"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "slide"
+    }
+   },
+   "source": [
+    "# That was just an overview\n",
+    "\n",
+    "This lesson was just a small taste of what can be done with Biopython.\n",
+    "\n",
+    "I strongly recommend looking at the [Biopython 'cookbook'](http://biopython.org/DIST/docs/tutorial/Tutorial.html) to get an idea of the wide range of things that you can do with it."
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {
+    "slideshow": {
+     "slide_type": "fragment"
+    }
+   },
+   "source": [
+    "The lesson was based on previous material by [Wibowo Arindrarto](mailto://w.arindrarto@lumc.nl) and Martijn Vermaat.\n",
+    "\n",
+    "License: [Creative Commons Attribution 3.0 License (CC-by)](http://creativecommons.org/licenses/by/3.0)"
+   ]
+  }
+ ],
+ "metadata": {
+  "celltoolbar": "Slideshow",
+  "kernelspec": {
+   "display_name": "Python 2",
+   "language": "python",
+   "name": "python2"
+  },
+  "language_info": {
+   "codemirror_mode": {
+    "name": "ipython",
+    "version": 2
+   },
+   "file_extension": ".py",
+   "mimetype": "text/x-python",
+   "name": "python",
+   "nbconvert_exporter": "python",
+   "pygments_lexer": "ipython2",
+   "version": "2.7.13"
+  }
+ },
+ "nbformat": 4,
+ "nbformat_minor": 2
+}
-- 
GitLab