diff --git a/BioPython/Biopython.ipynb b/BioPython/Biopython.ipynb
new file mode 100644
index 0000000000000000000000000000000000000000..4819b54bf12e10d10d2dbf477374b05011611ba0
--- /dev/null
+++ b/BioPython/Biopython.ipynb
@@ -0,0 +1,861 @@
+{
+ "cells": [
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "slide"
+ }
+ },
+ "source": [
+ "# Biopython\n",
+ "\n",
+ "\n",
+ "\n",
+ "## A quick overview\n",
+ "### [Guy Allard](mailto://w.g.allard@lumc.nl)"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "slide"
+ }
+ },
+ "source": [
+ "# What is Biopython?\n",
+ "\n",
+ "## 'Python Tools for Computational Molecular Biology'\n",
+ "\n",
+ "- Fully open-source\n",
+ "- Actively developed\n",
+ "- Large community"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "slide"
+ }
+ },
+ "source": [
+ "# What can it do?\n",
+ "\n",
+ "Modules, classes and functions for manipulating biological data\n",
+ "\n",
+ "- File parsers and writers.\n",
+ " - Sequence files: fasta, fastq, genbank, abi, sff, etc.\n",
+ " - Alignment files: clustal, emboss, phylip, nexus, etc.\n",
+ " - Sequence search outputs: BLAST, HMMER, BLAT, etc.\n",
+ " - Phylogenetic trees: newick, nexus, phyloxml, etc.\n",
+ " - Sequence motifs: AlignAce, TRANSFAC, etc.\n",
+ " - Others: PDB files, etc.\n",
+ "- Access to remote resources (e.g., Entrez, NCBI BLAST).\n",
+ "- Application wrappers.\n",
+ "- A simple graphing tool.\n",
+ "- Simple algorithms (e.g., pairwise alignment, cluster analysis).\n",
+ "- References such as codon tables and IUPAC sequences."
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "slide"
+ }
+ },
+ "source": [
+ "# Where can I find more information?\n",
+ "\n",
+ "- [Biopython Homepage](http://biopython.org/)\n",
+ "- [Biopython development repository](http://github.com/biopython/biopython)\n",
+ "- [Biopython mailing list](http://lists.open-bio.org/pipermail/biopython/)\n",
+ "- [Biopython 'cookbook'](http://biopython.org/DIST/docs/tutorial/Tutorial.html) (essential reading!)"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "slide"
+ }
+ },
+ "source": [
+ "# Manipulating Sequence Data\n",
+ "\n",
+ "## Bio.SeqIO\n",
+ "\n",
+ "Input and output of sequence files.\n",
+ "\n",
+ "- SeqIO.read\n",
+ " - Read a file containing a single sequence\n",
+ "- SeqIO.parse \n",
+ " - Iterate over all sequences in a sequence file\n",
+ "- SeqIO.write\n",
+ " - write sequences to a file"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 38,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "ID: 1\n",
+ "Name: 1\n",
+ "Description: 1\n",
+ "Number of features: 0\n",
+ "Seq('TGGAACATGTCCCGCTAGCTTCTTCTTGCTAGCAGATTTTTTCAGTTGATCGTC...TCT', SingleLetterAlphabet())\n"
+ ]
+ }
+ ],
+ "source": [
+ "from Bio import SeqIO\n",
+ "\n",
+ "# read the first sequence\n",
+ "for record in SeqIO.parse(\"../data/records.fa\", \"fasta\"):\n",
+ " dna = record\n",
+ " break\n",
+ "\n",
+ "print dna"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "source": [
+ "Each record is an object with several fields, including:\n",
+ "\n",
+ "- record.id\n",
+ " - the sequence id\n",
+ "- record.name\n",
+ " - sequence name, usually the same as the id\n",
+ "- record.description\n",
+ " - sequence description\n",
+ "\n",
+ "The actual sequence is a separate object contained within the record which can be accessed using record.seq\n",
+ "\n",
+ "The sequence has an 'alphabet' associated with it which defines which letters are allowed.\n",
+ "\n",
+ "Different alphabets are used for DNA, RNA, protein etc."
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 39,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "TGGAACATGTCCCGCTAGCTTCTTCTTGCTAGCAGATTTTTTCAGTTGATCGTCACATGCGGTAGACTACCCAAGGTGTGACTACTCGCATGCCTGATCT\n"
+ ]
+ }
+ ],
+ "source": [
+ "print dna.seq"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "source": [
+ "There are lots of built in methods that can be used to manipulate the sequence\n",
+ "\n",
+ "The sequence acts like a string in many ways"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 40,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "length: 100\n"
+ ]
+ }
+ ],
+ "source": [
+ "# get the length of the sequence\n",
+ "print \"length: \", len(dna.seq)"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 41,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "TGGAACATGT\n"
+ ]
+ }
+ ],
+ "source": [
+ "# slice and dice\n",
+ "print dna.seq[:10]"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 42,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "tggaacatgtcccgctagcttcttcttgctagcagattttttcagttgatcgtcacatgcggtagactacccaaggtgtgactactcgcatgcctgatct\n"
+ ]
+ }
+ ],
+ "source": [
+ "# change the case\n",
+ "print dna.seq.lower()"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 43,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "TGGAACATGTTGCCTGATCT\n"
+ ]
+ }
+ ],
+ "source": [
+ "# concatenate the first and last 10 nucleotides\n",
+ "print dna.seq[:10] + dna.seq[-10:]"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "source": [
+ "But also has more sequence-specific methods"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 44,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "ACCTTGTACAGGGCGATCGAAGAAGAACGATCGTCTAAAAAAGTCAACTAGCAGTGTACGCCATCTGATGGGTTCCACACTGATGAGCGTACGGACTAGA\n"
+ ]
+ }
+ ],
+ "source": [
+ "# complement\n",
+ "print dna.seq.complement()"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 45,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "AGATCAGGCATGCGAGTAGTCACACCTTGGGTAGTCTACCGCATGTGACGATCAACTGAAAAAATCTGCTAGCAAGAAGAAGCTAGCGGGACATGTTCCA\n"
+ ]
+ }
+ ],
+ "source": [
+ "# reverse complement\n",
+ "print dna.seq.reverse_complement()"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 53,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "UGGAACAUGUCCCGCUAGCUUCUUCUUGCUAGCAGAUUUUUUCAGUUGAUCGUCACAUGCGGUAGACUACCCAAGGUGUGACUACUCGCAUGCCUGAUCU\n"
+ ]
+ }
+ ],
+ "source": [
+ "# transcribe from DNA to RNA\n",
+ "rna = dna.seq.transcribe()\n",
+ "print rna"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 63,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "WNMSR*LLLASRFFQLIVTCGRLPKV*LLACLI\n"
+ ]
+ }
+ ],
+ "source": [
+ "# Translate from nucleotide to protein\n",
+ "protein = dna.seq.translate()\n",
+ "print protein"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "slide"
+ }
+ },
+ "source": [
+ "Sequence records can easily be written to a file.\n",
+ "\n",
+ "Specifying the file type allows conversion between different formats.\n",
+ "\n",
+ "For example, to convert from a fastq file to fasta format:"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 66,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "fragment"
+ }
+ },
+ "outputs": [
+ {
+ "data": {
+ "text/plain": [
+ "1"
+ ]
+ },
+ "execution_count": 66,
+ "metadata": {},
+ "output_type": "execute_result"
+ }
+ ],
+ "source": [
+ "records = SeqIO.parse(\"../data/easy.fastq\", \"fastq\")\n",
+ "SeqIO.write(records, \"tmp.fasta\", \"fasta\")"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "slide"
+ }
+ },
+ "source": [
+ "# Remote files\n",
+ "\n",
+ "NCBI allow for remote querying of their Entrez database, and Biopython allows us to use their services from within python.\n",
+ "\n",
+ "We can use the Entrez.efetch utility to retrieve various records from one of NCBI's databases.\n",
+ "\n",
+ "A full list of these services and their documentation can be found on the [Entrez utilities help page](https://www.ncbi.nlm.nih.gov/books/NBK25500/)"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 69,
+ "metadata": {
+ "collapsed": true,
+ "slideshow": {
+ "slide_type": "fragment"
+ }
+ },
+ "outputs": [],
+ "source": [
+ "from Bio import Entrez"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "fragment"
+ }
+ },
+ "source": [
+ "IMPORTANT:\n",
+ "\n",
+ "To monitor potential excessive use of their services, NCBI requests you to specify your email address with each request.\n",
+ "\n",
+ "With Biopython, you can set it once for your session like this:"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 70,
+ "metadata": {
+ "collapsed": true,
+ "slideshow": {
+ "slide_type": "fragment"
+ }
+ },
+ "outputs": [],
+ "source": [
+ "Entrez.email = 'python@lumc.nl'"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "source": [
+ "Now we can make a query of the database.\n",
+ "\n",
+ "The Entrez.efetch function returns a file-like handle that instead of pointing to a local file, points to a remote resource."
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 77,
+ "metadata": {
+ "collapsed": true,
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [],
+ "source": [
+ "efetch_handle = Entrez.efetch(db=\"nucleotide\", id=\"NM_005804\",\n",
+ " rettype=\"gb\", retmode=\"text\")"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "source": [
+ "We can use the handle as if it were a normal file handle opened with ```open(\"filename\", \"r\")```, and read from it using SeqIO.read()"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 78,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "ID: NM_005804.3\n",
+ "Name: NM_005804\n",
+ "Description: Homo sapiens DExD-box helicase 39A (DDX39A), transcript variant 1, mRNA\n",
+ "Number of features: 25\n",
+ "/comment=REVIEWED REFSEQ: This record has been curated by NCBI staff. The\n",
+ "reference sequence was derived from DA432925.1, BC001009.2 and\n",
+ "BM792110.1.\n",
+ "This sequence is a reference standard in the RefSeqGene project.\n",
+ "On Oct 14, 2010 this sequence version replaced gi:21040370.\n",
+ "Summary: This gene encodes a member of the DEAD box protein family.\n",
+ "These proteins are characterized by the conserved motif\n",
+ "Asp-Glu-Ala-Asp (DEAD) and are putative RNA helicases. They are\n",
+ "implicated in a number of cellular processes involving alteration\n",
+ "of RNA secondary structure, such as translation initiation, nuclear\n",
+ "and mitochondrial splicing, and ribosome and spliceosome assembly.\n",
+ "Based on their distribution patterns, some members of the DEAD box\n",
+ "protein family are believed to be involved in embryogenesis,\n",
+ "spermatogenesis, and cellular growth and division. This gene is\n",
+ "thought to play a role in the prognosis of patients with\n",
+ "gastrointestinal stromal tumors. A pseudogene of this gene is\n",
+ "present on chromosome 13. Alternate splicing results in multiple\n",
+ "transcript variants. Additional alternatively spliced transcript\n",
+ "variants of this gene have been described, but their full-length\n",
+ "nature is not known. [provided by RefSeq, Sep 2013].\n",
+ "Transcript Variant: This variant (1) represents the longer\n",
+ "transcript.\n",
+ "Publication Note: This RefSeq record includes a subset of the\n",
+ "publications that are available for this gene. Please see the Gene\n",
+ "record to access additional publications.\n",
+ " SRR1163655.274234.1 [ECO:0000332]\n",
+ " SAMEA1965299, SAMEA1966682\n",
+ " [ECO:0000350]\n",
+ "COMPLETENESS: complete on the 3' end.\n",
+ "/source=Homo sapiens (human)\n",
+ "/taxonomy=['Eukaryota', 'Metazoa', 'Chordata', 'Craniata', 'Vertebrata', 'Euteleostomi', 'Mammalia', 'Eutheria', 'Euarchontoglires', 'Primates', 'Haplorrhini', 'Catarrhini', 'Hominidae', 'Homo']\n",
+ "/structured_comment=OrderedDict([('Evidence-Data', OrderedDict([('Transcript exon combination', 'SRR1163655.176131.1,'), ('RNAseq introns', 'mixed/partial sample support')]))])\n",
+ "/keywords=['RefSeq']\n",
+ "/references=[Reference(title='The RNA helicase DDX39B and its paralog DDX39A regulate androgen receptor splice variant AR-V7 generation', ...), Reference(title='Identification of DDX39A as a Potential Biomarker for Unfavorable Neuroblastoma Using a Proteomic Approach', ...), Reference(title='Up-regulation of DDX39 in human malignant pleural mesothelioma cell lines compared to normal pleural mesothelial cells', ...), Reference(title='The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts', ...), Reference(title='Clinical proteomics identified ATP-dependent RNA helicase DDX39 as a novel biomarker to predict poor prognosis of patients with gastrointestinal stromal tumor', ...), Reference(title='The closely related RNA helicases, UAP56 and URH49, preferentially form distinct mRNA export machineries and coordinately regulate mitotic progression', ...), Reference(title='Hcc-1 is a novel component of the nuclear matrix with growth inhibitory function', ...), Reference(title='Growth-regulated expression and G0-specific turnover of the mRNA that encodes URH49, a mammalian DExH/D box protein that is highly related to the mRNA export protein UAP56', ...), Reference(title='Analysis of a high-throughput yeast two-hybrid system and its use to predict the function of intracellular proteins encoded within the human MHC class III region', ...), Reference(title='The BAT1 gene in the MHC encodes an evolutionarily conserved putative nuclear RNA helicase of the DEAD family', ...)]\n",
+ "/accessions=['NM_005804']\n",
+ "/molecule_type=mRNA\n",
+ "/data_file_division=PRI\n",
+ "/date=11-JUN-2017\n",
+ "/organism=Homo sapiens\n",
+ "/sequence_version=3\n",
+ "/topology=linear\n",
+ "Seq('AGCAGCAGCCCGACGCAAGAGGCAGGAAGCGCAGCAACTCGTGTCTGAGCGCCC...AAA', IUPACAmbiguousDNA())\n"
+ ]
+ }
+ ],
+ "source": [
+ "ncbi_record = SeqIO.read(efetch_handle, 'genbank')\n",
+ "\n",
+ "print ncbi_record"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "source": [
+ "It is also possible to query for multiple records"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 79,
+ "metadata": {
+ "collapsed": true,
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [],
+ "source": [
+ "efetch_handle = Entrez.efetch(db=\"nucleotide\", id=[\"NM_005804\",\"NM_000967\"],\n",
+ " rettype=\"gb\", retmode=\"text\")"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "source": [
+ "Which can then be iterated over using ```SeqIO.parse```"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 81,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "NM_005804.3 Homo sapiens DExD-box helicase 39A (DDX39A), transcript variant 1, mRNA\n",
+ "NM_000967.3 Homo sapiens ribosomal protein L3 (RPL3), transcript variant 1, mRNA\n"
+ ]
+ }
+ ],
+ "source": [
+ "for record in SeqIO.parse(efetch_handle, 'genbank'):\n",
+ " print record.id, record.description"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "slide"
+ }
+ },
+ "source": [
+ "# Remote Tools\n",
+ "\n",
+ "It is possible to use Biopyton with remote tools.\n",
+ "\n",
+ "For example, we can submit a BLAST search to the NCBI service. ([Documentation here](https://www.ncbi.nlm.nih.gov/BLAST/Doc/urlapi.html))\n",
+ "\n",
+ "We will use qblast function in the Bio.Blast.NCBIWWW module to perform a BLAST search using the record we retrieved earlier.\n",
+ "\n",
+ "NOTE: It can take some time for the search results to become available"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 89,
+ "metadata": {
+ "collapsed": true,
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [],
+ "source": [
+ "from Bio.Blast.NCBIWWW import qblast\n",
+ "blast_handle = qblast('blastn', 'refseq_mrna', ncbi_record.seq)"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "source": [
+ "We can the read from the file handle using the ```Bio.SearchIO``` module."
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 90,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "Program: blastn (2.7.0+)\n",
+ " Query: No (1558)\n",
+ " definition line\n",
+ " Target: refseq_mrna\n",
+ " Hits: ---- ----- ----------------------------------------------------------\n",
+ " # # HSP ID + description\n",
+ " ---- ----- ----------------------------------------------------------\n",
+ " 0 1 gi|308522777|ref|NM_005804.3| Homo sapiens DExD-box he...\n",
+ " 1 1 gi|1034056594|ref|XM_016946961.1| PREDICTED: Pan trogl...\n",
+ " 2 1 gi|1034130164|ref|XM_016935303.1| PREDICTED: Pan trogl...\n",
+ " 3 1 gi|675689963|ref|XM_003807080.2| PREDICTED: Pan panisc...\n",
+ " 4 1 gi|1099186172|ref|XM_004060164.2| PREDICTED: Gorilla g...\n",
+ " 5 1 gi|686757516|ref|XM_002828787.3| PREDICTED: Pongo abel...\n",
+ " 6 1 gi|795239725|ref|XM_011953207.1| PREDICTED: Colobus an...\n",
+ " 7 1 gi|1059109912|ref|XM_017851234.1| PREDICTED: Rhinopith...\n",
+ " 8 1 gi|724815869|ref|XM_010361572.1| PREDICTED: Rhinopithe...\n",
+ " 9 1 gi|1220191829|ref|XM_009193704.2| PREDICTED: Papio anu...\n",
+ " 10 1 gi|982311930|ref|XM_005588244.2| PREDICTED: Macaca fas...\n",
+ " 11 1 gi|967496221|ref|XM_015123082.1| PREDICTED: Macaca mul...\n",
+ " 12 1 gi|768000518|ref|XM_011527620.1| PREDICTED: Homo sapie...\n",
+ " 13 1 gi|635036575|ref|XM_007995524.1| PREDICTED: Chlorocebu...\n",
+ " 14 1 gi|795271240|ref|XM_011768647.1| PREDICTED: Macaca nem...\n",
+ " 15 1 gi|795144436|ref|XM_011981779.1| PREDICTED: Mandrillus...\n",
+ " 16 1 gi|1034130166|ref|XM_016935304.1| PREDICTED: Pan trogl...\n",
+ " 17 1 gi|1034056596|ref|XM_016946962.1| PREDICTED: Pan trogl...\n",
+ " 18 1 gi|795433285|ref|XM_012094155.1| PREDICTED: Cercocebus...\n",
+ " 19 1 gi|795433280|ref|XM_012094154.1| PREDICTED: Cercocebus...\n",
+ " 20 1 gi|795239720|ref|XM_011953206.1| PREDICTED: Colobus an...\n",
+ " 21 1 gi|1059109914|ref|XM_017851235.1| PREDICTED: Rhinopith...\n",
+ " 22 1 gi|1220191830|ref|XM_021930788.1| PREDICTED: Papio anu...\n",
+ " 23 1 gi|685606530|ref|XM_009193706.1| PREDICTED: Papio anub...\n",
+ " 24 1 gi|1220191832|ref|XM_017952263.2| PREDICTED: Papio anu...\n",
+ " 25 1 gi|982311931|ref|XM_005588245.2| PREDICTED: Macaca fas...\n",
+ " 26 1 gi|967496225|ref|XM_015123084.1| PREDICTED: Macaca mul...\n",
+ " 27 1 gi|967496223|ref|XM_015123083.1| PREDICTED: Macaca mul...\n",
+ " 28 1 gi|967496227|ref|XM_015123085.1| PREDICTED: Macaca mul...\n",
+ " 29 1 gi|795271249|ref|XM_011768705.1| PREDICTED: Macaca nem...\n",
+ " ~~~\n",
+ " 47 1 gi|826285426|ref|XM_012641398.1| PREDICTED: Propithecu...\n",
+ " 48 1 gi|947308602|ref|XM_006161013.2| PREDICTED: Tupaia chi...\n",
+ " 49 1 gi|1220191833|ref|XM_021930789.1| PREDICTED: Papio anu...\n"
+ ]
+ }
+ ],
+ "source": [
+ "from Bio import SearchIO\n",
+ "qresult = SearchIO.read(blast_handle, 'blast-xml')\n",
+ "print qresult"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 92,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "Query: No\n",
+ " definition line\n",
+ " Hit: gi|308522777|ref|NM_005804.3| (1558)\n",
+ " Homo sapiens DExD-box helicase 39A (DDX39A), transcript variant 1, mRNA\n",
+ " HSPs: ---- -------- --------- ------ --------------- ---------------------\n",
+ " # E-value Bit score Span Query range Hit range\n",
+ " ---- -------- --------- ------ --------------- ---------------------\n",
+ " 0 0 2810.93 1558 [0:1558] [0:1558]\n"
+ ]
+ }
+ ],
+ "source": [
+ "print qresult[0]"
+ ]
+ },
+ {
+ "cell_type": "code",
+ "execution_count": 94,
+ "metadata": {
+ "slideshow": {
+ "slide_type": "subslide"
+ }
+ },
+ "outputs": [
+ {
+ "name": "stdout",
+ "output_type": "stream",
+ "text": [
+ "Query: No\n",
+ " definition line\n",
+ " Hit: gi|1034056594|ref|XM_016946961.1| (1530)\n",
+ " PREDICTED: Pan troglodytes ATP-dependent RNA helicase DDX39A (LOC1079...\n",
+ " HSPs: ---- -------- --------- ------ --------------- ---------------------\n",
+ " # E-value Bit score Span Query range Hit range\n",
+ " ---- -------- --------- ------ --------------- ---------------------\n",
+ " 0 0 2695.52 1519 [0:1519] [11:1530]\n"
+ ]
+ }
+ ],
+ "source": [
+ "print qresult[1]"
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "slide"
+ }
+ },
+ "source": [
+ "# That was just an overview\n",
+ "\n",
+ "This lesson was just a small taste of what can be done with Biopython.\n",
+ "\n",
+ "I strongly recommend looking at the [Biopython 'cookbook'](http://biopython.org/DIST/docs/tutorial/Tutorial.html) to get an idea of the wide range of things that you can do with it."
+ ]
+ },
+ {
+ "cell_type": "markdown",
+ "metadata": {
+ "slideshow": {
+ "slide_type": "fragment"
+ }
+ },
+ "source": [
+ "The lesson was based on previous material by [Wibowo Arindrarto](mailto://w.arindrarto@lumc.nl) and Martijn Vermaat.\n",
+ "\n",
+ "License: [Creative Commons Attribution 3.0 License (CC-by)](http://creativecommons.org/licenses/by/3.0)"
+ ]
+ }
+ ],
+ "metadata": {
+ "celltoolbar": "Slideshow",
+ "kernelspec": {
+ "display_name": "Python 2",
+ "language": "python",
+ "name": "python2"
+ },
+ "language_info": {
+ "codemirror_mode": {
+ "name": "ipython",
+ "version": 2
+ },
+ "file_extension": ".py",
+ "mimetype": "text/x-python",
+ "name": "python",
+ "nbconvert_exporter": "python",
+ "pygments_lexer": "ipython2",
+ "version": "2.7.13"
+ }
+ },
+ "nbformat": 4,
+ "nbformat_minor": 2
+}