diff --git a/05 - IPython Notebook.ipynb b/05 - IPython Notebook.ipynb index 7d8a8e98b1bedd068895ff3d1d8db9341a721066..6988ad77bb9e240416cebcd9ae8605b2016576b1 100644 --- a/05 - IPython Notebook.ipynb +++ b/05 - IPython Notebook.ipynb @@ -39,7 +39,7 @@ "level": 2, "metadata": {}, "source": [ - "Requirements on scientific computing" + "Requirements on scientific computing\n" ] }, { @@ -820,7 +820,7 @@ "level": 1, "metadata": {}, "source": [ - "\u00a7 Excercise : My first Notebook (1)" + "\u00a7 Exercise : My first Notebook (1)" ] }, { @@ -837,7 +837,7 @@ " - Click on the current name (Untitled1) and edit this\n", "\n", "Add the code shown below to some **_code_** cells\n", - " - Add cells by pressen the '+' button or ALT+ENTER\n", + " - Add cells by pressing the '+' button or ALT+ENTER\n", " - Remember the keyboard shortcuts or the help function ('h')\n", "\n", "\n", @@ -1219,7 +1219,7 @@ "cell_type": "markdown", "metadata": {}, "source": [ - "- Notebook has acceess to all the files down in the directory" + "- Notebook has access to all the files down in the directory" ] }, { @@ -1245,7 +1245,7 @@ "metadata": {}, "source": [ "<br></br><br></br>\n", - "Some other examples:" + "Embed videos using python code" ] }, { @@ -1284,7 +1284,7 @@ "output_type": "pyout", "prompt_number": 1, "text": [ - "<IPython.lib.display.YouTubeVideo at 0x3224890>" + "<IPython.lib.display.YouTubeVideo at 0x23c2890>" ] } ], @@ -1295,7 +1295,7 @@ "level": 1, "metadata": {}, "source": [ - "Plotting with matplotlib" + "Output plots with matplotlib " ] }, { @@ -1333,7 +1333,7 @@ "level": 1, "metadata": {}, "source": [ - "\u00a7 Excercise : My first Notebook (2)" + "\u00a7 Exercise : My first Notebook (2)" ] }, { @@ -1358,15 +1358,18 @@ ] }, { - "cell_type": "markdown", - "metadata": {}, - "source": [ + "cell_type": "code", + "collapsed": false, + "input": [ "### My next notebook\n", "\n", "This notebook is my first notebook with some experimental code.\n", "\n", "Author: [Michiel van Galen](mailto:m.van_galen@lumc.nl)" - ] + ], + "language": "python", + "metadata": {}, + "outputs": [] }, { "cell_type": "markdown", @@ -1442,7 +1445,7 @@ "level": 1, "metadata": {}, "source": [ - "\u00a7 Excercise : My first Notebook (3)\n", + "\u00a7 Exercise : My first Notebook (3)\n", " " ] }, @@ -1475,14 +1478,18 @@ "cell_type": "markdown", "metadata": {}, "source": [ - " - Think of function which can test if a sequence is palindromic\n", + " - Think of a function which can test if a sequence is palindromic\n", " - Use the functions 'complement' and 'reverse'\n", " - Nicely formatted mardown cell(s) explaining the notebook\n", " - Add links as references like the one above\n", "\n", "**Bonus: Write a function which can test if there are short palindromic sequences in a longer piece of DNA**\n", "\n", - "- Try to find the palindromic seqeuences of at least length 6 in the sequence : GGGAGACATGTCTAACCGTTGTAAAA\n", + "- Try to find the palindromic sequences of at least length 6 in the sequence :\n", + " -GGGAGACATGTCTAACCGTTGTAAAA\n", + " \n", + "Hints:\n", + "\n", "- Implement your current functions in a new function\n", "- Begin to iterate over a sequence and find a palindrome of size 2\n", "- Continue to work from there and expand your test\n",