diff --git a/practical_one/practical1_toon.jpg b/practical_one/practical1_toon.jpg
new file mode 120000
index 0000000000000000000000000000000000000000..11a83eb3ac1176af31750d3b2c73fcdc52ed4ed2
--- /dev/null
+++ b/practical_one/practical1_toon.jpg
@@ -0,0 +1 @@
+../presentation-pics/practical1_toon.jpg
\ No newline at end of file
diff --git a/practical_one/practical_one.tex b/practical_one/practical_one.tex
index 05b26090e1ca076551f333ccde73127962223593..19c97398e6043b1eb599b495c73e44ce0c8b4891 100644
--- a/practical_one/practical_one.tex
+++ b/practical_one/practical_one.tex
@@ -2,13 +2,10 @@
\usepackage{fullpage}
\usepackage{listings}
\usepackage{graphicx}
-
\frenchspacing
\setlength{\parindent}{0pt}
\pagestyle{empty}
-
\renewcommand\_{\textunderscore\,}
-
\let\tempitemize=\itemize
\renewcommand\itemize{
\vspace{-5pt}
@@ -25,169 +22,41 @@
\date{Tuesday, 1 April 2014}
\author{Jeroen Laros, Michiel van Galen}
-
\begin{document}
-
\maketitle
\thispagestyle{empty}
-%\begin{figure}[h!]
-% \centering
-% \includegraphics[width=0.27\textwidth]{divide-and-conquer1.eps}
-%\end{figure}
-
-\section*{Introduction}
-We have a fellow researcher who is in desperate need of help. We get a fasta
-file containing probes used for an experiment. However, it's also contaminated
-with unused probes we don't want. Additionally, the poor colleague also needs
-to create a bed track (explained later) from this fasta file, and maybe some
-statistics on the contents. Obviously we can help him out with the conversion.
-
+\begin{figure}[h!]
+ \centering
+ \includegraphics[width=0.55\textwidth]{practical1_toon}
+\end{figure}
+
+% Introduction
+\section{Introduction}
+In this practical we will teach you how to use a specific set of tools to analyze a small human short read dataset.
\medskip
-\begin{lstlisting}[caption=Input file]
-
-The fasta header has this format:
-
->chrom
-start
-gene_id
-exon_nr
-unknown
-unknown
-strand
-unknown
-strand
-length
-
-Resulting in records like this:
-
->chr1_66999824_NM_032291_exon_0_0_chr1_66999825_f_0_+_227
-ATTGATTAGCTATCTCCCGTAGATTCTGGAACTGCCGCGCAGTCGTCAAG
-
+% Command line practice
+\section{Use the command line}
+\begin{lstlisting}[caption=Caption]
+Some lstlisting
\end{lstlisting}
-
-A bed track can be used to visualize data in a genome browser or for
-intersections with other bed tracks or variant files. The output bed track
-should have this format and is preferably sorted:
-
-chrom [tab] start [tab] end [tab] more info space separated [$\backslash$n]
\medskip
-Meaning in this example we aim for something like this:
+% Quality control
+\section{Quality control with Fastqc}
-chr1 66999824 67000051 NM\_032291 exon\_0
-\medskip
-
-This could be done in one big oneliner but then we risk to loose control over
-what we are are doing. Instead, let's break this problem down step by step to
-divide and conquer.
+% Alignment
+\section{Alignment with Bowtie}
-\section*{Remove sequences}
-Download the input file from the website and have a look at it. We don't need
-the sequences for the final bed track. Let's first get rid of those.
-\begin{itemize}
- \item Header lines start with a '\texttt{>}'.
- \item Can you get only the headers with AWK?
- \item Can you do this with grep?
- \item Save the output and continue with the next step.
-\end{itemize}
+% Variant calling
+\section{Variant calling with Samtools}
-\section*{Clean and sort}
-The researcher has unsorted data. A bed track sould be sorted. How can we fix
-this?
-\begin{itemize}
- \item Try use 'sort' and sort numerically. Will this work?
- \item Probably not. The data is cluttered, we need to clean this first.
-\end{itemize}
+% Annotation
+\section{Annotation with Ensembl VEP}
-We need to remove '\texttt{>chr}' and the first '\_'. We can do this with 'cut' and
-'sed'. This sed command will replace the first '\_' with a space. Use 'cut' to
-remove the '\texttt{>chr}', try with 'cut -c'. To cut everything after a
-certain character simply omit this. To cut from the third character with cut
-use '\texttt{cut -c3- file}'
-
-\begin{lstlisting}[caption=Sed to remove first underscore]
- $ sed 's/_/ /'
-\end{lstlisting}
-
-The output should now be valid for sort to work how we want it. Do the sorting
-and save the output to continue.
-
-\section*{Filter}
-Our colleague has still data from 'random' contigs and chromosome 17 in
-his file. He wants us to get rid of these. We can use inverted grep to do so.
-
-\begin{itemize}
- \item Get rid of lines which have 'random' in it, or start with '17'
- \item Use grep, with the invert option. Either at once or with two pipes.
- \item Save the output and continue.
-\end{itemize}
-
-\section*{Too many underscores}
-Now we can start preparing our final format. To do so, we need to get rid of
-all underscores to feed it easily to awk.
-\begin{itemize}
- \item Use 'tr' for this.
- \item Save the output.
-\end{itemize}
-
-\section*{Almost there}
-At this point we have all the fields we need, space separated. We only need to
-add up the 'length' field with the 'start' field to get the 'end'. Then we
-rejoin the gene\_ids and exon\_nr with and underscore. This is both perfectly
-doable with awk. Remember the first four fields need to be separated by tabs,
-the last two by spaces.
-
-\begin{itemize}
- \item Feed the file to awk and reformat the output.
- \item Print 'chr' and field 1.
- \item Then we need field 2.
- \item We need to sum field 2 and 13.
- \item Join field 3 and 4 with an '\_'.
- \item Likewise for field 5 and 6.
-\end{itemize}
-
-Output: chrX [tab] 48755194 [tab] 48755297 [tab] NM\_001032381 [space] exon\_0
-\medskip
-
-Congrats! You fixed the file for your colleague, he must be very happy already.
-
-\section*{Count}
-Only thing left is we want to know which exons each gene has. This can be done
-in both Bash and Awk using associative array. First we need to set IFS, then
-follow the steps and use your knowledge of these arrays to get what we need.
-
-\begin{lstlisting}[caption=Set IFS]
- $ IFS='
- '
-\end{lstlisting}
-
-\begin{itemize}
- \item Declare an associative array
- \item Print 'chr' and field 1.
- \item Now cut the field of interest from our bed file. Do this in a for loop.
- \item In bash we can put `a command` in backticks. This will be replaced with
- the output of that command.
- \item Then we need to put the gene and exon into separate variables. Use cut
- with the correct delimiter.
- \item Finally populate the array. Don't forget to append exons instead of
- overwriting them.
-\end{itemize}
-
-\begin{lstlisting}[caption=Bash backticks]
- We have a directory with some fasta files.
- $ ls *.fa
- ecoli.fa human.fa
-
- Then this command gets 'expanded'.
- $ cat `ls *.fa`
-
- The backticks will be replaced with the output of the command in between.
- Therefor, the previous command will in fact be executed like this:
-
- cat human.fa ecoli.fa
-\end{lstlisting}
+% End of practical
\medskip
-This is the end of the practical, thanks.
+This is the end of the practical. We hope you now got and idea how to work with
+a Linux terminal and running NGS tools. Thanks for participating!
\end{document}